Plant materials and treatments
The experiments were conducted in the greenhouse of the Chongqing Academy of Agricultural Sciences, Chongqing, China (29°36′N, 106°29′E). The common cultivar ‘Yunyan 87’ (N. tabacum, Yunnan Tobacco Research Institute, China) and K-efficient genotype tobacco ‘Wufeng No.2’ (Nicotiana tabacum, Yichang Tobacco Company of Hubei Province, China) were used in the present research. In order to ensure the success rate of grafting, the seeds of rootstock should be planted 7 days before the scion. The ‘split grafting’ was selected as the grafting method when six to eight true leaves had appeared on the seedlings of the rootstock. When the new leaves had grew by grafted plants, transplanted the plants into hydroponic box, with 12 seedlings planted per container. The nutrient solution for hydroponics was formulated as previous study [19]. Air pumps were adopted to supply oxygen to each container through a hose for oxygen supply to the tobacco seedlings during experiment. The plants were grown at 22.5 °C under a 16-h light/8-h dark cycle using fluorescent lamps with an average photosynthetic photon flux density (PPFD) of 300 µmol m− 2 s− 1 in the greenhouse. The relative humidity ranged from 60% to 95%.
Two K levels were used for the experiments: +K, sufficient supply (5 mmol L− 1) and -K, deficit (0.5 mmol L− 1), using K2SO4 as the substance source to adjust different K levels. Besides that, four graft treaments [Wufeng No.2 (W), W/Y (W grafted onto Y), Yunyan 87 (Y), and Y/W (Y grafted onto W)] were used in experiment. eight treatments were replicated 6 times with 12 plants in each replicate. The solutions were replaced every 4 d.
K content determination in the tobacco
The tobacco plants were cut into two sections at the hypocotyl below the cotyledon. The stem above the cotyledon was defined as the “Shoot,” while the stem below the cotyledon was defined as the “Root.” A flame atomic absorption spectrometer was adopted for determining K content in the dried samples (Varian AA-220FS, Thermo Fisher Scientific, USA) as previously described [43].
Root cell K+ channel inward current measurement
Fifteen days after transplanting, the fibrous roots of W and Y genotypes tobacco were collected and washed with deionized water, after then cut them into 5 mm segments. The treated sample was transferred to 1 ml of the enzymatic hydrolysate(1% cellulase, 0.15% pectinase, 0.8 mol L-1 mannitol, cell wash solution, pH 5.5-6.0), shaken for 2 h, 70 rpm, temperature 28 ° C. The enzyme hydrolysates were then filtered with a 200-mesh filter and rinsed twice with cell washing solution under dark conditions. The filtrate was collected, centrifuged for 5 min at 100 rpm, removed the supernatant and repeated twice. The sediment was the protoplasm sample.
Select a suitable hard thin glass tube, and use a two-step method to draw the microelectrode on the drawing instrument (Narishige Japan) and polish it. The inner diameter of the tip is about 0.5-1 µm, and the intracellular fluid is injected into it[100mmo1 L− 1 potassium glutamate, 2 mmo1 L− 1 magnesium chloride, 0.1 mmo1 L− 1 calcium chloride, 10 mmo1 L− 1 4-hydroxyethylpiperazine ethane sulfonic acid, 1.1 mmo1 L− 1 ethylene glycol double (2-aminoethyl ether)tetraacetic acid, 2 mmo1 L− 1 adenosine triphosphate, pH 7.2. Mannitol adjusts the osmolality to 800 mmo1 kg− 1]. The resistance of the electrode is 5–8 MΩ. Protoplasts were transferred to a sample pool containing 2 ml cell extracellular fluid(1 mmo1 L− 1 calcium chloride, 10mmo1 L− 1 potassium glutamate, 5mmo1 L− 1 2-morpholine ethanesulfonic acid, 4mmo1 L− 1 magnesium chloride, pH 6.0. Mannitol adjusts the osmolality to 900 mmo1 kg− 1). After forming a high-resistance seal (resistance 1–5 GΩ) between the tip of the glass microelectrode and the plasma membrane, begin to apply a negative pressure to the inner cavity of the electrode. During stimulation, the voltage was depolarized from − 130 mV to -10 mV, each stage was 20 mV, the duration was 2 s and the frequency was 0.2 Hz. Current signal and membrane capacitance were recorded by Axopatch-200B patch clamp amplifier, data acquisition card and Pclamp 6.0 software. The acquisition process was constant at room temperature (25 ± 1 °C). The channel current density was used to measure the whole cell current intensity (pA/pF, the ratio of current to cell capacitance) of each treatment, and the current amplitude was analyzed by I-V curve.
Measurement of K+ fluxes in transverse sections of the tobacco hypocotyls
Six plants of each grafting combination in the + K treatment were chosen to measure net K+-flux with noninvasive micro-test technology (NMT system BIO-IM; Younger Corp., Amherst, MA, USA), ASET 2.0 (Sciencewares, Falmouth, MA, USA) and iFluxes 1.0 (YoungerUSA, LLC, Amherst, MA, USA) software [44, 45], as described previously [46]. Net K+ flux was calculated by Fick’s law of diffusion [47].
Half of the plants were treated with 0.5 mmol L− 1 K2SO4 for 2 h before measurement to observe the short-term reaction of each grafting combination under K stress. The tobacco plants were cut into two sections at the hypocotyl below the cotyledon and then fixed in measuring solution with belts. The transverse section of the hypocotyl was immediately incubated in the measuring solution [0.1 mmol L− 1 CaCl2 and 0.3 mmol L− 1 2-ethanesulfonic acid (MES), pH 6] to equilibrate for 30 min. The equilibrated samples were then transferred to the measuring chamber filled with the solution containing either 0.5 mmol L− 1 K+ or 5 mmol L− 1 K+. The electrode was fixed at the center of the transverse section. Net K+ fluxes were measured under the experimental conditions for 20 min to decrease variability due to fluctuations. Each plant was measured once.
Measurement of K+ fluxes in the root meristem
This test only involves the absorption of nutrients by the roots. Thus, only nongrafted tobacco W (Wufeng No.2) and Y (Yunyan 87) were adopted in this trial. The measuring site was the root meristem. In order to elucidate the possible effects of K+ channel and plasma membrane H+-ATPase compounds on K+ uptake, the net K+ fluxes at the root meristem were monitored after the application of orthovanadate, which is a specific inhibitor of PM H+-ATPases [48], and cesium chloride, which is a K channel blocker. The rest of the measurement methods were consistent with the measurement of K+ fluxes in transverse sections of the tobacco hypocotyls.
Total RNA extraction and quantitative real-time (qRT) PCR
Total RNA was extracted from stems of ungrafted tobacco and grafted tobacco (SKOR and AKT2) with TRIzol reagent (Invitrogen, ThermoFisher, USA) according to the manufacturer’s instructions. 1 µg of total RNA in a 20-µL reaction system was used to synthesis first-strand cDNA in combination with oligo (dT)-18 as a primer and M-MuLV reverse transcriptase (TaRaKa, Japan). qRT-PCR (ABI 7900HT, Applied Biosystems, USA)was performed by a LightCycler480 SYBR Green I Master kit according to the protocols. Each sample analysis was repeated at least three times. The design of gene-specific primers was made by Primer premier5.0 software and all primers were summarized in Table 1. Each primer presented high specificity by the melting curve analysis. The PCR products were quantified by the 2−ΔΔCt method [49].
Table 1
Primers used in the qRT-PCR analysis
Gene | Accession Number | Forward primer (5’-3’) | Reverse primer (5’-3’) |
SKOR | NM_001326274 | TCAGCCTTACACGGTTAGAGTTG | CACCGTAGAAAGCCGCACT |
AKT2 | NM_001325653 | ACAAGACAATGCCACAATGCTC | AGGAGGAACAACATCGGTGT |
Actin* | AB158612 | AACAGTTTGGTTGGAGTTCTGG | CATGAAGATTAAAGGCGGAGTG |
* Reference gene (Act) for qRT-PCR analysis |
Statistical analysis
All data in research are presented as the means of six replicates ± S.D. A two-factorial ANOVA was performed to determine the impacts of grafting on tobacco by SAS Version 9.3 (Statistical Analysis System Institute Inc., Cary, NC, USA). The significance differences between treatments was compared by Duncan’s multiple range test (P < 0.05).