Establishment of the CIA rat model
6-week-old male Wistar rats (approximately 180–200 g) were purchased from the Laboratory Animal Center of Nantong University. The Animal Ethics Committee has approved all animal experiments (including rat anesthesia and euthanasia procedures) of Nantong University. Animals were housed in a 12-h light-dark cycle under relative humidity and temperature conditions of 22 ± 3°C SPF, fed with a regular diet and water for two weeks, and then the CIA model was induced. Type II bovine collagen was dissolved in 0.1 N acetic acid solution at a concentration of 10 mg/mL, and then complete Freund’s adjuvant was emulsified with collagen solution. 200 µl collagen-adjuvant emulsion (1:1) was injected into the base of the rat's tail by intradermal injection. 100ul of immunopotentiator was injected at the same site in the same way one week later. The control rats were subcutaneously injected with the same amount of saline at the same time. Arthritis index (AI) was used to evaluate the severity of arthritis in each rat: 0 for no swelling, 1 for interphalangeal joint involvement, 2 for mild joint and toe swelling, 3 for toe and ankle swelling, and 4 for severe arthritis of the entire foot point. Scoring was performed based on the condition of four paws to obtain a total clinical score of 16 points per rat. Generally, the value of AI ≥ 4 represented the successful establishment of the RA rat model. Four weeks after the first immunization, rats were randomly divided into normal group (rats injected with saline, n = 5), CIA group (collagen-induced rats, n = 5), CIA + SMAD2 group ((intra-articular injection of Plv3-CMV-Smad2 (rat) -3×FLAG-CopGFP-Puro lentivirus RA rats, n = 5), Each group of rats were scored for arthritis, and paw thickness was determined using vernier calipers once a week. On the 49th day, the rats were sacrificed, serum was used for detection of inflammatory factors by Elisa kit and ankle joints were taken out for H&E staining and Safranin O staining respectively.
Isolation Of Flss
Fresh synovial tissues obtained from patients of knee arthroplasty of RA or severe joint trauma were washed three times with D-PBS(Beyotime) supplemented with 10% penicillin-streptomycin solution(Beyotime) (1200 r/min, centrifugation for 6 min), cut into 1 mm pieces with sterile scissors, and transferred to 1 mg/ml collagenase II (Gbico), gently pipetting to resuspend the tissue block, put it into a 37-degree constant temperature shaking incubator for 4 hours, and then add DMEM-F12 medium (Gbico) supplemented with 20% fetal bovine serum and 1% penicillin-streptomycin solution. Centrifuge (1500 r/min, 10 min), discard the supernatant, resuspend the cells with DMEM-F12 medium, and transfer them into a culture flask. FLS were confirmed by positive staining for Vimentin with a fibroblast-like synovial cell marker. Cells in passages 3–6 were used in this study.
Elisa Assays
The supernatants originated from FLS thawed at room temperature, and concentrations of IL-1β (EK101B-01, multi sciences, China), IL-18 (EK118-02, multi sciences, China), IL-6(EK106/2 − 01, multi sciences, China), IL-8 (EK108-03, multi sciences, China) were determined by ELISA kits according to the manufacturer’s protocol.
Ldh Release Assay
LDH release assay was measured using the CyQUANT LDH Kit (C20300, Invitrogen) according to the manufacturer's instructions. The absorbance value was measured at 490 nm and 630nm.
RT-PCR
According to the manufacturer's instructions, total RNA was prepared from synovial tissue or FLS using the RNA-Quick Purification Kit (Shanghai Yishan Bio). The obtained RNA was reverse transcribed into cDNA using SweScript cDNA Synthesis SuperMix (Servicebio). cDNA was diluted 1:5 before being used for real-time quantitative polymerase chain reaction (Q-PCR) analysis. The sequence of SMAD2 was (Forward ctcttctggctcagtctgttaa, Reverse aaggagtacttgttaccgtctg). Target genes were subjected to qRT-PCR analysis in 20 µL reactions containing SYBR Green (10 µL, Servicebio), primers (1 µL each of forwarding and reverse primers), cDNA template (2.0 µL), and ddH2O (6.0 µL). Target mRNA expression in each sample was normalized to GAPDH expression compared to control samples.
Safranin O-fast Green Staining And Hematoxylin-eosin (He) Staining
Safranin O-fast green staining was performed according to manufacturer's instructions (G1371 Solarbio). For HE staining, sections were deparaffinized, hydrated, and stained with hematoxylin for 10 min. After PBS washing, the sections were counterstained with eosin, dehydrated with ethanol, cleared with xylene, mounted with neutral gum, and observed under a microscope. At least three sections from the same site were observed in each group.
Western Blotting Analysis
Proteins were subjected to 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto PVDF membrane. The membranes were blocked with Ncm Blot Blocking Buffer for 15min at room temperature, followed by incubation with anti-SMAD2 (67343-1-Ig, proteintech), anti-Phospho-SMAD2 (#3108, Cell Signal Technology), anti-GSDMD (20770-1-AP proteintech), anti-ASC (67494-1-Ig, proteintech), anti-NLRP3 (#13158, Cell Signaling Technology) and GAPDH antibody (60004-1-Ig, proteintech) overnight at 4°C. The membranes were washed three times and incubated with secondary anti-rabbit IgG (SA00001-2, proteintech) or anti-mouse IgG (SA00001-1, proteintech) for 1 h. Protein bands were visualized on Western blotting detection system (Bio-Rad, USA).
Flow Cytometry
The APC Annexin V kit (#640930, Biolegend) was used to detect cell death according to the manufacturer's instructions. Cells were harvested and incubated with Annexin V and 7-AAD antibody in 1 × Annexin V binding buffer for 15 min at room temperature. After staining, 300 µl 1 × binding buffer was added, and the cells were immediately analyzed. Pyroptosis caspase-1 assay was performed according to manufacturer's instructions (#9158, Immunochemistry Technologies).
Statistical analysis
All graphs and statistical data were generated using GraphPad Prism 7.0 software. One-way analysis of variance (ANOVA) was used to compare differences among groups for data with a normal distribution and homogeneity of variance.