A PyrR Regulating the Pyrimidine Biosynthesis Lost Antibacterial Ability Using CRISPR/Cas9-Mediated Knock-out for Metabolic Engineering at Lactobacillus casei

doi:10.21203/rs.3.rs-2470002/v1

Download PDF

Research Article

A PyrR Regulating the Pyrimidine Biosynthesis Lost Antibacterial Ability Using CRISPR/Cas9-Mediated Knock-out for Metabolic Engineering at Lactobacillus casei

https://doi.org/10.21203/rs.3.rs-2470002/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Lactobacillus casei had four possible probiotic roles, such as antimicrobial antagonism, competitional adhesion, immunoregulation and inhibition of bacterial toxin. The complex environment of gut microbe blocked to explore the antimicrobial scheme through genetics, metabolomics, proteomics, and signal transduction wth Lactobacillus casei. The genome editing Lactobacillus and germ-free animal provided the similar studying model of cell signal pathways to fully elucidate the probiotic mechanisms in animal.

Results

To delineate the metabolic reactions of nucleotides from L. casei associated with mechanisms of inhibiting pathogens and immunoregulation, we report the PyrR gene which was an important regulon to promote the pyrimidine biosynthesis, and PyrR deficient L. casei strain was successfully constructed with CRISPR-Cas9^D10A tool. There were some changes with the basic biological characterization, such as decreasing the growth, auxotroph and morphological damage in the PyrR deficient strain. The metabolic profiles of supernatant between PyrR deficient and wild strain revealed a complementary regulation from other metabolic pathways within decreasing pyrimidine biosynthesis. Besides, the PyrR deficient strain significantly lost the character of inhibiting the growth of pathogens. We further identify PyrR regulating pyrimidine biosynthesis, which further improved the internalization and colocalization with the development of macrophages.

Conclusions

Evidence shows that PyrR gene is an active key for regulating pyrimidine biosynthesis in L. casei supernatant against a wide range of pathogens. The complementary regulation for the PyrR deficient could no inhibit the growth of pathogens, and immune regulation in the macrophages from mice. Thus, the deletion of PyrR in L. casei lost the probiotic character of antimicrobial antagonism and immunoregulation.

CRISPR/Cas9

Lactobacillus casei

PyrR

pyrimidine biosynthesis

Lactic acid bacteria (LAB) are a heterogeneous group of Gram-positive bacteria, and probiotic function, with high tolerance for low pH. The living lactic acid bacteria have favorable effects on human and animal health. The study indicated that probiotics significantly reduced antibiotic associated diarrhea by 52% and acute diarrhea of various causes by 34%[1]. Molecular and genetic studies have allowed the determination of the basics of inhibiting pathogens with probiotic for four mechanisms, such as antimicrobial antagonism from metabolic products, competition with pathogens for adhesion, immunoregulation[2 Suppl] and inhibition of bacterial toxin[2].Various studies have indicated that LAB inhibit pathogenic microorganisms’ growth and degrade mycotoxins. LAB is abundantly found to remove and degrade different types microorganisms in by disrupting, changing the permeability of the plasma membrane, producing metabolites, inhibiting the protein translation. However, the growth optimum for LAB is at complex nutritional requirements for amino acids, peptides, nucleotide bases, vitamins, minerals, fatty acids and carbohydrates. Meanwhile, LAB could also produce a variety of products including short-chain fatty acids, amines, bacteriocins, vitamins and exopolysaccharides during metabolism. However, the concrete antibacterial mechanisms of LAB were complicated to attribute to its ability to produce antimicrobial compounds, including bacteriocins, with strong competitive action against many microorganisms. The proteomics of probiotics provide the special reference and tool to lactic acid bacteria with a view to understand metabolic function to answer basic cell functions. Nevertheless, the single and multiple omics technique describes for gaining mechanistic insights and discovering new metabolic properties of LAB.

The genome editing tools can be used to overcome current challenges in all these perspectives of traditional, emerging and future applications of lactic acid bacteria. The genome editing tools of LAB with a focus on fast speed, clean targeted modifications and stable genomic genotype for a wide variety of strains, which is crucial construction of strains for both fundamental studies, applications and products. Most metabolic reactions in the LAB are connected with the utilization of nucleotides or their metabolites regulation of nucleotides, such as pyrimidine and purine metabolism. The novel pyrimidine derivatives have been the promising areas of new antibacterial drug discovery. The derivatives to interact with genetic materials, enzymes and other biopolymer substances in the cell. The pyrimidine containing agents are the major areas of new antibacterial drug for their good activities and diverse mechanisms, which is an advantage in the endogenous substances and derivatives to interact with genetic materials, enzymes and other biopolymer substances in the cell[20]. The formation of pyrimidine was with different steps in the biosynthetic pathway of LAB, biosynthetic genes of pyrimidine are scattered on the chromosome of L. lactis subspecies for five transcriptional units[3]. The inactivation of PyrR in the Lactococcus lactis could result derepression in the expression of all pyrimidine biosynthetic genes for 3 to 8-fold, which played an attenuator mechanism with the PyrR regulon[9]. Given that the PyrR from B. subtilis possess a significant enzymatic activity in vitro and in vivo[14]. In previous study, there was no research on the metabolic regulation with the inactivation gene method in the PyrR of the lactobacillus. The deleting PyrR gene with the genome editing of CRISPR-CAS9 provided the possibility to assess the regulating activity of the LAB.

In this study, we used the systematically biochemical properties of CRISPR-Cas9^D10A to engineer it into an efficient genome editing tool in Lactobacillus casei. We combined rational engineering and constructed PyrR deficient Lactobacillus casei strain that is able to decrease the production of pyrimidine analogue, which further extensively interfere growth on different pathogenic bacteria. Moreover, we identify that the pyrimidine analogue possesses an immunoregulatory activity in the PBMC. Our study is to provide an overview of the physiology and antibacteria of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in Lactobacillus casei.

2.1 Bacterial Strains and Plasmid

The Lactobacillus casei strain used in this study was cultured in the MRS broth (Sigma, St. Louis, MO, USA) without shaking at 37 ℃. The antibiotic concentration was 10 mg liter with erythromycin in MRS mediia. The competent cells of E. coli TG-1 was used as a cloning host. All E. coli harboring pCLNICK series plasmids grew on LB mediia with kanamycin (50 mg /liter) at 32 ℃. The Lactobacillus casei gene-editing plasmid pLCNICK was kindly supplied by Yang Sheng (Key Laboratory of Synthetic Biology, CAS, Shanghai, China). All the bacterial strains and plasmid for cloning, L. casei and L. casei DPyrR mutant used in this study are listed in Table 1.

Table 1 Oligonucleotides used in this study

Oligonucleotide	Sequence (5’→3’)
arm-pyrR-merge	GTTGTGAAATGCCATCTGATGTGCCACCCT
arm-pyrR-left-down	TGATGTGCCACCCTTTCTTAT
arm-pyrR-right-up	GATGGCATTTCACAACGACGA
pyrR106-up	GGGCCCCTCAATTCCTGAAGCCAAGC
pyrR106-down	TCTAGACCGCGGGTTTTGATGCCGACTAAACCGATGAAGGCAAAC
pyrR9-up	GGGCCCCTCAATTCCTGAAGCCAA
pyrR9-down	TCTAGACCTCGTCTACAACTTGTTTTGACACCGATGAAGGCAAACA
pyrR-exup	GAATTCATGGCACAGTCAAAACAAGT
pyrR-exdown	CTCGAGTTAGCCCTCCATCCTTTCG
arm-pyrR-yz-up	CTCAATTCCTGAAGCCAAGC
arm-pyrR-yz-down	ACCGATGAAGGCAAACAAGATGG
arm-pyrR-merge-up	TAAGAAAGGGTGGCACATCAGATGGCATTTCACAACGACGAAG

2.2 Plasmid Construction of PyrR-Deficient L. casei by CRISPR-Cas9D10A

All the steps of genes clone and plasmids construction was shown in Figure 1. According to the general principles of primer design, the PyrR gene and up/down homology arms was clone with the up-stream/down-stream primer. The pyrimidine regulatory gene(PyrR) was cloned as the targeting gene from the Lactobacillus casei. The PyrR and the upstream/downstream homology arms(HASup and HASdown) was amplified by the PCR. The PCR product (HASup-PyrR-HASdown) was connected into the cloning vector of pMD19, which was used the template to clone the HASup and HASdown genes. Both of HASup and HASdown genes were clone into the cloning vector. The cloning HASup and HASdown genes were connected with the fusion PCR, which PCR product was cloned into the pMD19. To construct pMD19-sgRNA-HASup-HASdown for genome deletion, the sgRNA was connected into a single fragment of HASup-HASdown by overlap-extension PCR. The resulting cassette of sgRNA-HASup-HASdown with XbaI and ApaI restriction endonuclease sites was ligated to cloning vector of pMD19. To generate the genome editing plasmid, the backbone of P23 promoter for Cas9D10A, Emr, the promoter of Pldh for sgRNA, sgRNA and Has (obtained by restriction endonuclease of XbaI and ApaI from the pMD19-sgRNA-HASup-HASdown plasmid), which was named pLCNICK-PyrR-HAS-sgRNA. All these recombinant plasmids were chemically transformed into competent cells of E. coli TG1.

2.3 Transformation of Lactobacillus casei for electroporation

The constructed plasmids were transformed into L. casei by electroporation. The competent cells of L. casei were prepared as follows protocol. The 2 mL of an overnight L. casei was cultured into 100 ml MRS+ 2% glycine media and incubated until the optical density at logarithmic phase at 37 ℃ without shaking at 5,000 rpm and 4℃. The L. casei cell were chilled on ice for 10 min and harvested by centrifugation at 5,000 rpm and 4℃ for 10 min, which were washed twice with 40 mL of ice-cold EPWB(NaH₂PO₄ 0.6mmol/L, MgCl₂0.1mmol/L) and then washed one times in 40mL of ice-cold EPB(NaH₂PO₄ 0.6mmol/L, MgCl₂0.1mmol/L, 0.3mol/L Sucrose). The L. casei cell was centrifuged for 10 min at 5,000 rpm and 4℃. The iced L. casei competent cell was resuspended with 1mL EPB, which was used to prior electroporation.

The competent cells of L. casei mixed with 1 mg plasmid of pLCNICK-PyrR-HAS-sgRNA were transferred into a precooled 2 mm electroporation cuvette at 2.2 kV, 200 W, and 25 mF with a Bio-Rad GenePulser Xcell. The precooled MRS+500mM sucrose broth for 1 mL was immediately added in the electroporation cuvette, which was transformed into the culture tube to recover growth for 5 hours at 37 ℃ without shaking. The recovered cell was grown on the MRS plate containing erythromycin(5 mg/mL) for 4 or 5 days, and the single colonies were randomly selected to grow in MRS broth containing erythromycin(5 mg/mL). All the colonies were used to extract the genome as the template determining the PyrR knocked out with the PCR method. The L. casei mutation strain, with the PyrR gene deletion in the genome, was constructed to identify the positive clones named the L. casei DPyrR. All the PCR products from identifying the positive clones were sequenced to confirm the deleting strain.

2.4 Batch Fermentation, Growth Curve, and Lactic Acid Production

The fermentation was carried out 100 mL MRS media in 250 mL Erlenmeyer flasks. The L. casei and L. casei DPyrR strains, were statically cultivated in MRS medium at an initial density OD600 of 0.05 (MRS Broth, Becton, Dickinson and Company, Japan). The cultures cell were incubated at 37 ℃ without shaking. For time-course experiments, samples were taken every 2 h for the analysis of bacterial population density.

2.5 Determination of 5-FOA susceptibility

The strains L. casei and L. casei DPyrR were cultivated on MRS solid plates consisted 5-FOA for the amounts of 250 μmol/L. The strains of L. casei and L. casei DPyrR were incubated on MRS plates at 37 ℃ for 3-4 days. The growth and morphology of the colonies incubated on the plates were evaluated to assess the tolerance of the L. casei and L. casei DPyrR strains to 5-FOA.

2.6 Fermentation and detection of metabolic production

The fermentation was carried out 10 mL MRS media in 250 mL Erlenmeyer flasks. The L. casei and L. casei DPyrR strains, were statically cultivated in MRS medium at an initial density OD600 of 0.05. The cultures cell were incubated at 37 ℃ without shaking for 24 hours. The suspensions and cells of L. casei and L. casei DPyrR were quantified by high-performance liquid chromatography (HPLC) with the study of the metabolic production. The samples was performed with the following conditions: All samples and precooled buffer (20% H2O, 40% methanol, 40% acetonitrile v/v) were mixture together with ultrasonication in the ice-bath for 30 min. The separation were centrifuged for 30 min at 12,000 rpm and 4℃. All the samples were from vacuum dried , which were resolved with 100 mL solution (50% H2O, 50% acetonitrile v/v).

The raw data from LC-MS data were directly preprocessed using the Progenesis QI software for automatic search the selected databases. Data from the positive mode and negative mode were mixed and processed together for further multivariate statistical analysis included sample names, peak intensity, retention time (RT) and compound molecular weight, and metabolite identification.

2.7 Antibacterial Activity Assay

To investigate whether L. casei and L. casei DPyrR strains could induce the damage and growth of pathogenic microorganism. The antimicrobial activity was evaluated with the oxford cup antibacterial experiments to determine the changes of bacteriostatic activity of metabolic production and lactobacillus body composition from the L. casei and L. casei DPyrR strains. The Bacillus subtilis, Salmonella typhimurium and Staphylococcus aureus were used the indicator bacteria in the vitro experiment. The indicator bacteria suspension was diluted to 10⁸ cfu/mL, and 0.2 mL of each diluted bacterial culture suspension was inoculated on LB plates and evenly spread with a coater. Immediately, oxford cup performed by creating four vertical holes on the surface of solidified LB medium, and 0.1 mL of each sample was added to each hole with PBS(negetive control), antibiotic(positive control), microbial supernatant and lactobacillus body composition in each plate. Then, the petri dishes were incubated at 37 °C for 10 h, and the diameter of the circular antibacterial zone was measured to determine the antagonistic activity of the microbial supernatant and lactobacillus body composition. The experiment was repeated three times under the same conditions to afford the error estimates.

2.8 Scanning electron microscope analysis of genome editing Lactobacillus casei

The morphological comparison of genome editing Lactobacillus casei deleting PyrR was further validated through microscopic analyses by scanning electron microscope (SEM). The control and the deleting strain were cultured an optical density at 37°C without shaking. The samples were centrifuged and rinsed by 1x phosphate-buffered saline (PBS) for one time, which were fixed in a 2.5% glutaraldehyde solution buffered with 1x PBS and incubated overnight. The next step were dehydrated to use the increasing concentrations of 20, 40, 60, 80, and 100% ethanol, and then incubated in 100% ethanol overnight at 4°C. The dried samples were mounted on SEM stubs, which were coated with gold sputter for observation with Quanta™ 250 FEG SEM(Thermo Fischer Scientific; New Hampshire, USA), and the images were captured with PCI imaging software (Quartz Imaging Corp., Vancouver, BC, United States).

2.9 Fluorescent tracking of Lactobacillus in direct contact with macrophages

Brieﬂy, recombinant lactobacillus were grown in liquid MRS at 37 °C, and washed three times with phosphate buffered saline (PBS). The L. casei and L. casei DPyrR strains, were stained with Carboxyfluorescein diacetate, succinimidyl ester(CFDA-SE) for 30 min in 1 mL CFDA buffer at 37°C on a vertical rotator in the dark environment. To stain all the cell, the lactobacillus were washed twice with 5 mL PBS to remove excess CFDA-SE. Stained L. casei and L. casei DPyrR strains, were resuspended into single cell suspension with 1 mL 1640 cell culture media. The peritoneal macrophages were collected as previously described[2]. The mice were injected with 5ml of 1640 cell culture media into the peritoneum for the peritoneal macrophage collection. The abdomen was gently rubbed for 2 min for the release of peritoneal macrophages into the culture media from the abdominal cavity of mice. The peritoneal fluid was sucked out and transferred into a tube, which was centrifuged for 5 min at 1000 r/min and then macrophages were resuspended with the 1640 cell culture media containing 10% fetal calf serum, penicillin, and streptomycin at 37 °C under 5% CO2 air atmosphere for overnight.

To explore L. casei may promote the polarization of peritoneal macrophages with the pyrimidine production from PyrR gene, and we established the L. casei, L. casei DPyrR strains and peritoneal macrophages co-culture system of macrophages separately extracted from mice. The CFDA-SE-labeled L. casei, L. casei DPyrR strains, were contained inside the collecting macrophages were cultured for over-night at the in 12-well plates. After the incubation 37 °C under 5% CO₂ air atmosphere for 7 hours, the plate was washed two times with the pro-cold PBS and fixed with 4% paraformaldehyde for 30 min at RT. The wells were washed with pro-cold PBS and blocked with 1%BSA for 2 hours at RT. The F4/80⁺ served as a macrophage marker, which were performed by measurement of the activity of peritoneal macrophages for the stimulation of the pyrimidine production from L. casei PyrR gene. The peritoneal macrophages were blocked by incubation with anti-F4/80 antibody binding for 30 min in the RT at dark environment. Then the peritoneal macrophages were then washed and stained with DAPI for 10 min, and Images were captured with fluorescent microscopy ((Leica Microsystems, Madrid, Spain).

2.10 Data Analysis

The metabolomics data were analyzed using different modules of a web-based platform MetaboAnalyst (https://www.metaboanalyst.ca). Data were normalized using logarithmic transformation and auto-scaling. Fold change analysis and t - tests were conducted to determine the fold change and significance of each identified metabolite. All the sample were performed for three replication, and all the groups were examined as independent measurements to support adequately statistics in the experiments. The average duration of recovery and colonization over time were compared between groups using repeated-measures analysis of variance with Bonferroni’s correction using the SPSS software (IBM). Statistically significant effects (P < 0.05) were further analyzed, and mean values were compared with Tukey’s honestly significant difference test.

3.1 Knockout of pyrimidine biosynthesis of PyrR gene using CRIPSR-Cas9^D10Aedition in L. casei

Based on the CRISPR-Cas9^D10A genome editing plasmid, pLCNICK, pyrimidine regulatory gene(PyrR) was deleted to evaluate the knockout performance for the target of pyrimidine production. As shown of the schematic diagram of pLCNICK-mediated PyrR knockout, all the strain and constructing primers and plasmids from our studies were shown in the table 1 and table 2. The PyrR gene, upstream/downstream homology arms (HASup and HASdown) was cloned by the PCR assays as genome DNA template from L.casei using the primers pyrR-ex-up/down which was constructed as the plasmid of pMD19-PyrR in the table 2. The cloning vector carring the PyrR the upstream/downstream homology arms gene were respectively cloned to conduct the upstream homology arms and downstream homology arms gene, which genes were connected into the cloning vector, which were named pMD19-PyrRHAS-up and pMD19-PyrRHAS-down. Both of PyrRHAS-up and PyrRHAS-down genes were connected together with the fusion PCR assays, which PCR product was cloned into the plasmid of pMD19-PyrR-HAS. The sgRNA was cloned in front of the HAS in the plasmid of pMD19-PyrR-HAS-sgRNA, which then was ligated into the pLCNICK with the XbaI and ApaI restriction endonuclease sites. The genome editing plasmid of PyrR, which was named pLCNICK-PyrR-HAS-sgRNA. This plasmid of pLCNICK-PyrR-HAS-sgRNA containing Cas9, homologsheous arm (HAS) cassette genes and SgRNA targeting the PyrR gene in the Lactobacillus, which will guide the cleavage at the targeted gene and HAS DNA can be inserted into the designed restriction sites. The recombinant nutritionally deficient strain was constructed via the electrotransformation into the Lactobacillus casei growing in the MRS medium plates supplemented with erythromycin for 4 days. The clones were picked to grow in the MRS medium with the erythromycin resistance (Fig. 2A). The genome PCR results from different clones indicated that PyrR was completely knocked out in L. casei DPyrR (Fig. 2B). The PCR product were sent to gene-sequencing company, and the sequence results indicated that thePyrR genes were deleted in the gene site. The L. casei and L. casei DPyrR samples were analyzed with WesterBlot bands, which shown that L. casei DPyrR strain did not express the PyrR protein, and there was protein of PyrR in the L. casei wild strain (Fig. 2C).

Table 2 Plasmids and strains used in this study

Strain or plasmid	Relevant characteristics
Stains
L. casei LC2W	Wild type
E. coli DH5α	Commercial host for cloning
TG1	Commercial competent cell for cloning
BL21	Commercial competent cell for prokaryotic expression
Plasmids
pLCNICK	repA101(Ts), kan, P23-Cas9D10A,P_ldh-sgRNA, Has(PyrR), repD, repE and Em^r
pPROHTA	Iac1, MCS, Amp^r, ori, f1 ori
pMD19	ColE1 ori, LacZ operator, Amp^r
pMD19-PyrR	ColE1 ori, LacZ operator, Amp^r, PyrR
pPROHTA-PyrR	Iac1, MCS, Amp^r, ori, f1 ori, PyrR
PyrR-Has-updown	PyrR, HAS-up(PyrR), HAS-down(PyrR)
pMD19-PyrRHAS-up	ColE1 ori, LacZ operator, Amp^r, HAS-up(PyrR)
pMD19-PyrRHAS-down	ColE1 ori, LacZ operator, Amp^r, HAS-down(PyrR)
pMD19-PyrR-HAS	ColE1 ori, LacZ operator, Amp^r, HAS(PyrR)
pMD19-PyrR-HAS-sgRNA	ColE1 ori, LacZ operator, Amp^r, HAS(PyrR), sgRNA
pLCNICK-PyrR-HAS-sgRNA	repA101(Ts), kan, P₂₃-Cas9^D10A,P_ldh-sgRNA, Has(PyrR), repD, repE and Em^r, sgRNA

3.2 Biological Characterization of L. casei DPyrR

To further characterize the deletion of PyrR gene obtained L. casei and L. casei DPyrR mutants, which growth curves results showed that the L. casei and L. casei DPyrR were both S-shaped (Fig. 3A). Both of them entered the logarithmic growth phase at the eighth hour, but the number of L. casei DPyrR was lower than the wild strain of L. casei. They entered into the stable phase at about 16th-18th h; and then entered the decline phase. The difference was that the L. casei DPyrR directly went into the decline phase, which was earlier than the wild strain of L. casei, and the bacterial count of L. casei DPyrR was always lower than the wild strain of L. casei in the whole growing period. The pyrR encodes an mRNA-binding regulatory protein that negatively regulates pyr expression by sensing UMP or UTP. Mutant strain L. casei DPyrR was auxotrophic for uracil and 5-FOA resistance, whereas L. casei DPyrR was prototrophic for the uracil (Fig. 3B). 5-FOA resistance analysis showed that the wild type failed to grow well on the plates containing 5-FOA, whereas the L. casei DPyrR mutants grow well in the 5-FOA MRS plate. These results further confirm the PCR results, highlighting the feasibility of using the PyrR gene as a auxotrophic marker in the L. casei.

3.3 Morphological characteristics of genome editing Lactobacillus casei

In order to explore whether the deletion of PyrR gene affects the growth characteristics. The L. casei and L. casei DPyrR in the logarithmic growth phase and stable phase subjected to scanning electron microscope, and the morphological characteristics of the bacteria were observed(Figure 4). Similarly, the scanning electron microscope results also indicated that compared with L. casei, the morphological characteristics of L. casei DPyrR was significantly changed. Both in the 12th and 24th hour, the membrane of cells was keep integrated, and there was no leakage in the samples, which suggest that genome editing treatment had no obvious impact on the cell morphology. However, the cells became much shorter and serious leakage of cell contents was observed after the genome editing treatment deleting the PyrR gene. The deletion of PyrR gene affects the cell membrane permeability enhancement.

3.4 Changes in the metabolic profiles of L. casei editing the PyrR gene

To identify metabolites produced by lactobacilli deleting the PyrR gene that are candidates for microbiome mediated regulation of pyrimidine synthesis, we assessed the metabolome wiith non-targeted metabolomics analysis to identify bioactive small molecules in L. casei cell free supernatants, such as L. casei and L. casei DPyrR (Figure 5). A total of 1040 metabolites were detected in the supernatant of L. casei and L. casei DPyrR, and the major differences was about 71 metabolites with positive ion (53 metabolites, Figure 5A) and negative ion(18 metabolites, Figure 5B) modes depicted in Figure 4, respectively. Statistically significant metabolites profiled in this study are shown in Table S1. When organized into chemical classes and metabolic pathways, screening of major differences metabolite were classified into associated with biological processes from the positive ion(Figure 5D) and negative ion (Figure 5C)modes. From these differentially abundant metabolites, the positive ion mode mainly included 1. nucleoside, nucleotides and analogues, 2. organic acids and derivatives, 3. organoheterocyclic compounds. And negative ion mode mainly included 1. benzenoids, 2. organic acids and derivatives, 3. organoheterocyclic compounds. The pyrimidine, purine and secondary metabolites of anti-bacterial ingredient were significantly decreased in the L. casei DPyrR group, such as uracil, virhiniamycin and L-(+)-lactic acid. Certainly, these differentially abundant metabolites were used to analysis the metabolic pathway enrichment analysis. Based on the KEGG database, the significantly enriched metabolic pathways on differential metabolites were shown in Fig. 5E, which each bubble stand for one of signaling pathway in the bacterial biosynthesis for L. casei, such as biosynthesis of various secondary metabolites and pyridine alkaloid biosynthesis. All these enriched metabolic pathways were closed with the PyrR gene in regulation the synthesis of genetic material.

3.5 Interaction between pathway and metabolite set enrichment with the PyrR edition. `

The abundance of differential pathway based on the integrated metabolites comparing with the L. casei DPyrR and L. casei in Figure 6A. Pathway analysis and metabolite set enrichment analysis were performed as differential abundance score, which could indicate the average and total changes for metabolites enriched in the specific pathway such as cAMP signaling pathway, protein digestion and absorption, aminoacyl-tRNA biosynthesis, Tropane, piperidine and pyridine alkaloid biosynthesis. In a comparison of different pathways, pyrimidine and purine metabolism (Fig. 6B) and biosynthesis of secondary metabolites(Fig. 6C) were the most affected metabolic pathways by the PyrR gene. The expression of differential metabolites in pyrimidine and purine pathway shown that the deoxyadenosine, uracil, D-ornithine, lactic acid and citrate, which have been down-regulated by the PyrR gene with genome editing L. casei in the Figure 6B. Certainly, biosynthesis of secondary metabolites were enriched sources of drug leads, and in particular, numerous metabolites have been isolated from lactobacillus in the Figure 6C. The PyrR gene deletion decrease the production of secondary metabolites in the L. casei DPyrR comparing with L. casei. To explore the potential microbiota metabolic interactions between L. casei DPyrR and L. casei, a correlation network analysis was conducted using the differential metabolites from deleting the PyrR gene in the lactobacillus (Fig. 6D). The results of correlation network demonstrated that there were complex connections between the differential metabolites, and the key metabolites were reduction in the deoxyadenosine, uracil, mefenamic acid and pyrimidin-4-amine.

3.6 The antibacterial activities of deleting the PyrR gene in L. casei

The antibacterial activities of the nucleic acid produced from the L. casei and L. casei DPyrR were evaluated against Bacillus subtili, Staphyloccocus aureus, and Salmonella with the Oxford cup diffusion method, respectively in table 3. The bacterial inhibition diameter (mm) reflected the antibacterial activity with the culture suspension from L. casei and L. casei DPyrR for different dose (200 µL and 100 µL), and the PBS buffer and antibiotic were used as the negative and positive control groups, where a larger antibacterial diameter corresponds to a better antibacterial effect in the positive control group, L. casei group and L. casei DPyrR group. As shown in the Table 3, almost all of the culture suspension from L. casei and L. casei DPyrR produced a large or small clear inhibition zone against Bacillus subtili, Staphyloccocus aureus, and Salmonella. From all the results we could find that suspension from L. casei was high sensitivity(15mm-20mm) and moderate sensitivity (10mm-14mm) in the quality of 200 µL to the three pathogenic bacteria, such as Bacillus subtili, Staphyloccocus aureus, and Salmonella. However, the nucleic acid deficiency from the L. casei DPyrR groups have a small clear inhibition zone comparing with the wild strain group, which was also with a moderate sensitivity of antibacterial activity in the quality of 200 µL. There was no change of inhibition zone with dose-dependent in the wild strain of L. casei against the three pathogenic bacteria. But the L. casei DPyrR groups had significantly dose-dependent in theses pathogenic bacteria comparing within 200 µL and 100 µL. The suspension was low sensitivity against the Staphyloccocus aureus within 100 µL from the L. casei DPyrR group. The best antibacterial activities was from the Salmonella, which have the high sensitivity, which results were also with same trend comparing with furfure two pathogenic bacteria. According to the table, all of the above results indicated that antibacterial activity of the L. casei was from the pyrimidine’s metabolite in the suspension, but not the genome editing of L. casei DPyrR.

3.7 The interaction between peritoneal macrophages and genome editing of L. casei regulating the cell polarization

To ascertain the role of deleting PyrR gene in the L. casei-associated pyrimidine’s metabolite, wild L. casei were used to stimulate the differentiation and polarization in the peritoneal macrophages from the mice, which were treated with co-culture system of macrophages separately extracted from mice in figure 7. Both of peritoneal macrophages and L. casei were stained with F4/80+ and CFDA-SE marker respectively. Compared to the control group without the L. casei, the microbiome analysis revealed that both of L. casei and L. casei DPyrR could dramatically increase the percentage of the activity of peritoneal macrophages in the 12th hour and 24th hour. And the 12^th hour groups in the L. casei and L. casei DPyrR groups have much be better effect than the 24^th hour in these two groups. Moreover, the L. casei group induced obvious macrophage differentiation comparing with the L. casei DPyrR group in the 12th and 24th hours, and notably, there was no significant difference between the L. casei and L. casei DPyrR groups. But the activity of peritoneal macrophages in 12^th hour for control group was different with the 24^th hour in the same group. All these results indicated that both L. casei and L. casei DPyrR could stimulate the polarization of peritoneal macrophages from the mice. To detect the cellular compartment in which L. casei persists interaction with macrophages, we incubated mBMMs with CFDA-SE-labeled bacteria and assessed their colocalization with L. casei. Importantly, the deficiency of pyrimidine’s metabolite in the L. casei which preferentially targets peritoneal macrophages efficiently decreased the interaction, while L. casei DPyrR were observed surrounded by macrophages, which did not show colocalization with the marker suggesting that they are able to evade their localization. The L. casei-associated pyrimidine’s metabolite modified the internalization and colocalization with the macrophages.

Probiotics, strains containing to Bifidobacterium and Lactobacillus, which are the predominant groups of the gastrointestinal microbiota, have considerable potential for preventive or therapeutic applications in various intestinal disease. However, most of probiotic health claims have not yet been substantiated by experimental evidence in the enzymatic and the genetic regulation for different lactic acid bacteria. In addition, the efficacy demonstrated for one given bacterial strain cannot necessarily be transferred to other probiotic organisms. In our study, the interpretation of methods arising from genetics, metabolomics and proteomics have provided the opportunity to underly the mechanisms action in lactic acid bacteria, such as adhesion to intestinal mucosa, competitive exclusion of pathogenic microorganisms and production of antimicrobial substances. All these mechanisms should built the interaction of probiotics with the host-associated immune system. Our research firstly constructs the PyrR deficient Lactobacillus casei strain that is able to decrease the production of pyrimidine analogue, which further extensively interfere growth on different pathogenic bacteria.

The five transcriptional units, such as carB[17], pyrRPBcarA[9], pyrEC, pyrKDbF[16] and pyrDa[13], for pyrimidine biosynthetic genes are scattered on the chromosome of L. lactis subsp. The pyrR encoding a regulatory protein was the first gene of the pyrRPBcarA operon, which could decrease the expression of all pyrimidine biosynthetic genes for 3 to 8-fold in Lactococcus lactis[9]. The pyrimidine biosynthetic pathway is firstly from the formation of carbamoyl phosphate (CP), which also catalyze the conversion of DHO to orotate with the carAB-PyrB-PyrC-PyrD cassette. The orotic acid through cytosine(C), uracil(U), thymine(T), cytidine(CR), uridine(UR) is converted to UMP, which was the end product of the pyrimidine in the biosynthetic pathway. The site-directed mutagenesis had reduced UTP and CTP pools regulated by transcription attenuation mediated with a trans-acting repressor in Lactobacillus plantarum[6]. The PyrR type attenuators are found upstream of all pyrimidine biosynthetic genes, which can be identified in most lactobacilli excepting in L. casei. Our study developed the widely applicable and efficient PyrR-based CRISPR-Cas system in L. casei for whole genetic deletion, which provided original insights for the molecular mechanisms laid on the PyrR gene for the antimicrobial antagonism from metabolic products, competition with pathogens for adhesion, and immunoregulation. The molecular docking results indicated that pyrR protein attenuates the virulence through the biofilm formation and targeting pyrimidine de novo synthesis pathwayin S. aureus. To increase the sensitivity of 5-FOA, constructed the double mutant strain ΔpyrF ΔpyrR in Geobacillus kaustophilus, which is auxotrophic for uracil and resistant to 5-FOA[20]. The parasite PyrR activity is nonspecific and is active on uridine, deoxyuridine, pyrimidine and thymidine.

As a result, the selection (uracil auxotroph) and counterselection (5-FOA) markers can be utilized for developing CRISPR-Cas systems for broad and convenient clinical application on L. casei strains. And there was no effect on the growth-performance in the strains containing PyrR deletions as the uracil-auxotrophic hosts. The CRISPR-Cas9-based genome editing system combining wth the pyrF/5-FOA can both be time-saving and efficient in developing gene editing systems for diverse of A. baumannii strains[12]. Moreover, these genetic manipulation methods unveil the drug-resistance of oxidative stress-sensing mechanisms with the OxyR gene by performing from H2O2-sensing pocket in an A. baumannii strain. The reduced pyrimidine outside the lactobacillus in mutant bacteria likely reflects differences PyrR-induced cytotoxicity, which are then exported to the cell surface in the SEM results. In contrast, disruption of PyrR in the L. casei ΔPyrR strain produced a severe uracil auxotrophy due to the loss of the de novo pyrimidine synthesis pathway. These findings reveal the importance of ubiquitous surface modifications for PyrR function, which explaining the broad lactobacillus colonization and processes underlying host-pathogen interactions, and as well as highlight the utility of genome-wide CRISPR/Cas9 screens to explain the probiotic role.

Today, first-line ineffective antibiotics, the emerging pathogenic bacteria and reduced immunity are becoming an important reason of clinical death for patients. So novel antimicrobial agents from the probiotic are urgently needed in the drug discovery, which has attracted the attention of scientists due to its remarkable biological activity, such as anticancer, antiviral, antimicrobial, anti-inflammatory, analgesic, antioxidant and antimalarial therapies. They are characterized by bacteriocins, hydrogen peroxide, diacyls, which prevent the proliferation from glucose and growth inhibition[8]. The most famous was their antimicrobial compounds, and pyrimidines as integral part of DNA and RNA play an important role in the drug discovery projects in pharmacological and chemical significance[20]. Pyrimidine scaffold is one of the privileged heterocycles in antimicrobial drug discovery. Our research has firstly attracted the attention on the antimicrobial activity due to its remarkable pyrimidine pool in probiotic. The metabolite interacts with diverse protein targets in the pathogenic microorganism, such as inhibition of FtsZ polymerization, GTPase activity, and bacterial cell division[19]. 5-Fluorouracil has been used in a phase III clinical trial for antibacterial agent[11]. Many Gram-positive and Gram-negative bacteria were found to be susceptible to floxuridine[3]. And Streptococci, S. aureus and Bacillus species for Gram-positive bacteria were more sensitive than the Gram-negative bacteria, which was the same trend for the L. casei on the antibacterial activity in our teste. An encouraging example of metabolic engineering in Pseudomonas putida improve microbial bioconversion for the ferulic acid consumption with efficient genome editing strategy[1]. The deletion of the gene encoding 1,3-propanediol reductase in L. reuteri decreased the production of reuterin compared to the wild-type, which was identified a novel antimicrobial variant in killing E. coli[Pt 6]. Regarding synthetic biology developments, improving regulatory control systems with the silence and deletion in the host of lactic acid bacteria metabolites to control gene expression in vivo at the targeted location with the genome editing[7; 1]. The programmable autolysis and killing specific pathogens have been genetically engineered in bacterial reprogramming of E. coli[2], and could be adapted to LAB. Most important was that the court has recently ruled that new genome editing methods (including CRISPR-Cas) as ‘non-GMO,’ have recently been allowed in the USA Cas9-edited plants[7716]. LAB can be considered as microbial cell factories in the development of traditional industrial biotechnology with a green chemical production, which would be an iterative workflow “Design–Build–Test–Learn”.

The modifying native genes in the probiotic could be one approach to enhancing immunomodulation properties in the host. Although the overall mechanistic understanding of probiotic features in the immunoregulation is still mostly lacking, the key role in probiotic metabolite and outer cell surface interacted on the probiotic-host. The teichoic acids (TAs) stimulate TLRs on mammalian to promote the dendritic cells differentiation and subsequently lead to cytokine responses[2], and D-alanylation of TAs decreased the adhesion of L. reuteri to host cells[7].The deletion of the phosphoglycerol transferase gene was acted on the biosynthesis of lipoteichoic acid (LTA) in Lactobacillus acidophilus, and LTA-deficient strain relieved the colonic polyposis in a unique mouse model compared with the wild L. acidophilus[26].

In our study, we conclude pyrimidine biosynthesis modulates intracellular nucleotide pools to maintain metabolic homeostasis, thus quenching the host innate immunity during biotrophy.The nucleotidyltransferases (CD-NTases) in bacteria was capable of synthesizing cyclic pyrimidine in bacterial physiology and modulation of the host innate immune system[4]. Moreover, the V. cholerae encoded di-nucleotide cyclase affects (DncV) to synthesizes cyclic AMP-GMP molecule, which also play a benefit role for host adaptation and the intestinal colonization process[2]. This pyrimidine adducts are microbial small molecules, which are derived from metabolic pathways to activate mucosal-associated invariant T cell (MAIT) for immunosurveillance[7500]. Most importantly, Toxoplasma gondii KU80 has been used to delete the orotidine-5′-monophosphate decarboxylase (OMPDC) and uridine phosphorylase (UP) genes to obtain an avirulent nonreverting pyrimidine auxotroph strain, providing novel tool for the dissection of the host Th1 immune response to infection[9]. Our study also analyzed the functional capacity of the pyrimidine pathways by deleting the PyrR salvage activity in the Lactobacillus casei, which controls the direct access to host cell pyrimidine biosynthetic pathway, with or without a pyrimidine interacting with the host immune cell indicated that the pyrimidine stimulated the peritoneal macrophages polarization in the mice.

Overall, the examples we have provided illustrate how food-grade bacteria in general, and probiotic lactobacilli to be identified as novel variants, genetic engineering approaches to promote human health. As long as the application of CRISPR-based technologies continues to expand the genetic tool-boxes for LAB, we envision that LAB will provide great potential to modulate the microbiota and host immunity. In particular, the genome editing LAB will be much more effectively to eradicate target microbes in the new specific strain. Advancing this field must accompanied considerations of dimensions, the ongoing CRISPR intellectual property battles drive and enable technological advances in LAB, such as biological safety, policies and regulations, and consumer acceptance. Nonetheless, the ongoing microbiology renaissance remains strong, fueled by CRISPR technological advances and our increasing awareness of the LAB.

Taken together, our finding successfully constructed the auxotroph for the PyrR deficient L. casei. Evidence shows that PyrR gene is an active key for regulating pyrimidine biosynthesis with metabolic profiles of supernatant in L. casei, and the supernatant inhibited a wide range of pathogens to grow in the vitro. The complementary regulation for the PyrR deficient could no inhibit the growth of pathogens, and immune regulation in the macrophages from mice. Thus, the deletion of PyrR in L. casei lost the probiotic character of antimicrobial antagonism and immunoregulation.

Acknowledgments

The authors would like to thank Sheng Yang from Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China, for their invaluable assistance in obtaining plasmid.

Funding

This work was supported by the National Natural Science Foundation of China (Grant number:31902169), the Heilongjiang Province Science Fund for Excellent Young Scholars (Grant number:YQ2020C008)，"Young Talents" Project of Northeast Agricultural University（Grant number: 18QC39）and Student Innovation Practical Training of NEAU.

Author contributions

Professor Xinpeng Jiang and Di Liu contribute the conceptualization and supervision in the ideas, formulation or evolution of overarching research goals and aims, including mentorship external to the core team. Shaojun Chen and Zida Nai contribute the methodology and writing, such as the development and design of methodology. Jun Bao, Ziliang Qin, Xinmiao He and Wentao Wang contribute the formal analysis, such as mathematical, computational, and other formal techniques to analyze the study data. Gang Li and Jiqiao Xia contribute the investigation, such as the conducting a research and investigation process and specifically performing the experiments.

Data availability statement

The raw data supporting the conclusions of this article will be made available by the corresponding authors, without undue reservation.

Ethics declarations

Ethics approval and consent to participate

Ethical approval for the study was granted by Northeast Agricultural University Research Ethics Committee (NEAU20220109).

Consent for publication

All authors read and approved the final version of the manuscript.

Competing interests

The authors declare no competing financial interests or other competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Ewald W, Werbin H, Chaikoff IL.Evidence for the presence of 17-hydroxypregnenedione isomerase in beef adrenal cortex. Biochim Biophys Acta. 1965;111(1):306-12.
Isolauri E, Sutas Y, Kankaanpaa P, Arvilommi H, Salminen S.Probiotics: effects on immunity. Am J Clin Nutr. 2001;73(2 Suppl):444S-450S.
Brandao RL, Castro IM, Bambirra EA, Amaral SC, Fietto LG, Tropia MJ, Neves MJ, Dos Santos RG, Gomes NC, Nicoli JR.Intracellular signal triggered by cholera toxin in Saccharomyces boulardii and Saccharomyces cerevisiae. Appl Environ Microbiol. 1998;64(2):564-8.
Anjana, Tiwari SK.Bacteriocin-Producing Probiotic Lactic Acid Bacteria in Controlling Dysbiosis of the Gut Microbiota. Front Cell Infect Microbiol. 2022;12:851140.
Zhuang J, Ma S.Recent Development of Pyrimidine-Containing Antimicrobial Agents. ChemMedChem. 2020;15(20):1875-1886.
Kilstrup M, Hammer K, Ruhdal Jensen P, Martinussen J.Nucleotide metabolism and its control in lactic acid bacteria. FEMS Microbiol Rev. 2005;29(3):555-90.
Martinussen J, Schallert J, Andersen B, Hammer K.The pyrimidine operon pyrRPB-carA from Lactococcus lactis. J Bacteriol. 2001;183(9):2785-94.
Quinn CL, Stephenson BT, Switzer RL.Functional organization and nucleotide sequence of the Bacillus subtilis pyrimidine biosynthetic operon. J Biol Chem. 1991;266(14):9113-27.
Schleier L, Wiendl M, Heidbreder K, Binder MT, Atreya R, Rath T, Becker E, Schulz-Kuhnt A, Stahl A, Schulze LL, Ullrich K, Merz SF, Bornemann L, Gunzer M, Watson AJM, Neufert C, Atreya I, Neurath MF, Zundler S.Non-classical monocyte homing to the gut via alpha4beta7 integrin mediates macrophage-dependent intestinal wound healing. Gut. 2020;69(2):252-263.
Martinussen J, Hammer K.The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically. J Bacteriol. 1998;180(17):4380-6.
Andersen PS, Martinussen J, Hammer K.Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis. J Bacteriol. 1996;178(16):5005-12.
Andersen PS, Jansen PJ, Hammer K.Two different dihydroorotate dehydrogenases in Lactococcus lactis. J Bacteriol. 1994;176(13):3975-82.
Nicoloff H, Elagoz A, Arsene-Ploetze F, Kammerer B, Martinussen J, Bringel F.Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels. J Bacteriol. 2005;187(6):2093-104.
Liu Y, Su S, Yu M, Zhai D, Hou Y, Zhao H, Ma X, Jia M, Xue X, Li M.Pyrancoumarin derivative LP4C targeting of pyrimidine de novo synthesis pathway inhibits MRSA biofilm and virulence. Front Pharmacol. 2022;13:959736.
Suzuki H, Murakami A, Yoshida K.Counterselection system for Geobacillus kaustophilus HTA426 through disruption of pyrF and pyrR. Appl Environ Microbiol. 2012;78(20):7376-83.
Wang Y, Wang Z, Chen Y, Hua X, Yu Y, Ji Q.A Highly Efficient CRISPR-Cas9-Based Genome Engineering Platform in Acinetobacter baumannii to Understand the H2O2-Sensing Mechanism of OxyR. Cell Chem Biol. 2019;26(12):1732-1742 e5.
Mokoena MP.Lactic Acid Bacteria and Their Bacteriocins: Classification, Biosynthesis and Applications against Uropathogens: A Mini-Review. Molecules. 2017;22(8).
Fang Z, Li Y, Zheng Y, Li X, Lu YJ, Yan SC, Wong WL, Chan KF, Wong KY, Sun N.Antibacterial activity and mechanism of action of a thiophenyl substituted pyrimidine derivative. RSC Adv. 2019;9(19):10739-10744.
Walz JM, Avelar RL, Longtine KJ, Carter KL, Mermel LA, Heard SO, Group FUCS.Anti-infective external coating of central venous catheters: a randomized, noninferiority trial comparing 5-fluorouracil with chlorhexidine/silver sulfadiazine in preventing catheter colonization. Crit Care Med. 2010;38(11):2095-102.
Zander J, Besier S, Ackermann H, Wichelhaus TA.Synergistic antimicrobial activities of folic acid antagonists and nucleoside analogs. Antimicrob Agents Chemother. 2010;54(3):1226-31.
Zhou Y, Lin L, Wang H, Zhang Z, Zhou J, Jiao N.Development of a CRISPR/Cas9n-based tool for metabolic engineering of Pseudomonas putida for ferulic acid-to-polyhydroxyalkanoate bioconversion. Commun Biol. 2020;3(1):98.
Schaefer L, Auchtung TA, Hermans KE, Whitehead D, Borhan B, Britton RA.The antimicrobial compound reuterin (3-hydroxypropionaldehyde) induces oxidative stress via interaction with thiol groups. Microbiology (Reading). 2010;156(Pt 6):1589-1599.
Zhu Q, Xu C, Zhang S, Xie N, Pang X, Lu J.Advances in utilizing the endogenous CRISPR-Cas system for genome editing of lactic acid bacteria.2022;38(7):2447-2458.
Borner RA, Kandasamy V, Axelsen AM, Nielsen AT, Bosma EF.Genome editing of lactic acid bacteria: opportunities for food, feed, pharma and biotech. FEMS Microbiol Lett. 2019;366(1).
Hwang IY, Koh E, Wong A, March JC, Bentley WE, Lee YS, Chang MW.Engineered probiotic Escherichia coli can eliminate and prevent Pseudomonas aeruginosa gut infection in animal models. Nat Commun. 2017;8:15028.
Chan CT, Lee JW, Cameron DE, Bashor CJ, Collins JJ.'Deadman' and 'Passcode' microbial kill switches for bacterial containment. Nat Chem Biol. 2016;12(2):82-6.
Callaway E.CRISPR plants now subject to tough GM laws in European Union. Nature. 2018;560(7716):16.
Dessing MC, Schouten M, Draing C, Levi M, von Aulock S, van der Poll T.Role played by Toll-like receptors 2 and 4 in lipoteichoic acid-induced lung inflammation and coagulation. J Infect Dis. 2008;197(2):245-52.
Walter J, Loach DM, Alqumber M, Rockel C, Hermann C, Pfitzenmaier M, Tannock GW.D-alanyl ester depletion of teichoic acids in Lactobacillus reuteri 100-23 results in impaired colonization of the mouse gastrointestinal tract. Environ Microbiol. 2007;9(7):1750-60.
Khazaie K, Zadeh M, Khan MW, Bere P, Gounari F, Dennis K, Blatner NR, Owen JL, Klaenhammer TR, Mohamadzadeh M.Abating colon cancer polyposis by Lactobacillus acidophilus deficient in lipoteichoic acid. Proc Natl Acad Sci U S A. 2012;109(26):10462-7.
Severin GB, Waters CM.Pyrimidines and Cyclic Trinucleotides Join the Second Messenger Symphony. Cell Host Microbe. 2019;25(4):471-473.
Davies BW, Bogard RW, Young TS, Mekalanos JJ.Coordinated regulation of accessory genetic elements produces cyclic di-nucleotides for V. cholerae virulence. Cell. 2012;149(2):358-70.
Corbett AJ, Eckle SB, Birkinshaw RW, Liu L, Patel O, Mahony J, Chen Z, Reantragoon R, Meehan B, Cao H, Williamson NA, Strugnell RA, Van Sinderen D, Mak JY, Fairlie DP, Kjer-Nielsen L, Rossjohn J, McCluskey J.T-cell activation by transitory neo-antigens derived from distinct microbial pathways. Nature. 2014;509(7500):361-5.
Fox BA, Bzik DJ.Avirulent uracil auxotrophs based on disruption of orotidine-5'-monophosphate decarboxylase elicit protective immunity to Toxoplasma gondii. Infect Immun. 2010;78(9):3744-52.

Table 3 is available in the Supplementary Files section.

Supplementary Table S1 is not available with this version

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

A PyrR Regulating the Pyrimidine Biosynthesis Lost Antibacterial Ability Using CRISPR/Cas9-Mediated Knock-out for Metabolic Engineering at Lactobacillus casei

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Table 3

Supplementary Table S1

Additional Declarations

Supplementary Files

Status:

Version 1