Animals and treatment
Forty-five-week-old clean grade male ICR mice whose weights ranged from 20-22g were obtained from Vital River Laboratory Animal Technology Co. Ltd (Beijing, China). The mice put into standard plastic boxes (26 cm ×15 cm ×15 cm), 5 mice per box, with hygienic laboratory conditions at 20 ± 2 ℃ with a 12 h photoperiod and relative humidity of 60 ± 10%, with a 12:12 hour light/dark cycle. Animals were fed pellets food and water ad libitum, following the procedures of the Animal Experiments and Experimental Animal Welfare Committee of Capital Medical University (ethical review number: AEEI-2019-003).
After adapting to the lab conditions for one week, 40 healthy adult male mice were randomly divided into either a saline control group or SiNPs group and there were 20 mice per group. The mice in the SiNPs group were administrated with 20mg/kg SiNPs by tracheal perfusion once every 5 days for a total of 35 days. The dosage of 20 mg/kg was based on previous studies of acute toxicity studies(22). The mice in the saline control group were given equivalently volumes of normal saline. After 35 days, the mice were sacrificed using tribromoethanol anesthesia, and the blood, testis, and epididymides collected from each animal for analysis. After 1 h at room temperature, the blood samples were centrifuged for 15 min at 3000 rpm (Eppendorf, 5415D, USA), then the serum samples were amassed and stored at -80℃ for future analysis, one side of the testis was fixed for the histopathological experiment, and the other side was stored at -80℃ and liquid nitrogen.
Determination of the SiNPs characterization
The configuration of the SiNPs was verified using the transmission electron microscope (TEM) (JEOL JEM 2100, Japan), and their hydrodynamic size and zeta potential of SiNPs were detected in distilled water, saline, and Dulbecco’s modified eagle’s medium (DMEM) using a Zetasizer (Nano ZS90; Malvern, UK). Before addition of the SiNPs to the culture medium, a sonicator (160 W, 20 kHz, 5 min) (Bioruptor UDC-200, Belgium) was used to suspend SiNPs to minimize their aggregation.
Analysis of the sperm quality and quantity
Sperms were extracted from the epididymides and immediately incubated in Dulbecco’s Modified Eagle Medium (2 mL) at 37 ℃ for 5 min, then their concentrations and motility were measured using semen analyzer (Hamilton Thorne IVOS-II; Hamilton Thorne Research, Beverly, MA, USA). A smear of the sperm suspension was made on the glass. To determine the sperm deformation, the number 1000 sperms under a high magnification microscope (Olympus BX53, Japan) by counting. Sperm were scored as normal or abnormal using the Kruger strict criteria. Sperm morphology was observed and imaged under a light microscope (Olympus BX53, Japan).
The sperm abnormality=The abnormality sperm number/1,000×100%
|
Histopathological analysis of the testis
After animals were sacrificed with tribromoethanol anesthesia, the testis from a side of the mice in all groups were fixed in 4 % paraformaldehyde, embedded in paraffin blocks, sectioned and stained with hematoxylin and eosin (HE) for histological examination. The testis sections were observed using the Qupath (The University of Edinburgh, Scotland) software.
Detection of spermatozoa cell apoptosis in the testis
Cell apoptosis in the testis was analyzed using the method of terminal deoxyribonucleotide transferase-mediated nick end labeling (TUNEL). Each group of testis sections were stained using the TUNEL assay kit (KeyGen, Nanjing, China). In apoptotic cells, Biotin-labeled dUTP could be linked to the 3′-OH end of the DNA fragments with the TdT enzyme. Fluorescence microscopy can detect fluorescein-isothiocyanate (FITC), which the labeled streptavidin binds to biotin during the biotin-streptavidin amplification. The testis sections were first dewaxed, and then the sections were dealt with Proteinase-K working fluid for permeabilization and then reacted with the TdT working solution (mixture of dUTP and the TdT-enzyme). The testis sections were stained with streptavidin fluorescein; meanwhile, the nucleus were stained by DAPI (ThermoFisher, USA). The testis sections of each group were imaged using laser scanning confocal microscopy (A1R HD25, Nikon, Japan). Ten visual fields from each group were selected randomly to examine the relative fluorescence intensity and count the number of TUNEL-positive cells per tubule. The relative fluorescence intensity was analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Protein expressions detection of MTCH2 and apoptotic signaling pathway in the testis
To expound the influence of the SiNPs on the expression of the cellular factors involved in the MTCH2 and apoptotic signaling pathway, the protein levels of MTCH2, BID, BAX, Cytochrome C, Caspase-9, and Caspase-3 in the testis were determined with western blot analysis.
The total protein of the testis tissues was extracted using a bicinchoninic acid (BCA) protein assay. Equal amounts of lysate proteins (40 μg per testis tissue) were electrophoresed in SDS-polyacrylamide gels (12% separation gels) and transferred to nitrocellulose membranes (Millipore, USA). After being blocked with 5% bovine serum albumin (BSA) (Epsilon, USA) and being dissolved in Tris-buffered saline (TBS) containing 0.05% Tween-20 (TBST) for 1 h at room temperature, the membranes were incubated with rabbit polyclonal antibodies of MTCH2 (1:500, Abcam, UK), BID (1:1000, proteintech, USA), BAX, Cytochrome C, Caspase-9, and Caspase-3 (1:1000, CST, USA) overnight at 4 ℃, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1:1000, CST, USA) was used as an internal control. The membranes were then washed with TBST and incubated with fluorescent anti-rabbit Ig G secondary antibody (Amyjet, China) for 1 h at room temperature. After washing with TBST three times, the antibody-bound proteins were detected with Li- Cor Odyssey system (Li-Cor Biosciences). The densitometric values of the protein bands were analyzed using Image Studio Lite Software (Li-Cor Biosciences).
Cell cultures and experimental design
Primary mouse spermatocyte cells (GC-2spd) were purchased from Guangzhou Jennio Biotech Company Limited. The cells were cultivated in Dulbecco's Modified Eagle's Medium (DMEM) (Genview, USA) furnished with 10 %fetal bovine serum (Gibco, USA), 100 mg/mL streptomycin, 100 U/mL penicillin, and cultured at 37 ℃ in a 5 % CO2 humidified environment. The cells were seeded into 10-cm (diameter) dishes at a density of 1 × 105 cells/mL. The spermatocyte cells were divided into two groups, those with 0 mg/mL SiNPs and those with 5 mg/mL SiNPs and the cells in each group were serially passaged for 30 generations. At each generation, the cells in the 5 mg/mL SiNPs group were exposed to SiNPs in a culture medium for 24 h after cell attachment, and the cells in the 0 mg/mL SiNPs group were exposed to an equivalent volume of culture medium without the SiNPs. To evaluate the function of the key miRNAs associated with apoptosis, the spermatocyte cells were transfected with mimic and inhibitor. The mimic can increase the activity of the miRNAs, whereas the inhibitor can restrain its activity. The transfection experiment of the mimic and inhibitor involved 6 groups: control group, SiNPs group, mimic transfection group, mimic negative control group, inhibitor transfection group, and inhibitor negative control group. The mimic and inhibitor were synthesized by Sangon Biotech Company, Ltd, Shanghai. Each group had three replicate wells. All experiments were carried out at least three times.
Prediction of target genes of the miRNA
Data about the prediction of the target genes of the miRNA were obtained from MiRWalk (https://www.umm.uni-heidelberg.de/apps/ zmf/mirwalk),RNA22 (https://cm.jefferson.edu/rna/22), RNA- hybrid (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/), Micro T (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=microT_CDS/index), miRMap (https://mirmap.ezlab.org/), and PITA (https://genie.weizmann.ac.il/pubs/mir07/), RNAhybrid (http://alk.ibms.sinica.edu.tw/cgi-bin/RNAhybrid/RNAhybrid.cgi ) from CapitalBio Technology Corporation (Beijing, China). Starbase (http://starbase.sysu.edu.cn./) was then used to verify the target genes of the miRNA.
Transfection
Spermatocyte cells in the 5μg/mL group were transfected with four groups of the vectors: miRNA-450b-3p mimic group, mimic negative control group, inhibitor group, and inhibitor negative control group. The mimic of the miRNA-450b-3p (AUUGGGAACAUUUUGCAUGCAU), the mimic of the negative control of miRNA-450b-3p (GGAUAUUCAAGUGAUCUCAUGU), the inhibitor of miRNA-450b-3p (AUGCAUGCAAAAUGUUCCCAAU), and the inhibitor of the negative control of miRNA-450b-3p (CAGUACUUUUGUGUAGUACAA) were devised and synthesized by Sangon Biotech Company. Ltd (Shanghai). After exposure to the SiNPs for 30 generations, cells at a density of 1 × 105 were allowed to adhere to a six-hole plate for 24 h. After the cells were washed thrice with PBS, they were cultured in 1750 μL DMEM for transfection. The 117.5 μL of the Opti-MEM (Gibco, USA) and 7.5 μL of the mimic, mimic negative control, inhibitor, and inhibitor negative control were first mixed for 5 min, respectively, and 117.5 μL of the Opti-MEM and 7.5 μL of the EndoFectinTM-MAX transfection array (GeneCopocia, Inc., Guangzhou, China) were mixed for 5 min. The two mixed solutions described above, were again mixed together for 20 min. Then the cells were cultured for 24 h, and finally, the cells were collected for detection.
Detection of the expression levels of the miRNA and mRNA
The total RNA was extracted from the GC-2spd cells and testis by the Trizol method according to the manufacturer's instructions (Trizol; Applygen Technologies Inc., Beijing, China). RT-PCR of the miRNA was conducted using the All-in-OneTM miRNA qRT-PCR Detection Kit (GeneCopocia, Inc., Guangzhou, China). The RT-PCR of the mRNA was conducted using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) and KAPA SYBRR FAST Universal qPCR Kit (Kapa Biosystems, USA), separately. U6 and GAPDH were regarded as the references. The relative expression levels of the miRNA and mRNA were represented as 2(-△△Ct).
Detection of cell viability and lactate dehydrogenase
After being exposed to 5μg/mL of SiNPs for 30 generations, the GC-2spd cells were seeded into 96 wells at a density of 7000 cells per well. Then, the mimic, mimic NC, inhibitor, and inhibitor NC of the miRNA-450b-3p were transfected for 24 h. After culturing for 24 h, 10 mL of Cell Counting Kit-8(CCK8) (Dojindo, Japan)was added to the cells, and then, they were incubated for 4 h. The absorbance was detected at 450nm using a microplate reader (Thermo Multiskan MK3, USA). In order to indicate whether the cell membrane was damaged, lactate dehydrogenase (LDH) leakages were detected using the LDH Kit (KeyGEN BioTECH, Nanjing, China), as its instructions. After GC-2spd cells were transfected, we assessed the supernatants by detecting their absorbance at 440nm using a microplate reader (Thermo Multiskan MK3, USA).
Detection of the GC-2spd cells apoptosis in testis
After being exposed to 5μg/mL of SiNPs for 30 generations, the GC-2spd cells were seeded into 6 wells at a density of 1 × 105 cells per well. Then, we transfected the mimic, mimic NC, inhibitor, and inhibitor NC of the miRNA-450b-3p for 24 h. Using the PBS washing GC-2spd cells for three times and then centrifuging the cells at 1500 rpm for 5 min and then they were suspended in 500 μL of binding buffer. There was 5 μL Annexin V-FITC and 5 μL PI added to the cells in the dark. Analysis apoptosis of the cells by flow cytometry.
Protein expression analysis of MTCH2 and apoptotic signaling pathway in the GC-2spd cells in vitro
To expound the influence of the SiNPs and the miRNA-450b-3p on the expression of the cellular factors involved in the MTCH2 and apoptotic signaling pathway, the protein levels of the MTCH2, BID, BAX, Cytochrome C, Caspase-9, and Caspase-3 in GC-2spd cells were determined through western blot analysis.
After transfect of the mimic, mimic NC, inhibitor, and inhibitor NC of the miRNA-450b-3p, the proteins in the GC-2spd cells were extracted and quantified using a bicinchoninic acid (BCA) protein assay (Dingguo Biotechnology, China). The equal amount of lysate proteins (20 μg per cells group) were electrophoresed in SDS-polyacrylamide gels (12 % separation gels) and transferred to nitrocellulose membranes (Millipore, USA). After being blocked with 5% bovine serum albumin (BSA) (Epsilon, USA) and being dissolved in Tris-buffered saline (TBS) containing 0.05% Tween-20 (TBST) for 1 h at room temperature, the membranes were incubated with rabbit polyclonal antibodies of MTCH2 (1:500, Abcam, UK), BID (1:1000, proteintech, USA), BAX, Cytochrome C, Caspase-9, and Caspase-3 (1:1000, CST, USA) overnight at 4 ℃, rabbit-anti-β-Actin (1: 1000; Santa Cruz, USA) was used as an internal control. The membranes were then washed with TBST and incubated with fluorescent anti-rabbit Ig G secondary antibody (Amyjet, China) for 1 h at room temperature. After washing with TBST three times, the antibody-bound proteins were detected with Li- Cor Odyssey system (Li-Cor Biosciences). The densitometric values of the protein bands were analyzed using Image Studio Lite Software (Li-Cor Biosciences).
Statistical analysis
All the experimental data were analyzed by using the SPSS 17.0 software. Independent-sample t tests was used to analyze the data in the experiments. The values of p < 0.05 was considered as statistically significant. Data were expressed as means ± standard deviation (S.D.).