The effect and mechanism of POSTN and its alternative splicing on the apoptosis of myocardial cells in acute myocardial infarction

doi:10.21203/rs.3.rs-2465466/v1

Download PDF

Research Article

The effect and mechanism of POSTN and its alternative splicing on the apoptosis of myocardial cells in acute myocardial infarction

https://doi.org/10.21203/rs.3.rs-2465466/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Acute myocardial infarction (AMI) is characterized by high morbidity and mortality, and has no effective treatments. Our study aimed to investigate key molecular targets in the pathogenesis of AMI, and provide new strategy for the treatment.

Methods

The myocardial ischemia and hypoxia model was constructed by using cardiomyocytes from HL-1 mice. The constructed cardiomyocytes, along with normal cardiomyocyte controls, were transfected with lentiviruses carrying over-expressed POSTN gene (GV492-POSTN-WT), over-expressed POSTN alternative splicing gene (GV492-POSTN-MUT) and negative control (GV492-NC), respectively. Cardiomyocyte proliferation and apoptosis, and the level of proteins related to endoplasmic reticulum stress and apoptosis was examined to explore the effects and mechanisms of POSTN and its alternative splicing on the proliferation and apoptosis of ischemic hypoxic and normal cardiomyocytes.

Results

Ischemic hypoxic and normal cardiomyocytes transfected with GV492-POSTN-WT showed significantly increased OD value, and significantly decreased apoptosis (p < 0.05), with low expression of elF2α, CHOP, GRP78, ATF4 and BAX and high expression of BCL-2 (p < 0.05). Cardiomyocytes transfected with GV492-POSTN-MUT also showed significantly decreased apoptosis (p < 0.05), however, the expression levels of elF2α, CHOP, GRP78, ATF4, BAX and BCL-2 showed no difference between the 2 groups.

Conclusion

POSTN could promote the proliferation whilst inhibit the apoptosis of normal and ischemic hypoxic cardiomyocytes. The mechanism by which POSTN inhibits cardiomyocyte apoptosis may be through inhibiting the GRP78-eIF2α-ATF4-CHOP pathway of endoplasmic reticulum stress. The alternative splicing of POSTN could also inhibit cardiomyocyte apoptosis, however the mechanism requires further investigation. Our results demonstrated that POSTN might be a potential therapeutic target for AMI.

Acute myocardial infarction

POSTN

alternative splicing

apoptosis

Acute myocardial infarction (AMI) is a cardiovascular emergency in which the myocardium is irreversibly damaged. Its pathogenesis is mainly due to coronary atherosclerotic stenosis, plaque rupture, platelet aggregation and thrombus formation, leading to interruption of coronary blood flow and local myocardial ischemia, hypoxia and ultimately myocardial cell death. Its characteristics of acute onset, rapid progression, high morbidity and mortality severely threaten the health of human beings. At present, the treatment of acute myocardial infarction mainly relies on early surgical interventions to restore coronary blood flow as early as possible, in order to reduce myocardial cell death and fibrosis, thereby to improve the prognosis of heart failure after myocardial infarction. However, effective drug treatment is still lacking. Therefore, it is particularly meaningful to search for important molecular targets in the pathogenesis of AMI in order to provide new strategies for the treatment.

Periostin, encoded by the POSTN gene, is a secreted protein that exists in the extracellular matrix and is highly expressed in osteoblasts and their precursor cells [1, 2]. Current studies have found that POSTN is widely expressed in many human tissues including the heart, liver, kidney, adrenal gland, thyroid and so on [3]. In addition, periostin has been found to be associated with various diseases, such as tumors, inflammatory, respiratory and cardiovascular diseases [4, 5].

In our previous study, we found significant differences on the expression of POSTN and its alternative splicing (AS) between AMI and sham-operated mice groups via high-throughput RNA sequencing[6]. In order to verify the potential role of POSTN and its alternative splicing in AMI, we examined the plasma POSTN protein levels of AMI patients at different stages, and also the expression level of POSTN gene in peripheral blood mononuclear cell (PBMC) within 24 hours of myocardial infarction. The results showed that POSTN protein level was significantly decreased in the early stage of AMI (within 24 hours), then started to increase for the next 7 days, and reached its normal level in about 30 days. Moreover, the expression of POSTN in PBMC of AMI patients was significantly decreased within the first 24 hours, indicating that POSTN was closely related to the pathogenesis of AMI, however the mechanism was unclear. Previous studies have showed that POSTN could promote the proliferation of cardiomyocytes and the formation of myocardial fibrosis after AMI. Another study reported that POSTN could inhibit the apoptosis of melanoma osteoblasts by inhibiting endoplasmic reticulum stress [7]. Cardiomyocyte apoptosis is one of the important molecular phenotypes and outcomes after AMI, but whether or not POSTN is related to cardiomyocyte apoptosis is still unclear. In this study, the effect and mechanism of POSTN and its alternative splicing on cardiomyocyte apoptosis were studied to further explore the role of POSTN and its alternative splicing in the pathogenesis of AMI.

1. Cell culture and treatment.

The HL-1 mouse cardiomyocyte cells were obtained from Yagi Biology Company, which were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S) at 37°C, 5% CO₂ with saturated humidity. We continued to culture the HL-1 mouse cardiomyocyte cells in complete cell culture media, selected cells in good growth and made single cell suspension with 5×10⁴ cells/ml. We then used CCK-8 cell proliferation/toxicity testing kit (FC101-03, TransGen Biotech, Beijing, China) to assess the growth after 1 week. Finally, we measured the optical density (OD) value at 450nm to draw out the cell growth curve, using microplate reader (xMarkTM, Bio-Rad, the USA).

2. Construction Of Ischemic Hypoxic Cardiomyocyte Model

2.1 Hypoxia treatment

The cultured cells were transferred to serum-free media, and then further cultured at 37°C in gas containing 1% O₂, 4% CO_2, and 95% N₂ for 3, 6, 12, 24 hours respectively. The control cells were cultured at 37°C in normal condition for the same time period.

2.2 Cell Proliferation Assay

After the hypoxia treatment, the culture media were discarded, then 100µl of 10% CCK-8 solution was added to each well, and continued culture for 1 hour. Lastly the OD value was measured at 450nm to assess cell growth curve.

2.3 Lactate Dehydrogenase (Ldh) Assay

The LDH detection kits (Nanjing Jiancheng, A020-2-2) were used for LDH detection on the treated culture supernatant. The formula for LDH calculation is: LDH (U/L) = (measured OD value - control OD value)/(standard OD - blank OD value) × standard concentration (0.2 µmol/L) × 1000.

3. Construction of the overexpression lentiviral vectors.

Primers were designed using the sequence of POSTN and the alternative splicing of POSTN in GenBank, which contained the BamHI and AgeI restriction enzymes sites. The primers are shown in Table 1a and 1b. RT-PCR was used to clone the gene of POSTN and POSTN alternative splicing. The RT-PCR products were resolved by 1% agarose gel electrophoresis, and then purified, sequenced and cloned into the lentiviral vector, GV492, to produce the POSTN (GV492-POSTN-WT) and POSTN alternative splicing (GV492-POSTN-MUT) overexpression lentiviral vector. An empty vector was used as the negative control (GV492-NC). The construction of vector lentiviruses was conducted by Genechem Co., Ltd (Shanghai, China).

Table 1

a. Primer of wild-type POSTN gene
Primers	Sequences (5’-3’)
POSTN-F	AGGTCGACTCTAGAGGATCCCGCCACCATGGTTCCTCTCCTGCCCTTATATGC
POSTN-R	TCCTTGTAGTCCATACCCTGAGAACGGCCTTCTCTTGATCG

Table 1

b. Primer of mutant POSTN gene
Primers	Sequences (5’-3’)
POSTN-AS-F	AGGTCGACTCTAGAGGATCCCGCCACCATGGTTCCTCTCCTGCCCTTATATGCTC
POSTN-AS-R	TCCTTGTAGTCCATACCCTGAGAACGGCCTTCTCTTGATCGTCTTC

4. Exploration on the optimal condition of cell transfection

MOI (multiplicity of infection) refers to the ratio of the number of viruses to the number of cells during infection. The formula to calculate MOI is: MOI = viral titer (TU/ml)×viral volume (ml)/cell number.

We selected 3 potential MOI value, 1, 10, 100 after literature review, and calculated the viral titers, 1×10⁶ TU/ml, 1×10⁷ TU/ml, 1×10⁸ TU/ml, respectively, using the formula above (viral volume was 10µl). We also compared the transfection efficiency using 2 different transfection reagents, HitransG A (Reagent A) and HitransG P (Reagent P) (Genechem, Shanghai, China).

We titrated the GV492-NC culture to 1×10⁶ TU/ml, 1×10⁷ TU/ml, 1×10⁸ TU/ml for 50µl each using serum-free media, then mixed the viruses and reagents as shown in Table 2. After 12 hours of transfection the viruses were transferred back to normal culture media. We determined the optimal transfection condition by observing the fluorescence intensity under inverted fluorescence microscope (Eclipse TS100-F, Nikon, Japan). The optimal condition should have high fluorescence intensity with a transfection efficiency close to 80%, and good cell growth. The corresponding MOI to such condition was then chosen for subsequent procedures.

Table 2

Testing groups and transfection conditions
Transfection condition	Group M	Group A	Group P
MOI = 1 1×10⁶ TU/ml	Normal media: 90µl Virus: 10µl	Normal media: 86µl Virus: 10µl Reagent A: 4µl	Normal media: 86µl Virus: 10µl Reagent P: 4µl
MOI = 10 1×10⁷ TU/ml	Normal media: 90µl Virus: 10µl	Normal media: 86µl Virus: 10µl Reagent A: 4µl	Normal media: 86µl Virus: 10µl Reagent P: 4µl
MOI = 100 1×10⁸ TU/ml	Normal media: 90µl Virus: 10µl	Normal media: 86µl Virus: 10µl Reagent A: 4µl	Normal media: 86µl Virus: 10µl Reagent P: 4µl

5. Cell Transfection And Quantitative Real-time Pcr (Qrt-pcr)

We transfected the cultured cardiomyocytes with the GV492-POSTN-WT and GV492-POSTN-MUT lentiviruses using the optimal condition. After discarding the culture media, the cells were digested using 1ml of TRIzol™ Reagent (15596026, Ambion, the USA). Then the RNA was extracted using TRIzol protocol for each group, and 5X All-In-One RT MasterMix (with AccuRT Genomic DNA Removal Kit) Reverse Transcription Kit (G492, abm, the USA) was utilized to convert RNA to cDNA. The POSTN gene in cDNA was amplified using SYBR Green Real-time kit (TaKaRa, Dalian, China) on an ABI7500 Fast RT-PCR system (ABI, the USA) according to the manufacturer’s instructions. Mouse β-actin was used as the endogenous control. The primers are shown in Table 3a and 3b. The relative gene expression was calculated by the 2^−△△Ct method. The POSTN alternative spicing gene in cDNA was amplified using 2×EasyTaq PCR SuperMix (+ dye) (AS111, TransGen Biotech, Beijing, China) on a MyCycler Thermal Cycler PCR system (Bio-Rad, the USA) according to the manufacturer’s instructions. The PCR products were checked by electrophoresis with 2% agarose gel and observed by ethidium bromide (EtBr) staining. Finally the electrophoretic bands were scanned and the grayscale values were obtained using Adobe Photoshop to semi-quantify the expression levels of the POSTN alternative splicing.

Table 3

a. The sequences of POSTN primers.
Primers	Sequences (5'-3')	Product (bp)
POSTN-F	GGACCTTGTTTGCACCAACC	147
POSTN-R	CGGGTTCGAATCCCTTTCCA	147
Mouse β-actin-F	GGCTGTATTCCCCTCCATCG	154
Mouse β-actin-R	CCAGTTGGTAACAATGCCATGT	154

Table 3

b. The sequences of POSTN-AS primers.
Primers	Sequences (5'-3')	Product (bp)
POSTN-AS-F	ACAAACTCCTCTATCCAGC	292/211
POSTN-AS-R	TCTGTCACCGTTTCGCCTTC	292/211

6. The Effects Of Postn And Its Alternative Splicing On Cardiomyocytes

6.1 Cell proliferation assay

We utilized CCK-8 cell proliferation assay to measure the OD values of normal and ischemic hypoxic cardiomyocytes transfected with GV492-POSTN-WT, GV492-POSTN-MUT lentiviruses. The method was as stated in previous sections.

6.2 Cell Apoptosis Assay

We used Annexin V-PE/7-AAD Cell Apoptosis Testing Kit (559763, BD, the USA) to measure the apoptosis of the cardiomyocytes. Transfected cells in each group were transferred into 15ml centrifuge tubes, washed twice with Phosphate Buffer Saline (PBS) solution, and then trypsinized (0.25% Trypsin-EDTA, 25200-056, GIBCO, the USA). Then we added 500 µl of 1×Binding Buffer to the centrifuge tube to resuspend the cells, and made them into single-cell suspension through grit 200 filter. We then added 5 µl of Annexin V-PE and 10 µl of 7-AAD into each tube and mixed gently. After incubating for 15 minutes at 4°C in the dark, the samples were analyzed by flow cytometry (LSRFortessa, BD, the USA).

6.3 Western Blot

Cardiomyocytes in each group were collected and total proteins were extracted using RIPA RIPA Lysis and Extraction Buffer (AR0105, Boster Biological Technology, Wuhan, China), and the protein concentration was determined using Easy II Protein Quantitative BCA kit (DQ111-01, TransGen Biotech, Beijing, China). The OD values of cell growth were measured at 562nm, and the concentration of proteins were calculated with the standard curve. The protein samples were pre-processed using 5×SDS-PAGE loading buffer (with β-Mercaptoethanol) (C05-03001, Bioss, Beijing, China), isolated with electrophoresis (10% gel for eIF2α and GRP78; 12% gel for ATF4 and β-actin; 15% gel for CHOP, BCL-2 and BAX), and transferred to ploy membrane (0.45um polyvinylidene fluoride PVDF membrane [IPVH00010, Millipore, the USA] for eIF2α, ATF4, GRP78 and β-actin; 0.22um PVDF membrane [ISEQ00010, Millipore, the USA] for CHOP, BCL-2 and BAX). The membrane was blocked using blocking solution containing 5% skim milk for 1 hour, and incubated with primary and secondary antibodies (Table S1). Mouse β-actin was used as the internal reference for other proteins. The protein bands were visualized using chemiluminescence kit (Chemiscope 3000, Clinx Science Instruments, Shanghai, China) to assess the expression levels of eIF2α, ATF4, CHOP, GRP78, BCL-2 and BAX in each group.

7. Statistical Analysis

We used SPSS 20.0 to conduct the statistical analysis on the level of each gene in each group, with measurement data using mean ± standard deviation (χ ̅±s) and enumeration data using proportion. The measurement data were tested for normality and proved to be normally distributed. Therefore two-tailed independent samples t-test was used with significance level set at p < 0.05.

1. The cardiomyocytes of HL-1 mice grew logarithmically.

The growth curve was drawn according to the OD value (Table S2) of HL-1 cardiomyocytes after culture for 7 days (Fig. 1a). the cells grew well with logarithmic growth and were used for subsequent studies.

2. The Optimal Hypoxia Treatment Time For Cardiomyocyte Hypoxia Model

The hypoxia treatment of cells for 3 hours had little effect on cell proliferation and LDH. At 6, 12 and 24 hours of hypoxia treatment, cell proliferation was significantly inhibited and the LDH level was significantly increased (Table S3-4, Fig. 1b-c). The results suggested that hypoxia treatment for more than 6 hours significantly inhibited the proliferation of cardiomyocytes and caused obvious inflammatory injury. At 24 hours, the inhibitory effect of hypoxia on cell proliferation was strongest, however, the OD value of cells was close to 1/4 of the control group, indicating that the survival rate was too low to yield enough cells for subsequent studies. Therefore, 24 hours was not the optimal hypoxia treatment time. Between 6 and 12 hours of hypoxia treatment, the LDH of cells increased significantly at 6 hours, therefore the optimal hypoxia treatment time of cardiomyocytes in the model of ischemia and hypoxia was 12 hours.

3. The construction of lentiviral vector and transfection.

POSTN was highly expressed in cardiomyocytes that transfected with GV492-POSTN-WT (Table S5, Fig. 1d). The alternative splicing of POSTN (POSTN-full) was also highly expressed in cardiomyocytes that transfected with GV492-POSTN-MUT (Table S6, Fig. 1e). The results showed that both GV492-POSTN-WT and GV492-POSTN-MUT were successfully constructed and the cardiomyocytes were also successfully transfected.

4. The best transfection conditions of lentivirus.

According to the influence of different MOI values and the addition of different transfection reagents on cell growth, it was found that at MOI = 100 with Reagent P, the lentiviruses had the highest infection efficiency on HL-1 cells with the best cell growth. Therefore, this condition was determined as the optimal infection condition (Fig. 2).

5. POSTN promoted the proliferation of normal and hypoxic cardiomyocytes.

Compared with the negative control, the proliferation of normal cardiomyocytes transfected with GV492-POSTN-WT was significantly up-regulated (p < 0.05), while the proliferation of normal cardiomyocytes transfected with GV492-POSTN-MUT was not significantly changed. There was no significant difference in the proliferation ability of cardiomyocytes transfected with GV492-POSTN-WT and GV492-POSTN-MUT, respectively, indicating that POSTN-WT could promote the proliferation of normal cardiomyocytes (Table S7, Fig. 3a). The transfection of GV492-POSTN-WT (p < 0.0001) or GV492-POSTN-MUT (p < 0.01) could promote the proliferation of ischemic hypoxic cardiomyocytes compared with the negative control, but there was no significant difference between the two groups. As the alternative splicing of POSTN studied in this paper had additional sequences on top of POSTN, the results indicated that only the POSTN could promote the proliferation of ischemic hypoxic cardiomyocytes, but not the alternative splicing of POSTN with these additional sequences (Table S7, Fig. 3b).

6. POSTN and its alternative splicing inhibited cardiomyocytes apoptosis.

The apoptosis rates of normal cardiomyocytes transfected with GV492-POSTN-WT and GV492-POSTN-MUT, compared with the negative control, were significantly decreased (p < 0.001), but there was no significant different between the two groups (Table S8, Fig. 3c). This indicated that the POSTN inhibited the apoptosis of normal cardiomyocytes, but not the POSTN alternative splicing. The apoptosis rates of ischemic hypoxic cardiomyocytes transfected with GV492-POSTN-WT and GV492-POSTN-MUT were significantly reduced (p < 0.0001), and the difference between the two groups was also statistically significant (p < 0.0001). The apoptosis rate of ischemic hypoxic cardiomyocytes transfected with GV492-POSTN-WT was lower (Table S8, Fig. 3d, Fig. 4). The results suggested that both POSTN and its alternative splicing could inhibit the apoptosis of ischemic hypoxic cardiomyocytes, and the inhibitory effect of POSTN was stronger.

The apoptosis of cardiomyocytes in (a) blank group, (b) ischemic hypoxic model group, (c) GV492-NC group, (d) GV492-POSTN-WT group, (e) GV492-POSTN-MUT group, (f) ischemic hypoxic model + GV492-NC group, (g) ischemic hypoxic model + GV492-POSTN-WT group and (h) ischemic hypoxic model + GV492-POSTN-MUT group. Note: x-axis represents Annexin V-PE, y-axis represents 7-AAD; Q1 represents cells with mechanical injury, Q2 represents cells in late apoptosis, Q3 represents cells in early apoptosis, Q4 represents cells without apoptosis (normal cells)

7. POSTN inhibited cardiomyocytes apoptosis through GRP78-eIF2α-ATF4-CHOP pathway.

In normal cells transfected with POSTN and its alternative splicing, the expression levels of eIF2α, CHOP, GRP78 in GV492-POSTN-WT and GV492-POSTN-MUT group were significantly decreased, while the expression level of BCL-2 was increased. The expression levels of ATF4 and BAX were significantly decreased in GV492-POSTN-WT, but no significant changes in GV492-POSTN-MUT. There were no significant differences in the expression levels of the six proteins above between GV492-POSTN-WT and GV492-POSTN-MUT groups, however, in the GV492-POSTN-WT group, eIF2α, ATF4, CHOP, GRP78 and BAX showed a tendency of lower expression while BCL-2 showed slightly higher expression than in the GV492-POSTN-MUT group.

Similarly, in ischemic hypoxic cells, there were significant differences in the expression levels of eIF2α, ATF4, CHOP, GRP78, BCL-2, and BAX in GV492-POSTN-WT and GV492-POSTN-MUT group compared with the negative control. All 6 proteins were low-expressed in GV492-POSTN-WT and GV492-POSTN-MUT groups, but there were no significant differences (Table S9-10 and Fig. 5,Figure S1).

In our preceding study, we found that POSTN was lowly expressed in the myocardial tissue of AMI mice model by using RNA sequencing. However, our finding seemed to conflict with what previous studies had found that POSTN was basically not expressed in the normal adult heart tissues, and highly expressed after cardiac injury such as myocardial infarction, pressure overload, and dilated cardiomyopathy [8, 9]. Studies in the early 20th century reported that POSTN was elevated in myocardial tissues after myocardial infarction and was thought to be associated with reduced fibrosis after myocardial infarction [10, 11]. However, Oka et al. found that the mice with POSTN knockdown showed less fibrosis and better ventricular performance after a myocardial infarction [12]. POSTN was also found to lowly expressed in the early stage of AMI patients’ plasma [13]. Thus, the role of POSTN in myocardial tissue and cells after AMI is still controversial.

Due to the limited regenerative capacity of the adult heart, myocardial infarction can lead to irreversible loss of cardiomyocytes and poor prognosis subsequently [14, 15]. Therefore, many recent studies have focused on solving the problem of myocardial regeneration after myocardial infarction. Previous studies claimed that appropriate stimulation by extracellular signals might enable post-mitotic cardiomyocytes to proliferate [16, 17]. These studies led us to speculate whether POSTN is a factor that stimulates cardiomyocyte proliferation. Researchers have found that POSTN could induce myocardial infarction mice’s cardiomyocytes to re-enter the mitotic cell cycle, thereby improving ventricular remodeling and myocardial function, reducing fibrosis and infarct size, and increasing angiogenesis [17]. Another study found that MI pig models treated with exogenous POSTN showed newly formed myocardial strips, increased capillary density and improved local myocardial function, suggesting that POSTN could promote the proliferation of myocardial cells after infarction[18]. POSTN was also claimed to induce cardiomyocytes to enter S and M cell cycle phrases, thereby promoting cardiomyocyte proliferation [19]. Another study showed that compared with the control group, knockdown of POSTN in AMI mice models significantly increased fibrosis and cardiomyocyte regeneration after myocardial infarction [20]. Nevertheless, other research found no obvious effect of POSTN on myocardial regeneration through in vivo and in vitro experiments [21], indicated that the ability of POSTN remains controversial.

In our preceding study, we found that the POSTN alternative splicing was highly expressed in the myocardial tissue of AMI mice, suggesting that POSTN alternative splicing was closely related to AMI. Therefore the question is, do POSTN and its alternative splicing have the same effect on AMI cardiomyocytes? Balbi et al. transfected POSTN protein into cardiac explant-derived progenitor cells (CPCs) to study the role of POSTN in cell cycle activity. They found that CPC-secreted exosomes promoted cardiomyocyte re-entry cycle through their surface-expressed short POSTN isoforms, while recombinant full-length POSTN did not [22]. By using AMI mice models, Taniyama et al. found a significant association between full-length POSTN and the severity of myocardial infarction [23]. In our preceding study, RNA sequencing of myocardial tissue of AMI and Sham found that POSTN was lowly expressed in the myocardial tissue of AMI mice, while its alternative splicing was highly expressed, and the two expression trends were opposite. So does POSTN play opposite roles to its alternatively spliced transcripts in the mechanism of AMI? Through this study, we concluded that the effects of POSTN and alternatively spliced transcripts on normal and ischemic hypoxic cardiomyocytes were showing consistent trends, although not all statistically significant. And in this part of the study, POSTN was lowly expressed in ischemic/ hypoxic cardiomyocytes, and POSTN alternative splicing was highly expressed in ischemic/ hypoxic cardiomyocytes, which was consistent with our previous detection results in animals.

Is this study we found that POSTN inhibited apoptosis, which was firstly reported in neoplastic diseases. Bao SD et al. found that POSTN can inhibit the apoptosis of colon cancer cells and increase the survival rate of cancer cells, promoting the growth and metastasis of colon cancer cells [24]. Zhang et al. found that suppressing POSTN could increase the apoptosis of the hepatocellular carcinoma cell, suggesting that POSTN had anti-apoptosis effects on liver cancer cells [25]. Li et al. suggested that over-expressed POSTN could suppress the apoptosis of the gastric cancer cells via down-regulating the expression of apoptosis-related proteins in gastric cancer cells (26). Similarly, Baril et al. found in their research that POSTN could promote the invasiveness of pancreatic cancer cells, and the effects were more obvious in hypoxic condition [27]. Liu et al. also found that down-regulating POSTN in hypoxic condition could facilitate liver cancer cell apoptosis [28]. Therefore, we could speculate that POSTN has anti-apoptosis effect on cancer cells, moreover, this effect is closely related to hypoxia. AMI features cardiomyocyte ischemia, hypoxia, and apoptosis, however, very few studies have been done to investigate the association between POSTN and apoptosis in AMI. In a study done by Cho et al., the authors found that POSTN could significantly improve the survival rate of mesenchymal stem cells (MSCs). When POSTN-overexpressed MSCs (P-MSCs) were co-cultured with cardiomyocytes, POSTN activated the PI3K-Akt pathway through adherence-related integrin and inhibited apoptosis of cardiomyocytes after myocardial infarction [29]. However, Hu et al. had opposite opinion in their recent study that POSTN could promote cardiomyocyte apoptosis in AMI with high-expression of POSTN in the infarct border zone [30]. This has shown that the association between POSTN and cardiomyocyte apoptosis post AMI is still unclear. Given the POSTN gene has a number of alternative splicing forms, the association between the alternative splicing and cardiomyocyte apoptosis is also unclear, which is the starting point of our study.

The traditional ways of apoptosis are called caspase-dependent pathways, including receptor-induced and mitochondria-mediated pathways. Both pathways lead to the enzymatic activation of caspases, which triggers the caspase cascade, leading to apoptosis [31]. In addition, endoplasmic reticulum stress (ERS)-mediated apoptosis has become a research hotspot in recent years [32–34]. The endoplasmic reticulum is the main site of protein synthesis, folding and secretion. Many factors, such as ischemia, hypoxia, heat shock, genetic mutations, oxidative stress, and increased protein synthesis, can impair ER function. Disruption of ER function, termed "ER stress", leads to accumulation of unfolded and misfolded proteins in the ER and triggers unfolded protein responses [35, 36]. One study showed that ERS played an important role in inducing cardiomyocyte apoptosis in a pressure overload mouse model of heart failure [37]. Bi X et al. suggested that ERS was involved in cardiomyocyte apoptosis by elucidating the role of the master regulator GRP78 in the unfolded protein response (URP) in myocardial ischemia/reperfusion injury [38]. Meng X et al. have confirmed that POSTN could protect osteoblasts by inhibiting the ERS-related eIF2α-ATF4 pathway and reducing the induction of melatonin on human osteoblast apoptosis [7]. ERS mainly induces apoptosis through three URP signal pathways, namely PERK pathway, IRE1 pathway and ATF6 pathway, and PERK-eIF2α-ATF4-CHOP is one of the PERK pathways [39, 40]. GRP78 is the major resident protein of the endoplasmic reticulum and is often used as an important marker for evaluating the function of the endoplasmic reticulum [41]. CHOP, a homologous protein of the pro-apoptotic transcription factor C/EBP, is a typical marker of endoplasmic reticulum stress and a downstream target of the UPR pathway [42, 43]. During ERS, due to increased phosphorylation of eIF2α, only specific mRNAs such as ATF4 and CHOP mRNA are translated, and ATF4 directly binds to the CHOP promoter and activates its transcription [37, 44, 45]. Therefore, we hypothesized that POSTN might affect cardiomyocyte apoptosis by regulating the eIF2α-ATF4-CHOP pathway of ERS.

In this study, the effect of POSTN and its alternative splicing on proliferation and apoptosis of normal and ischemic hypoxic cardiomyocytes infected with wild-type and mutant POSTN overexpressed lentivirus were observed. POSTN promoted the proliferation of normal and hypoxic cardiomyocytes. POSTN alternative splicing showed a tendency of promoting the proliferation of normal and ischemic hypoxic cardiomyocytes compared with the control group, but there was no statistical significance. The effect of POSTN alternative splicing on cardiomyocytes needs further study to confirm. Apoptosis studies showed that POSTN could inhibit the apoptosis of normal and ischemic hypoxic cardiomyocytes, while POSTN splicing had no significant inhibitory effect on the apoptosis of normal cardiomyocytes, but had an inhibitory effect on the apoptosis of ischemic hypoxic cardiomyocytes. Therefore, we concluded that POSTN could promote the proliferation of AMI cardiomyocytes and inhibit the apoptosis of AMI cardiomyocytes. We simulated AMI cardiomyocytes through ischemic hypoxic cardiomyocyte modelling, and demonstrated that POSTN could promote the proliferation and inhibit the apoptosis of AMI cardiomyocytes, whilst the alternative splicing could inhibit the apoptosis of AMI cardiomyocytes. The promoting trend of POSTN alternative splicing on the proliferation of AMI cardiomyocytes was observed, but there was no statistical significance. However it would be premature to deny the effect of POSTN alternative splicing on AMI cardiomyocytes proliferation, instead, it needs to be confirmed by further experiments.

To explore the mechanism of POSTN and its alternative splicing inhibiting cardiomyocyte apoptosis, we examined ERS related proteins GRP78, eIF2α, ATF4, CHOP and apoptosis-related proteins BCL-2 and BAX, and found that POSTN inhibited the expression of GRP78, eIF2α, ATF4, CHOP proteins, while the expression of anti-apoptotic protein BCL-2 was up-regulated and the expression of pro-apoptotic protein BAX was down-regulated. These results indicated that POSTN inhibited cardiomyocyte apoptosis by inhibiting GRP78-eIF2α-ATF4-CHOP pathway. The same trend with POSTN alternative splicing was observed in both normal and ischemic hypoxic cardiomyocytes, but the role of POSTN alternative splicing could not be proved because there was no statistical difference between POSTN and POSTN alternative splicing. However, it is also premature to deny the possible influence of POSTN alternative splicing on this pathway, which calls for further study to confirm. It was concluded that POSTN inhibited cardiomyocyte apoptosis post AMI by inhibiting GRP78-eIF2α-ATF4-CHOP pathway, and POSTN had a protective effect on AMI cardiomyocytes.

Claudio et al. found that ischemic preconditioning in distal limbs could reduce the incidence of AMI post coronary angiography, suggesting a protective effect of ischemia on the heart tissue [46]. When combining this finding with our study, we would suspect whether such protective effect was due to increased expression of POSTN. This would have had important impact on the clinical management of AMI should the protective role of POSTN on cardiomyocyte could be confirmed. In this study, we demonstrated that POSTN played a crucial role in the pathogenesis of AMI. POSTN could promote the proliferation of AMI cardiomyocytes, inhibit the apoptosis of AMI cardiomyocytes, suggesting a protective effect on AMI. We suspected that up-regulation of POSTN might play a role in the clinical treatment of AMI, which makes POSTN a potential biomarker and therapeutic target for AMI.

Limitations The limitation of our study was that we did not verify the effect of POSTN knockout or knockdown on cardiomyocytes proliferation and apoptosis, and there was no further in vivo confirmation. Through this study, we had some preliminary conclusions, and we will conduct a series of further studies to thoroughly verify the role of POSTN in the pathogenesis of AMI. We hope our research can lead to a new breakthrough in the diagnosis and treatment of AMI.

Ethical Approval

In this research, all procedures were approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University (Ethical approval number: 220120-03).

Competing interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Authors' contributions

Muhuyati participated in the conception and design of this study; Ze Zhang, Zulikaier Tuerxun and Yumaierjiang Balati were involved in data acquisition; Pengfei Gong participated in the analysis and interpretation of data; Zhen Bao performed statistical analysis; Pengyi He obtained the funding; Xuemei Liu drafted the manuscript; Yuchun Yang was responsible for the critical revision. All authors read and approved the final manuscript.

Funding

This work was supported by the Tianshan Innovation Team Plan of Xinjiang, China (Grant numbers: 2020D14012).

Availability of data and materials

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgement

We specially thank Lin Gan, Faculty of Medicine, Health and Human Sciences, Macquarie University, Australia, for his work on proof reading and language editing for this paper.

Lehmann AE, Scangas GA, Bergmark RW, El Rassi E, Stankovic KM, Metson R (2019) Periostin and Inflammatory Disease:Implications for Chronic Rhinosinusitis. Otolaryngol Head Neck Surg 160(6):965-973. dol: 10.1177/0194599819838782
Jia Y, Zhong FM, Jiang SY, Guo Q, Jin H, Wang F et al (2019) Periostin in chronic liver diseases:Current research and future perspectives. Life Sci 226:91-97. dol: 10.1016/j.lfs.2019.04.021
Matsumoto H (2019) Roles of Periostin in Asthma. Adv Exp Med Biol 1132:145-159. dol: 10.1007/978-981-13-6657-4_15
Yu Y, Tan CM, Jia YY (2021) Research status and the prospect of POSTN in various tumors. Neoplasma 68(4):673-682. dol: 10.4149/neo_2021_210223N239
Jia YY, Yu Y, Li HJ (2020) The research status and prospect of Periostin in chronic kidney disease. Ren Fail 42(1):1166-1172. dol: 10.1080/0886022X.2020.1846562
Liu XM, He PY, Zhang Z,Gong PF, Niu YX, Bao Z et al (2022) Candidate genes and their alternative splicing may be potential biomarkers of acute myocardial infarction: a study of mouse model.BMC Cardiovasc Disord 22(1): 505.
Meng XT, Zhu Y, Tao L, Zhao SC, Qiu S (2017) Periostin has a protective role in melatoninin-induced cell apoptosis by inhibiting the eIF2α-ATF4 pathway in human osteoblasts. International Journal of Molecular Medicine 41(2): 1003-1012. dol: 10.3892/IJMM.2017.3300
Kanisicak O, Khalil H, Ivey MJ, Karch J, Maliken BD, Correll RN et al(2016) Genetic lineage tracing defines myofibroblast origin and function in the injured heart. Nat Commun 7:12260. dol: 10.1038/ncomms12260
Dixon IMC, Landry NM, Rattan SG (2019) Periostin Reexpression in Heart Disease Contributes to Cardiac Interstitial Remodeling by Supporting the Cardiac Myofibroblast Phenotype. Adv Exp Med Biol 1132:35-41. dol: 10.1007/978-981-13-6657-4_4
Stanton LW, Garrard LJ, Damm D, Garrick BL, Lam A, Kapoun AM et al (2000) Altered patterns of gene expression in response to myocardial infarction. Circ Res 86(9):939-945. dol: 10.1161/01.res.86.9.939
Shimazaki M, Nakamura K, Kii I, Kashima T, Amizuka N, Li M et al (2008) Periostin is essential for cardiac healing after acute myocardial infarction. The Journal of experimental medicine 205(2):295-303. dol: 10.1084/jem.20071297
Oka T, Xu J, Kaiser RA, Melendez J, Hambleton M, Sargent MA et al (2007) Genetic manipulation of periostin expression reveals a role in cardiac hypertrophy and ventricular remodeling. Circulation research 101(3):313-321. dol: 10.1161/CIRCRESAHA.107.149047
Cheng CW, Wang CH, Lee JF, Kuo LT, Cherng WJ (2012) Levels of blood periostin decrease after acute myocardial infarction and are negatively associated with ventricular function after 3 months. J Investig Med 60(2):523-528. dol: 10.2310/JIM.0b013e3182408549
Bergmann O, Jovinge S (2014) Cardiac regeneration in vivo:mending the heart from within. Stem Cell Res 13(3):523-531. dol: 10.1016/j.scr.2014.07.002
Wang J, Liu SJ, Heallen T, Martin JF (2018) The Hippo pathway in the heart:pivotal roles in development, disease, and regeneration. Nature reviews. Cardiology 15(11):672-684. dol: 10.1038/s41569-018-0063-3
Engel FB, Schebesta M, Duong MT, Lu G, Ren S, Madwed JB et al (2005) p38 MAP kinase inhibition enables proliferation of adult mammalian cardiomyocytes. Genes Dev 19(10):1175-1187. dol: 10.1101/gad.1306705
Kühn B, del Monte F, Hajjar RJ, Chang YS, Lebeche D, Arab S et al (2007) Periostin induces proliferation of differentiated cardiomyocytes and promotes cardiac repair. Nature medicine 13(8):962-969. dol: 10.1038/nm1619
Ladage D, Yaniz-Galende E, Rapti K, Ishikawa K, Tilemann L, Shapiro S et al (2013) Stimulating myocardial regeneration with periostin Peptide in large mammals improves function post-myocardial infarction but increases myocardial fibrosis. PloS one 8(5): e59656. dol: 10.1371/journal.pone.0059656
Sözmen M, Devrim AK, Kabak YB, Devrim T (2018) The Effects of Periostin in a Rat Model of Isoproterenol:Mediated Cardiotoxicity. Cardiovascular toxicology 18(2):142-160. dol: 10.1177/0960327118802617
Chen ZH, Xie JH, Hao HX, Lin H, Wang L, Zhang Y et al (2017) Ablation of periostin inhibits post-infarction myocardial regeneration in neonatal mice mediated by the phosphatidylinositol 3 kinase/glycogen synthase kinase 3β/cyclin D1signalling pathway. Cardiovascular research 113(6):620-632. dol: 10.1093/cvr/cvx001
Lorts A, Schwanekamp JA, Elrod JW, Sargent MA, Molkentin JD (2009) Genetic manipulation of periostin expression in the heart does not affect myocyte content, cell cycle activity, or cardiac repair. Circulation research 104(1):e1-e7. dol: 10.1161/circresaha.108.188649
Balbi C, Milano G, Fertig TE, Lazzarini E, Bolis S, Taniyama Y et al (2021) An exosomal-carried short periostin isoform induces cardiomyocyte proliferation. Theranostics 11(12):5634-5649. dol: 10.7150/thno.57243
Taniyama Y, Katsuragi N, Sanada F, Azuma J, Iekushi K, Koibuchi N et al (2016) Selective Blockade of Periostin Exon 17 Preserves Cardiac Performance in Acute Myocardial Infarction. Hypertension 67(2):356-361. dol: 10.1161/HYPERTENSIONAHA.115.06265
Bao SD, Ouyang GL, Bai XF, Huang Z, Ma C, Liu M et al (2004) Periostin potently promotes metastatic growth of colon cancer by augmenting cell survival via the Akt/PKB pathway. Cancer Cell 5(4):329-339. dol: 10.1016/s1535-6108(04)00081-9
Zhang R,Lin XH,Ma M, Chen J, Chen J, Gao DM et al (2018) Periostin involved in the activated hepatic stellate cells-induced progression of residual hepatocellular carcinoma after sublethal heat treatment: its role and potential for therapeutic inhibition .J Transl Med 16: 302. dol: 10.1186/s12967-018-1676-3
Li B,Wang LY,Chi BR (2013) Upregulation of periostin prevents P53-mediated apoptosis in SGC-7901 gastric cancer cells. Mol Biol Rep 40: 1677-83. dol: 10.1007/s11033-012-2218-3
Baril P,Gangeswaran R,Mahon PC, Caulee K, Kocher HM, Harada T et al (2007) Periostin promotes invasiveness and resistance of pancreatic cancer cells to hypoxia-induced cell death: role of the beta4 integrin and the PI3k pathway .Oncogene 26: 2082-94. dol: 10.1038/sj.onc.1210009
Liu YJ,Gao F,Song WX (2017) Periostin contributes to arsenic trioxide resistance in hepatocellular carcinoma cells under hypoxia .Biomed Pharmacother 88: 342-348. dol: 10.1016/j.biopha.2017.01.052
Cho YH, Cha MJ, Song BW, Kim IK, Song H, Chang W et al (2012) Enhancement of MSC adhesion and therapeutic efficiency in ischemic heart using lentivirus delivery with periostin. Biomaterials 33(5):1376-1385. dol: 10.1016/j.biomaterials.2011.10.078
Hu YL,Wang XH,Ding FY, Liu C, Wang S, Feng T et al (2022) Periostin renders cardiomyocytes vulnerable to acute myocardial infarction via pro-apoptosis .ESC Heart Fail 9: 977-987. dol: 10.1002/ehf2.13675
Del Re DP, Amgalan D, Linkermann A, Liu Q, Kitsis RN (2019) Fundamental Mechanisms of Regulated Cell Death and Implications for Heart Disease. Physiological reviews 99(4):1765-1817. dol: 10.1152/physrev.00022.2018
Ren J, Bi YG, Sowers JR, Hetz C, Zhang Y (2021) Endoplasmic reticulum stress and unfolded protein response in cardiovascular diseases. Nat Rev Cardiol 18(7):499-521. dol: 10.1038/s41569-021-00511-w
Wu CZ, Chen W, Yu FY, Yuan Y, Chen Y, Hurst DR et al (2020) Long Noncoding RNA HITTERS Protects Oral Squamous Cell Carcinoma Cells from Endoplasmic Reticulum Stress-Induced Apoptosis via Promoting MRE11-RAD50-NBS1 Complex Formation. Advanced science (Weinheim, Baden-Wurttemberg, Germany) 7(22):2002747-2002747. dol: 10.1002/advs.202002747
Lee DY, Lee SH, Noh I, Oh E, Ryu H, Ha J et al (2019) A Helical Polypeptide-Based Potassium Ionophore Induces Endoplasmic Reticulum Stress-Mediated Apoptosis by Perturbing Ion Homeostasis. Adv Sci (Weinh) 6(14):1801995. dol: 10.1002/advs.201801995
Wang M, Kaufman RJ (2016) Protein misfolding in the endoplasmic reticulum as a conduit to human disease. Nature 529(7586):326-335. dol: 10.1038/nature17041
Westrate L M, Lee J E, Prinz W A, Voeltz GK (2015) Form follows function:the importance of endoplasmic reticulum shape. Annu Rev Biochem 84(1):791-811. dol: 10.1146/annurev-biochem-072711-163501
Yao YF, Lu QL, Hu ZK, Yu Y, Chen Q, Wang QK (2017) A non-canonical pathway regulates ER stress signaling and blocks ER stress-induced apoptosis and heart failure. Nature communications 8(1):133. dol: 10.1038/s41467-017-00171-w
Bi XK, Zhang GY, Wang XD, Nguyen C, May HI, Li X et al (2018) Endoplasmic Reticulum Chaperone GRP78 Protects Heart From Ischemia/Reperfusion Injury Through Akt Activation. Circ Res 122(11):1545-1554. dol: 10.1161/CIRCRESAHA.117.312641
Liu XD, Chen Y, Wang HH, Wei Y, Yuan Y, Zhou Q et al (2021) Microglia-derived IL-1β promoted neuronal apoptosis through ER stress-mediated signaling pathway PERK/eIF2α/ATF4/ CHOP upon arsenic exposure. Journal of Hazardous Materials 417:125997-125997. dol: 10.1016/j.jhazmat.2021.125997
Kim S, Lee M, Song Y, Lee SY, Seo H (2021) Argininosuccinate synthase 1suppresses tumor progression through activation of PERK/eIF2α/ATF4/CHOP axis in hepatocellular carcinoma. Journal of Experimental & Clinical Cancer Research 40(1):127-127. dol: 10.21203/rs.3.rs-125320/v1
Tseng CC, Zhang P, Lee AS (2019) The COOH-Terminal Proline-Rich Region of GRP78 Is a Key Regulator of Its Cell Surface Expression and Viability of Tamoxifen-Resistant Breast Cancer Cells. Neoplasia 21(8):837-848. dol: 10.1016/j.neo.2019.05.008
Woehlbier U, Hetz C (2011) Modulating stress responses by the UPRosome:a matter of life and death. Trends Biochem Sci 36(6):329-337. dol: 10.1016/j.tibs.2011.03.001
Yang C, Xu XX, Dong XF, Yang B, Dong W, Luo Y et al(2021) DDIT3/CHOP promotes autophagy in chondrocytes via SIRT1-AKT pathway. Biochimica et biophysica acta. Molecular cell research 1868(9):119074-119074. dol: 10.1016/j.bbamcr.2021.119074
Minamino T, Kitakaze M (2010) ER stress in cardiovascular disease. Journal of Molecular and Cellular Cardiology 48(6):1105-1110. dol: 10.1016/j.yjmcc.2009.10.026
Palam LR, Baird TD, Wek RC (2011) Phosphorylation of eIF2 facilitates ribosomal bypass of an inhibitory upstream ORF to enhance CHOP translation. J Biol Chem 286(13):10939-10949. dol: 10.1074/jbc.M110.216093
Moretti C,Cerrato E,Cavallero, Lin S, Rossi ML, Picchi A et al (2018) The EUROpean and Chinese cardiac and renal Remote Ischemic Preconditioning Study (EURO-CRIPS CardioGroup I): A randomized controlled trial. Int J Cardiol 257: 1-6. dol: 10.1016/j.ijcard.2017.12.033

No competing interests reported.

Supplementaryfile.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

The effect and mechanism of POSTN and its alternative splicing on the apoptosis of myocardial cells in acute myocardial infarction

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

2. Construction Of Ischemic Hypoxic Cardiomyocyte Model

2.1 Hypoxia treatment

2.2 Cell Proliferation Assay

2.3 Lactate Dehydrogenase (Ldh) Assay

4. Exploration on the optimal condition of cell transfection

5. Cell Transfection And Quantitative Real-time Pcr (Qrt-pcr)

6. The Effects Of Postn And Its Alternative Splicing On Cardiomyocytes

6.1 Cell proliferation assay

6.2 Cell Apoptosis Assay

6.3 Western Blot

7. Statistical Analysis

Results

2. The Optimal Hypoxia Treatment Time For Cardiomyocyte Hypoxia Model

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1