Immunohistochemical Staining (IHC)
The 99 pairs of pancreatic cancer tissue and matched non-cancer normal tissue were purchased from Shanghai Outdo Biotech Company. First, the specimen was deparaffinized and antigen-blocked with citric acid. Subsequently, Rabbit Anti-CCNI2 (Abcam, USA, Cat. # ab97767) was added and incubated at 4°C overnight. After elution with PBS several times, Goat Anti-Rabbit IgG H&L (HRP) (Abcam, USA, Cat. # ab205718) was added and incubated at room temperature. After multiple elution with PBS again, the tissue sections were stained with DAB and hematoxylin again. Finally, images were taken under a microscope and evaluated by the German immune response score [11], the high and moderate expression parameters are determined by the median of the experimental sample in the total IHC experimental score.
Cell Culture
Human pancreatic cancer cell lines PANC-1 and SW1990 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All pancreatic cancer cell lines were incubated at 37°C under 5% CO2 atmosphere, supplemented with Dulbecco's modified Eagle's medium (DMEM, GibcoBRL, Grand Island, NY, USA) and 10% fetal bovine serum (FBS, Gibco BRL). The medium was changed every 72 h, and 0.05% trypsin and 0.02% EDTA were passaged at a concentration of 80%.
Lentiviral shRNA Vector Construction and Cell Transfection
First, three RNA interference target sequences were designed using CCNI2 as a template. The sequence with the highest knockdown efficiency was selected and ligated to the linearized vector BR-V108. At the same time, BR-V108 linear vector (Shanghai Biological Science Co., Ltd., Shanghai, China) was obtained by digestion with restriction enzyme AgeI (NEB, Cat. # R3552L) and EcoRI (NEB, Cat. # R3101L). The clones on the medium were selected for PCR identification, and the clones were sequenced and analyzed. Culture positive clones and extract plasmids according to the kit instructions (Endo Free midi Plasmid Kit, TIANGEN, Cat. # DP118-2). After that, 293T cells were co-transfected with three plasmids (BRV-108, Helper 1.0 and Helper 2.0). According to different experimental requirements, it was determined to adopt the corresponding concentration and purification method to obtain high titer lentivirus preservation solution. Based on quality standards, various indicators of lentivirus are tested, such as sterility, viscosity, color and titer. After 72 h, the expression of green fluorescent protein was observed with a fluorescence microscope to evaluate the transfection efficiency.
Target sequence (Number)
|
Sequence (5’-3’)
|
Human-CCNI2-1 (Pbr00138)
|
TACCTGCATTGCGCCACAATT
|
Human-CCNI2-2 (Pbr00164)
|
ATCTGCGACGCCTTCGAGGAA
|
Human-CCNI2-3 (Pbr00165)
|
CCTGGAAGGCGACCTGGACGA
|
Quantitative Real-Time -PCR (qPCR)
First, follow the manufacturer's instructions (Thermo Fisher Scientific, Cat. # 204211) to extract RNA from human pancreatic cancer cell lines PANC-1 and SW1990. The Nanodrop 2000/2000C spectrophotometer was used to determine the concentration and quality of the extracted RNA. Promega M-MLV kit was then used to obtain cDNA by reverse transcription. Finally, the cDNA was used as a template, and the primer information was shown below, GAPDH was used as a reference control, AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) was added to perform qPCR and the fusion curve was drawn.
Primer
|
Upstream Primer
Sequence (5’-3’)
|
Downstream Primer
Sequence (5’-3’)
|
GAPDH
|
TGACTTCAACAGCGACACCCA
|
CACCCTGTTGCTGTAGCCAAA
|
CCNI2
|
CCAGGGAGTATGAATGAATGTT
|
TTGGGATAAGCCTGGGAAGTT
|
Western Blot
The BCA protein assay kit (Thermo Fisher Scientific, catalog number A53227) extracted and quantified the total cellular proteins of human pancreatic cancer cell lines PANC-1 and SW1990. Thereafter, proteins were separated by 10% SDS-polyacrylamide gel (SDS-PAGE) electrophoresis. Next, the sample was transferred to polyvinylidene fluoride (PVDF) membrane at 4°C. After blocking, the membrane was first incubated with Anti CCNI2, Akt, p-Akt, CDK6, MAPK9, PIK3CA and GAPDH (internal reference), then incubated with Goat Anti-Rabbit IgG H&L (HRP) (1: 3000, Beyotime, Cat. # A0208). Finally, the blots were imaged using the reagent Amersham ECL and luminescent image analyzer.
Antibody Name
|
Band Size (Kda)
|
Diluted Multiples
|
Antibody Source
|
Company
|
Number
|
CCNI2
|
41/50
|
1:1000
|
Rabbit
|
Abcam
|
ab97767
|
Akt
|
60
|
1:1000
|
Rabbit
|
CST
|
4685
|
p-Akt
|
60
|
1:1000
|
Rabbit
|
Bioss
|
BS5193R
|
CDK6
|
37
|
1:1000
|
Rabbit
|
Abcam
|
ab15127
|
MAPK9
|
48
|
1:1000
|
Rabbit
|
Abcam
|
ab76125
|
PIK3CA
|
110
|
1:1000
|
Rabbit
|
Abcam
|
ab40776
|
GAPDH
|
37
|
1:3000
|
Rabbit
|
Bioworld
|
AP0063
|
MTT Assay
ShCCNI2 and the negative control group shCtrl human pancreatic cancer cell lines PANC-1 and SW1990 cells (2 × 103 cells/well) were seeded at 100 μL/well in 96-well plates for 120 h. After trypsinization, the medium was completely resuspended. Subsequently, 20 mg of 3 (4,5-dimethylthiazole 2yl) 2,2,5 (diphenyltetrazole bromide) (MTT) (5 mg/mL) (Genview, Beijing, China; catalog number JT343) was added. After the medium is completely removed, 100 μL of dimethyl sulfoxide (DMSO) was added and mixed solution. Microplate reader was used to detect the OD value (the value of OD490 reflects the number of living cells), and the data for analysis.
Colony Formation Assay
PANC-1 and SW1990 cells with CCNI2 knockdown and the negative control group shCtrl are trypsinized, resuspended in complete medium to make a cell suspension, and counted. Cells were continuously cultured for 8 days, which were seeded in 6-well plates (2 mL/well) with 600 cells/well. Then 1 mL of 4% paraformaldehyde was added to each well, fixed for 60 min, and the cells were washed once with PBS. 500 μL of GIEMSA staining solution was stained the cells for 20 min. Finally, the cells were washed several times, and cell clones were photographed under a fluorescent microscope after being dried.
Flow Cytometry Apoptotic Assay
PANC-1 and SW1990 cells with CCNI2 knockdown and the negative control group shCtrl were seeded in 6-well plates (2 mL/well). After the cells were continuously cultured for 5 days, they were trypsinized and suspended. Annexin V-APC was added and stained in the dark for 15 min. The percentage of cell phase was determined by FACScan to evaluate the apoptotic rate, and the results were analyzed.
Transwell Assay
The chamber was placed in an empty 24-well plate, and 100 μL of serum-free medium was added to the chamber. After that PANC-1 and SW1990 cells with CCNI2 knockdown and the negative control group shCtrl were cultured in 24-well plates for 24 h. The number of seeded cells was 5× 104 cells/well, of which the inner chamber was 100 μL/well and the outer chamber was 600 μL/well. These cells were trypsinized and resuspended in low serum medium. Subsequently, the Transwell chamber was removed and washed with PBS. Next, it was fixed in methanol for 30 min, and stained with 0.1% crystal violet for 20min. Finally, the cells were observed under a microscope, photographed and counted.
Wound-healing Assay
PANC-1 and SW1990 cells with CCNI2 knockdown and the negative control group shCtrl at 1× 105 cells/well were seed in a 96-well plate (100 μL/well) and cultured 120 h, then serum medium with a low concentration was replaced. Align the scraper at the lower part of the 96-well plate and push it up slightly to form a scratch. Pictures were taken at preset time points (8 h and 24 h for PANC-1; 24 h and 30 h for SW1990), and cell migration rates were then calculated for each group.
Animal Xenograft Model
Animal experiments have been approved by the Ethics Committee of Shanghai Tongji University and conducted in accordance with guidelines and protocols for animal care and protection. BALB/c female nude mice (4 weeks old) were purchased from Shanghai Jiesijie Experimental Animal Co., Ltd. (Shanghai, China). Twenty mice were randomly divided into two groups, shCtrl and shCCNI2. Subsequent subcutaneous injection of trypsinized human pancreatic cancer cells SW1990 was performed in the right arm of the mouse. After 18 days, tumor size was measured every other week. Subsequently, mice were anesthetized intraperitoneally with 0.7% sodium pentobarbital (dose, 10 μL/g), tumor burden was assessed by bioluminescence imaging, and analyzed by IVIS spectral imaging system (emission wavelength of 510 nm). After 46 days, the experimental mice were sacrificed at the cervical spine and the tumors were removed. Finally, tumors were measured for volume and weight and photographed.
Ki67 Staining
Tumor tissue removed from the mice was sectioned, and the antigen was repaired and blocked with citrate. Antigen was eluted multiple times with PBS before and after antibody addition. Subsequently, antibody Ki67 (1: 200), (Abcam, USA, Cat. # ab16667) was added to the groups of shCCNI2 or shCtrl, respectively, and incubated overnight at 4°C. Thereafter, Goat Anti-Rabbit IgG H&L (HRP) (1: 400, Abcam, USA, Cat. # ab6721) was added and incubated for 30 min at room temperature. Tissue sections were stained with DAB first and then with hematoxylin. Finally, the images were collected with an optical microscope and analyzed.
Human Apoptosis Antibody Array
The human apoptotic antibody array kit (Cat. #AB134001) was used to examine the intracellular apoptotic signaling pathway. PANC-1 cells with CCNI2 knockdown and the negative control group shCtrl were collected, washed with PBS, lysed with lysis buffer at 4°C for 30 min, and then shaken gently to mix. The total protein extracted was diluted to 0.5 mg/mL with the array dilution buffer kit. Each array antibody membrane was blocked with blocking buffer for 30 min at room temperature, incubated at 4°C and gently shaken overnight. Biotin-conjugated anti-cytokine was incubated overnight at 4°C and then gently shaken. After adding HRP-linked streptavidin to the membrane, the protein was visualized using ChemiDoc XRS chemiluminescence detection and imaging system. Finally, the density of spots was quantified using Quantity One software and normalized to alpha-tubulin levels.
Statistical Analysis
The data were expressed as mean ± SD (n ≥ 3) and analyzed using GraphPad Prism 8.0 software (GraphPad Software Inc., San Diego, CA, USA). The qPCR was analyzed by 2−∆∆CT method. T-test were used to compare the difference. P values less than 0.05 were considered statistically significant.