CircTPST2 inhibits cisplatin sensitivity in head and neck squamous cell carcinoma by sponging miR-770-5p and interacting with Nucleolin

doi:10.21203/rs.3.rs-2472879/v1

Download PDF

Research Article

CircTPST2 inhibits cisplatin sensitivity in head and neck squamous cell carcinoma by sponging miR-770-5p and interacting with Nucleolin

https://doi.org/10.21203/rs.3.rs-2472879/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Head and neck squamous cell cancer (HNSCC) is the most prevalent head and neck malignancy. Chemoresistance is a major challenge in the treatment of advanced HNSCC. Circular RNAs (circRNAs) are essential for the development of cancer and chemoresistance. The role and mechanism of circRNAs in the regulation of HNSCC chemoresistance are much less explored.

Methods: CircRNA microarray analysis was used to detect differentially expressed circRNAs in HNSCC. The expression of circTPST2 and miRNAs in HNSCC cells was assessed by qPCR, and the ring structure of circTPST2 was examined using Sanger sequencing, RNase R, and actinomycin D assays. MiR-770-5p and Nucleolin were found to be downstream target molecules of circTPST2 by Western blotting, biotin-labeled RNA pulldown, RNA immunoprecipitation, mass spectrometry, and rescue experiments. Then, the chemoresistance ability of circTPST2, miR-770-5p and Nucleolin was examined through functional tests such as CCK8 assays and flow cytometry assays. FISH assays were performed to determine the location of circTPST2, miR-770-5p, and Nucleolin. IHC staining assays were applied to detect the expression of circTPST2 and Nucleolin in HNSCC patients.

Results: The expression level of circTPST2 was negatively related to the cisplatin sensitivity of HNSCC cell lines. Notably, the expression of circTPST2 was negatively correlated with the overall survival rate of chemotherapeutic patients with HNSCC. Mechanistically, circTPST2 could reduce the cisplatin sensitivity of HNSCC cells through sponge-like adsorption of miR-770-5p, and it could also interact with and upregulate the downstream protein Nucleolin to regulate cisplatin sensitivity in HNSCC cells. Finally, according to the analysis of the TCGA database, the prognosis of patients with high miR-770-5p expression is better after chemotherapy. In contrast, according to the analysis of our HNSCC cohorts, the prognosis of patients with low Nucleolin protein expression is better after chemotherapy.

Conclusion: Our results identified the chemotherapy resistance-related circRNA circTPST2, indicating that circTPST2 may serve as a promising chemotherapy regimen selection marker in HNSCC.

Head and neck squamous cell cancer

circTPST2

cisplatin sensitivity

miR-770-5p

Nucleolin

Head and neck squamous cell cancer (HNSCC) is the most prevalent head and neck malignancy. Despite many efforts, the survival rate of HNSCC patients remains suboptimal, with a 40–50% 5-year survival rate [1]. The treatment modality for advanced HNSCC is surgical resection of the primary tumor followed by chemoradiotherapy. The combination of cisplatin and 5-fluorouracil (5-Fu), doxorubicin (Adriamycin, ADR), or cisplatin and docetaxel is the most commonly used chemotherapy regimen for HNSCC [2]. Reduced sensitivity to chemotherapeutic drugs is one of the important factors for treatment failure, ultimately leading to persistent tumor growth and metastatic spread in HNSCC [3]. Decreased sensitivity to chemotherapeutic drugs is the bottleneck problem faced by current tumor treatment. Current studies have shown that to escape the effects of various chemotherapeutic drugs, tumor cells have evolved a variety of functions, including promoting drug efflux; changing drug targets; enhancing DNA repair capacity, apoptotic escape, and autophagy; and promoting adaptive responses, thereby causing decreased sensitivity to chemotherapeutic drugs and resulting in treatment failure. The efficiency of chemotherapeutic drugs is mainly constrained by toxicity to healthy tissues and pharmacokinetic factors (including drug absorption, systemic distribution, elimination, and metabolism). Within tumor cells, the effects of drugs on tumor cells are called pharmacodynamic properties [4]. It has been reported that tumor pharmacodynamic resistance mechanisms include insufficient drug influx or excessive drug efflux, drug inactivation or lack of activation, changes in drug target expression levels, activation of adaptive survival responses [5], and dysregulation of apoptosis [6]. However, the exact mechanism of chemosensitivity reduction remains to be further elucidated. In-depth research on circRNAs in recent years has found that circRNAs are of vital importance in the regulation of chemosensitivity apart from tumor proliferation, metastasis, and radiosensitivity in various tumors.

CircRNAs are a class of noncoding RNAs lacking 5'-3' ends and with a poly(A) tail closed loop structure, which is more stable than linear RNAs [7, 8]. According to their genomic origin, circRNAs can be roughly divided into three types: exonic circRNAs, which are formed by exon skipping or head-to-tail connection; intronic circRNAs, which are composed of lariat introns; and exon‒intron circRNAs, consisting of exons and introns [9]. Exonic circRNAs can reflect the development of diseases and can be used as biomarkers for the diagnosis and prognostic assessment of various diseases [10]. The reported functions of circRNAs include affecting transcription, acting as a sponge for adsorbing miRNA, acting as a sponge for proteins, interacting with proteins, and translating into proteins [11]. Many existing studies have demonstrated that circRNAs are involved in the regulation of the chemosensitivity of tumor cells [12]. The circRNA-miRNA pathway and the circRNA-protein pathway are the main mechanisms by which circRNAs exert various functions, including chemosensitivity. For example, related studies on the circRNA-miRNA pathway have found that circRNA EIF6 acts as a sponge for adsorbing miR144-3p to promote cisplatin resistance in human thyroid cancer cells through autophagy [13]; circRNA Cdr1as upregulates cancer cell invasion inhibitors through miR-1270 (suppressor of cancer cell invasion, SCAI), thereby reducing the cisplatin resistance of ovarian cancer [14]. Studies on the circRNA-protein pathway have found that circRNA MTO1 inhibits the resistance of breast cancer cells to monaster by regulating the TRAF4/Eg5 axis [15]; CircPDSS1 conferred cisplatin resistance through the miR-515-5p/ITGA11 axis in gastric cancer [16]. Previously, we screened 32 differentially expressed circRNAs by conducting a circRNA microarray in HNSCC, and we validated CircRFWD3’s high expression and promotion of HNSCC metastasis by modulating miR-27a/b/PPARγ signaling [17]. However, there is no study on the regulation of circRNAs in HNSCC chemotherapy sensitivity.

In the current study, we discovered that hsa_circ_103188 (termed circTPST2), a distinctive circRNA from the TPST2 gene, is significantly upregulated in HNSCC. miR-770-5p and Nucleolin were found to be downstream target molecules. We also investigated the involvement of these components in chemoresistance to identify prospective markers for chemoresistance prediction and possible therapeutic targets for overcoming chemoresistance in HNSCC.

Patients and follow-up

Data on the cohort comprising 186 patients after chemotherapy for HNSCC were obtained from The Cancer Genome Atlas (TCGA) database (Additional file 1: Table S1). A total of 69 cases were obtained from chemotherapeutic patients with HNSCC at West China Hospital of Stomatology, Sichuan University, Peking University Stomatology, and Guangzhou Guanghua Dental Hospital. All patients or their family members were followed up for recurrence and prognosis. The starting point of follow-up was the date the patients received surgical treatment, and the recurrence, death, and survival time were recorded. Inclusion criteria: ① diagnosis of HNSCC confirmed by histopathological examination; ② chemotherapy after surgery; ③ no other organ tumors; ④ informed consent of patients. Exclusion criteria: ①the primary tumor had distant metastasis; ②with serious systemic infectious diseases; ③pregnant and lactating women. Informed consent was obtained from all patients and approved by the Ethics Committee of Sichuan University. The correlation between clinicopathological features and the expression of Nucleolin was analyzed (Additional file 2: Table S2). The study was approved by the ethics committees of the West China Hospital of Stomatology, Sichuan University and was conducted in agreement with the Helsinki Declaration. Written informed consent was provided by all participants at baseline and during follow-up.

Circrna Microarray Analysis

CircRNA microarray analyses were performed as previously described [17].

Cell Cultures

Human oral keratinocyte (HOK) cells and six human HNSCC cell lines (UM1, UM2, HSC-3, CAL27, HN12, and HN31) were supplied by the State Key Laboratory of Oral Diseases. HOK cells were cultured in defined keratinocyte SFM medium (10744019, Thermo Fisher Scientific). UM1, UM2, HSC-3, CAL27, HN12, and HN31 cells were appropriately cultured in DMEM (SH30243.01, HyClone) supplemented with 10% FBS and 1% penicillin-streptavidin solution. All cells were regularly tested for mycoplasma with a MycAwayTM Plus-Color One-Step Mycoplasma Detection Kit (40612ES25, Yeasen). Cells were kept in a humidified incubator at 37°C with 5% CO2.

Transfection Assay

Six-well plates were used to culture HSC-4, HSC-3, UM1, UM2, and HN31 cells, and transduction was carried out when cells were 70–80% confluent. Serum-free medium was used before transduction reagents were added to the corresponding plates. Cells were transfected using Lipofectamine™ RNAiMAX transfection reagent (13778030, Thermo Fisher) following the product’s manual, and cells were seeded after being cultured for 48–72 h. All small interfering RNA (siRNA) targeting circTPST2, Nucleolin, hnRNPM, miRNA mimics or inhibitors, and negative control (NC) were synthesized by RiboBio (Guangzhou, China) (Additional file 3: Table S3).

Stable Cell Line Generation

GV493-sh-circTPST2 and CV572-circTPST2 recombinant lentiviruses (sh-circTPST2, sh-NC, OE-circTPST2, and OE-NC), empty GV341 lentivirus and empty CV572 lentivirus (sh-NC and OE-NC) were purchased from NeuronBiotech (Shanghai Genechem Co., Ltd.). HSC-4 and HN31 cells were infected with sh-circTPST2 or sh-NC or infected with OE-circTPST2 or OE-NC. Selective culture medium containing 1 µg/ml puromycin was used to select the cells with stable expression of low circRFWD3 or vector controls. The expression of circTPST2 was detected by RT‒qPCR.

Flow Cytometry

The HN31 and HSC-4 cells, which were treated with cisplatin 48 h after trypsin digestion (note that the trypsin digestion time should not be too long to avoid false positive results), were subjected to flow cytometry after Annexin V-FIT (ab54775, Abcam) and propidium iodide (ab139418, Abcam) apoptosis double staining.

Rna Isolation And Qrt‒pcr

RNA isolation and qRT‒PCR were performed as previously described [17]. Primer sequences are listed in Additional file 4: Table S4.

Rnase R Digestion Treatment And Sanger Sequencing

RNase R digestion treatment was performed as previously described [17]. Sanger sequencing service was provided by CloudSeq Biotech Inc. (Shanghai, China). Primer sequences for Sanger sequencing were as follows: forward primer: TCACTCAAGCTCATCCTCGA-TCGAGGATGAGCTTGAGTG; reverse primer: CGACAGGTTAGCGGGCA-TGCCCGCTAACCTGTCG.

Cck8 Experiment

After 24 hours of cell culture after transfection, the cells were placed in 96-well plates (6x10⁴ cells per well) and incubated with cisplatin (Sigma, USA), 5-Fu (Sigma, USA), and ADR (Sigma, USA) at different concentrations (1, 2, 4, 8, 16, 32 mg/ml) for 48 hours. Then, 10 µl CCK8 was added to each well, a spectrophotometer was used to detect the absorbance at 450 nm, and the half maximal inhibitory concentration (IC50) of each chemotherapy drug was analyzed in different OSCC cell lines.

Fluorescence In Situ Hybridization (Fish) Assay

RNA fluorescence in situ hybridization (FISH) was performed using the Fluorescent in situ Hybridization Kit (lnc1CM001, RiboBio) according to the manufacturer’s instructions. Labeled probes targeting circTPST2 and U6 were synthesized by RiboBio (Guangzhou, China). Fluorescence was recorded with a confocal laser scanning microscope (FV3000, OLYMPUS).

Rna Pull-down Assay

RNA pull-down assays were performed according to the Pierce™ Magnetic RNA‒Protein Pull-Down Kit (20164, Thermo Scientific). Biotinylated circTPST2 probes were synthesized by RiboBio (Guangzhou, China). Pull-down RNA released from the beads after cleansing was evaluated by qRT‒PCR. Primer sequences of s biotinylated circTPST2 probes were: circTPST2 probe1: TCACATTTGGACAGGGAGAC; circTPST2 probe2: CCAGGCTCACATTTGGACAG.

Rapid Silver Staining Experiment For Mass Spectrometry

Mass spectrometry was performed using the rapid silver staining kit purchased from Sangon Biotech (Shanghai, China), and WB electrophoresis was carried out on the pulled down RNA protein. After electrophoresis, the polyacrylamide gel was subjected to a silver staining experiment and then subjected to mass spectrometry for detection.

Western Blot Analysis

For Western blot analysis, cells were washed three times with 1x PBS and then used for extraction of total proteins. Protein extracts were prepared by mammalian lysis buffer. Protein concentrations were measured by the Pierce™ BCA Protein Assay Kit (23250, Thermo Scientific). Protein extracts were separated by 10% SDS PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, IPVH00010). Then, the PVDF membranes were blotted individually with appropriate primary antibodies against GAPDH (2148 S, Cell Signaling Technology, dilution rate 1:3000), cleaved caspase-8 (9661 S, Cell Signaling Technology, dilution rate 1:1000) and caspase-3 (9662 S, Cell Signaling Technology, dilution rate 1:1000) histone H2A. X (9718 S, Cell Signaling Technology, dilution rate 1:1000), Tubulin (5335 S, Cell Signaling Technology, dilution rate 1:1000), Nucleolin (ab129200, Abcam, dilution rate 1:10000), hnRNPM (ab226407, Abcam, dilution rate 1:10000), KPYM (ab150377, Abcam, dilution rate 1:10000) and appropriate secondary antibodies (mouse, ZB-2305; rabbit, ZB2301, ZSGB-BIO, dilution rate 1:3000). Protein bands were visualized using a chemiluminescence system (Amersham Imager 600).

Immunohistochemistry

Immunohistochemistry (IHC) for Nucleolin (#14574, Cell Signaling Technology, dilution rate 1:400) was performed in specimens after antigen retrieval with citrate buffer (0.01 M, pH 6.0), and then it was visualized by diaminobenzidine (GK600510, DAKO 1:50 dilution). Two experienced pathologists without any knowledge of the clinical and pathological data valued the score of the intensity of staining (0, no staining; 1, weakly stained; 2, moderately stained; 3, strongly stained; 4, extremely stained) and the area of staining (1, 5%-25%; 2, 26%-50%; 3, 51%-75%; 4, > 75%). For the statistics of prognostic value in the HNSCC cohort, the total staining score was multiplied by the intensity of staining and the area of staining (1, 2, 3, 4, 6, 8, 9, 12, 16) and was divided into two categories: low expression (the total staining score was 1, 2, 3, 4, 6, 8, and 9) and high expression (the total staining score was 12 and 16).

Statistical analysis

Statistical analysis All statistical analyses were carried out using GraphPad Prism version 8.0. Means ± SDs are presented in quantification bar graphs. The data of each group are expressed as the mean ± SD (x ± s). Student’s t test was used for comparisons between groups. Correlations were analyzed by the Pearson correlation test. Survival analysis was performed by Kaplan–Meier curves and log-rank tests for significance. P values of < 0.05 were considered statistically significant. The data are presented as the mean ± SD of three independent experiments, *P < 0.05, **P < 0.01, ***P < 0.001.

CircTPST2 was identified as a novel highly expressed circRNA in HNSCC.

Our previous report screened 32 differentially expressed circRNAs by conducting a circRNA microarray on nine pairs of cancer and paracancerous tissue analysis in HNSCC [17] (Additional file 5: Table S5). Among them, circTPST2 was relatively high in HNSCC tissue compared with adjacent tissues (Fig. 1A), and we set circTPST2 as the target circRNA in this study. In vitro experiments showed that circTPST2 is highly expressed in HNSCC cells compared with HOK cells (Fig. 1B). CircTPST2 was found to be independently looped by exon 3 of the TPST2 gene by consulting the circBASE and CIRCpedia v2 databases, and sanger sequencing confirmed that the back-splicing junction site of circTPST2 is CCAAATGT-ACATTTGG (Fig. 1C). In addition, the RNase R digestion experiment demonstrated that circTPST2 has a circular structure (Fig. 1D). To further determine the localization of circTPST2 in cells, we performed a nucleoplasmic isolation experiment and a fluorescence in situ hybridization (FISH) experiment, and the results showed that circTPST2 was present in the nucleus and cytoplasmic samples and was mainly localized in the cytoplasm (Fig. 1E). The above experimental data proved that circTPST2 is a novel, mainly cytoplasm-localized, unique TPST2-derived circRNA that is remarkably upregulated in HNSCC.

The Expression Level Of Circtpst2 Is Negatively Correlated With The Cisplatin Sensitivity Of Hnscc Cells

We predicted the downstream target miRNAs of circTPST2 in the miRBase, miRanda, and TargetScan databases, including miR-593-5p, miR-770-5p, miR-370-3p, miR-637, and miR-383-3p. A literature review found that the downstream miRNAs of cirTPST2 are mostly associated with chemotherapy sensitivity [18, 19]. Thus, we focused on its function in regulating chemoresistance in HNSCC. First, we aimed to uncover the relationship between circTPST2 expression levels and the chemotherapy sensitivity of HNSCC cells. The CCK8 experiment demonstrated that the expression level of circTPST2 was positively related to the IC50 of cisplatin in four HNSCC cell lines, including UM1, HN31, CA27, and HSC-4 (r = 0.9129, P < 0.01, Fig. 2A-C). We designed three different siRNAs that could specifically target the back-splicing junction site of circTPST2, and si-circTPST-2 was chosen for follow-up experiments because of its efficient inhibition rate (Additional file 6: Fig S1A). Si-circTPST-2 was transfected into four HNSCC cell lines, and then the IC50 values of cisplatin, ADR, and 5-Fu in those four HNSCC cell lines were detected. As a result, after knocking down circTPST2, HNSCC cells became more sensitive to chemotherapy drugs (Additional file 6: Fig S1B). The sensitivity of HN31 and HSC-4 cells to chemotherapy drugs was significantly increased after silencing the expression of circTPST2, from 39%-44% and from 23–56%, respectively (Fig. 2D and E). These two HNSCC cell lines were selected for follow-up experiments. Then, we found that the expression levels of γH2AX and cleaved caspase3 were relatively upregulated in HNSCC cells after circTPST2 was silenced for 48 h by Western blotting (Fig. 2F). These results suggest that knocking down circTPST2 increases apoptosis and DNA damage. Moreover, Kaplan–Meier analysis revealed that chemotherapeutic HNSCC patients who expressed circTPST2 at a low level had a longer overall survival (OS) than patients who expressed it at a high level. in the TCGA database cohort (P = 0.019, Fig. 2G). These data distinctly showed that the expression level of circTPST2 is negatively correlated with the chemotherapy drug sensitivity of HNSCC cells.

Circtpst2 Functions As A Sponge For Mir-770-5p In Hnscc

To verify the precise downstream, chemotherapy sensitivity-related miRNAs of circTPST2, we knocked out circTPST2 in HNSCC cells, and then qPCR was carried out to detect the expression levels of five predicted downstream miRNAs (miR-770-5p, miR-383-3p, miR-593-5p, miR-370-3p, and miR-637) (Additional file 7: Fig S2A). As a result, elevated levels of miR-770-5p, miR-370-3p, and miR-637 in both cell lines were higher than in the control group. (Fig. 3A). We constructed a biotinylated probe that has the reverse complement of the circTPST2 back-splicing site to verify the mutual interaction between circTPST2 and certain downstream miRNAs; therefore, it can directly combine with circTPST2. RNA pulldown experiments proved that biotinylated circTPST2 probe 2 has good binding efficiency in both HNSCC cell lines (Fig. 3B). Using this probe, we further discovered that circTPST2 can bind to miR-770-5p and miR-370-3p in both HNSCC cell lines (Fig. 3C), and cell flow cytometry experiments found that after knocking down miR-770-5p in HNSCC cells, the number of advanced apoptotic cells was substantially lower. (Fig. 3D), while it did not show significant differences after knocking down miR-370-3p (Additional file 7: Fig S2B). Further immunofluorescence experiments showed that miR-770-5p and circTPST2 could colocalize in both HNSCC cell lines (Fig. 3E). Collectively, these experiments demonstrated that miR-770-5p is precisely downstream of circTPST2, which could serve as a sponge in HNSCC.

Circtpst2 Physically Interacts With The Nucleolin Protein In Hnscc

To verify the downstream of chemotherapy sensitivity-related proteins of circTPST2, we performed silver-stained polyacrylamide gels on the protein complexes in the RNA-pulldown products in two HNSCC cell lines and extracted the proteins in the differential band regions and sent them to mass spectrometry for identification. As a result, three differential bands between the probe-circTPST2 group and the circ-NC group were observed in the range of 70 < protein kDa < 100 (Fig. 4A). Mass spectrometry analysis showed that 713 and 1097 candidate proteins bound to circTPST2 were detected in HN31 and HSC-4 cells, respectively. We screened candidate interacting proteins using the following strategy: proteins of the appropriate size among the proteins and shared by the two HNSCC cell lines, and the combined Sequest program scored greater than 25. Then, we obtained 10 pending proteins of interest (Fig. 4B), namely, heat shock cognate 71 kDa protein (HSP7C), endoplasmic reticulum chaperone BiP (BIP), Nucleolin, heat shock protein HSP 90-beta (HS90B), heat shock 70 kDa protein 1B (HS71B), pyruvate kinase PKM (KPYM), heterogeneous nuclear ribonucleoprotein M (hnRNPm), heat shock protein HSP 90-alpha (HS90A), heterogeneous nuclear ribonucleoprotein U (HNRPU), and 60 kDa heat shock protein (CH60). Among them, three proteins were associated with tumor chemotherapy sensitivity: KPYM, hnRNPm, and Nucleolin. Subsequently, the RNA pulldown assay showed that circTPST2 could pull down hnRNPm and Nucleolin but not KPYM (Fig. 4C). This result suggests that circTPST2 can bind to hnRNPm and Nucleolin. Next, to detect the functionality of hnRNPm and Nucleolin in HNSCC, siRNA was used to silence hnRNPm or Nucleolin expression in HSC-4 cells (Additional file 8: Fig S3A). Then, we applied flow cytometry assays to reveal that late apoptotic cells increased significantly after inhibiting the expression of Nucleolin (Fig. 4D), while late apoptosis in HN31 and HSC-4 cells after inhibition of hnRNPm expression was not noticeably changed (Additional file 8: Fig S3B). FISH experiments showed that circTPST2 and Nucleolin colocalized in HNSCC cells, which further verified that they could interact with each other (Fig. 4E). We then constructed stable circTPST2-overexpressing and circTPST2-knockdown HN31 and HSC-4 cell lines (Additional file 9: Fig S4 A). Western blot assays showed that overexpressing circTPST2 increased the expression of Nucleolin, while Nucleolin was less expressed after the knockdown of circTPST2 (Fig. 4F). The data above demonstrated that circTPST2 physically interacts with the Nucleolin protein in HNSCC.

Circtpst2 Inhibits Cisplatin Sensitivity By Sponging Mir-770-5p And Interacting With Nucleolin

To test the function of circTPST2 in chemotherapy, we applied western blotting and found that the levels of γH2AX and cleaved caspase3 were relatively reduced in HNSCC cells after cisplatin treatment for 48 h, indicating that the expression level of circTPST2 was inversely correlated with apoptosis and DNA damage (Fig. 5A). Compared with the control groups, γH2AX and cleaved caspase 3 expression obviously increased in the si-Nucleolin group and miR770-5p mimic group (Fig. 5B). Additionally, Kaplan–Meier analysis showed that chemotherapeutic patients with HNSCC with high expression levels of miR-770-5p had a longer OS than those with low expression in the TCGA database cohort (P = 0.083, Fig. 5C). As the downstream mRNA of circTPST2, the expression of miR-770-5p is positively correlated with the prognosis of chemotherapeutic patients with HNSCC, confirming that circTPST2 is negatively correlated with the prognosis of chemotherapeutic patients with HNSCC. Then, we obtained a total of 69 cases of chemotherapeutic patients with HNSCC from three different hospitals and assessed the correlation of nucleolin expression with the prognosis of HNSCC patients by IHC (Fig. 5D). Further analysis showed that the protein level of nucleolin was inversely correlated with prognosis in chemotherapeutic patients with HNSCC (Fig. 5E). Taken together, these results suggest that circTPST2 regulates chemotherapy sensitivity by sponging miR-770-5p and interacting with the nucleolin dual pathway (Fig. 6).

CircRNA is a closed-loop structure molecule with covalent bonds that is more stable than linear RNA [20, 21]. It was found that circRNAs play important roles in tumor malignancy, including tumor proliferation, metastasis, chemosensitivity, and radiosensitivity [22]. The mechanism of circRNA involvement in tumor chemotherapy sensitivity has been a hot topic in recent years, suggesting the potential of circRNAs as new tools to improve tumor chemosensitivity [23–25]. However, the role and mechanisms of circRNAs in HNSCC chemosensitivity remain elusive. Here, we identified a novel unique TPST2-derived circTPST2 that is abnormally upregulated in HNSCC tissues and cells. The results of loss- and gain-of-function experiments indicated that circTPST2 inhibits cisplatin sensitivity in HNSCC. Mechanistically, we found that circTPST2 regulates cisplatin sensitivity by sponging miR-770-5p and interacting with the Nucleolin dual pathway in HNSCC.

CircTPST2 is significantly upregulated in HNSCC tissue analysis by a previous circRNA microarray [17]. In this study, we identified and proved that circTPST2, which is derived from the TPST2 gene, has a ring structure by qPCR, Sanger sequencing, RNase R, and actinomycin D assays. Subsequently, we found that circTPST2 was mainly located in the cytoplasm, similar to most of the circRNAs reported through immunofluorescence hybridization and nucleocytoplasmic separation experiments [26, 27]. Moreover, we found that the expression level of circRNA is negatively correlated with the chemotherapeutic sensitivity of cells, and weakening circTPST2 could enhance the chemosensitivity of HNSCC cells. Additionally, Kaplan–Meier analysis demonstrated that circTPST2 is a risk factor for patient OS, indicating that circTPST2 might function as a chemotherapy regimen selection marker for HNSCC.

Cisplatin-based therapy accounts for up to 50% of tumor chemotherapy, while most patients experience cancer recurrence due to cisplatin resistance [28–30]. Meanwhile, it has been found that circRNAs play an essential role in the mechanism of tumor chemosensitivity [31–39]. Microarray analysis identified more than 10,000 circRNAs that were dysregulated in cisplatin-resistant cell lines [40]. There is growing evidence indicating that circRNA can act as a microRNA sponge and reduce chemoresistance through the circRNA-miRNA‒protein signaling pathway [41, 42]. For example, circRNA EIF6 acts as a sponge for adsorbing miR-144-3p to promote cisplatin resistance in human thyroid cancer cells through autophagy [43]. Therefore, we speculated that downstream miRNAs or proteins may be related to chemotherapy sensitivity, and cisplatin was appropriate for us to study the effect of circTPST2 on the sensitivity of HNSCC to chemotherapy in this experiment. To study the relationship between the expression of circTPST2 and the chemosensitivity of HNSCC, the relationship between the expression of circTPST2 and the IC50 of cisplatin in different HNSCC cells was studied, and it was found that circTPST2 and cisplatin were correlated with the IC50 of HNSCC cells. To investigate whether the content of circTPST2 is widely applicable to other chemotherapeutic drugs (ADR and 5-Fu), we silenced the expression of circTPST2 in HNSCC cells by siRNA and found that the IC50 of chemotherapeutic drugs on five HNSCC cell lines showed a downward trend. This finding indicates that the effect of circTPST2 on the chemosensitivity of HNSCC cells may apply to a variety of chemotherapeutic drugs.

CircRNAs are well known to regulate the tumor process by sponging miRNAs. To reveal the downstream target of circTPST2, we performed an RNA pulldown experiment to find a direct interaction between circTPST2 and miRNAs. We found that inhibition of circTPST2 expression significantly increased intracellular miR-770-5p expression, while inhibition of miR-770-5p significantly attenuated the chemosensitivity of HNSCC cells. Recent studies have demonstrated the crucial role that miR-770-5p plays in cancer and chemoresistance. In ovarian cancer (OVC), miR-770-5p may function as an anti-oncogene and promote cisplatin sensitivity by downregulating ERCC2 in OVC [18]. Another study also indicated that the knockdown of NEAT1 inhibited cisplatin resistance by upregulating miR-770-5p [44]. Additionally, miR-770-5p regulates the resistance of human colorectal adenocarcinoma cells to methotrexate by downregulating HIPK1 [45].

CircRNAs have been shown to control tumor proliferation by interacting with RNA-binding proteins. To better understand the mechanism of circTPST2, we also predicted the possible downstream target proteins of the circTPST2 downstream proteins KPYM, Nucleolin, and hnRNPm by mass spectrometry analysis. The RNA pulldown assay showed that circTPST2 could pull down hnRNPm and Nucleolin but not KPYM. Flow cytometry revealed that inhibiting the expression of Nucleolin increased late apoptotic cells in number markedly instead of hnRNPm. Nucleolin is important in cancer proliferation survival, infiltration, and metastasis [46]. Nucleolin is positively regulated by HuR and negatively regulated via competition with miR-494, leading to an obvious reduction in cancer cell survival [47]. Nucleolin has also been reported to mediate cisplatin resistance by stimulating YB1-induced MDR1 transcription [48].

Combining the predictive results, we believe that both miR-770-5p and Nucleolin participate in the regulation of circTPST2-induced chemoresistance. Additionally, the outcomes of a rescue experiment demonstrated that treatment with miR-770-5p mimics or inhibitors could partially reverse the change in the chemoresistance abilities of HNSCC cells caused by circTPST2 overexpression and suppression. Noticeably, the application potential of circTPST2 or miR-770-5p as molecular markers of chemotherapy sensitivity in HNSCC patients was discovered using TCGA database analysis. Our study revealed that Nucleolin is negatively correlated with the cisplatin sensitivity of HNSCC cells, and inhibition of Nucleolin can strengthen the chemosensitivity of HNSCC cells.

In the current study, we identified a distinctive TPST2-derived circRNA that is significantly upregulated in HNSCC tissues and cells and is associated with reduced sensitivity to cisplatin chemotherapy. This suggests that circTPST2 and its downstream target could serve as a biomarker in chemotherapy and a potential treatment target in HNSCC. Collectively, we revealed that circTPST2 inhibits cisplatin sensitivity by sponging miR-770-5p and dually interacting with nucleolin.

HNSCC: Head and neck squamous cell cancer; circRNAs: Circular RNAs; miRNAs: MicroRNAs; 5-Fu: 5-fluorouracil; ADR: Adriamycin; TCGA: The Cancer Genome Atlas; HOK: Human oral keratinocyte cell; DMEM: Dulbecco's modified Eagle’s medium; FBS: Fetal bovine serum; OE: overexpressing; NC: negative control; qRT‒PCR: Quantitative real-time reverse transcription PCR; CCK-8: Cell Counting Kit-8; FISH: fluorescence in situ hybridization; PBS: phosphate buffered saline; IHC: Immunohistochemistry; SD: standard deviation; HSP7C: Heat shock cognate 71 kDa protein; BIP: Endoplasmic reticulum chaperone BiP; KPYM: Nucleolin, Pyruvate kinase PKM; hnRNPm: Heterogeneous nuclear ribonucleoprotein M; HS90A: Heat shock protein HSP 90-alpha; HS90B: Heat shock protein HSP 90-beta; HS71B: Heat shock 70 kDa protein 1B; HNRPU: Heterogeneous nuclear ribonucleoprotein U; CH60: 60 kDa heat shock protein; PVDF: polyvinylidene fluoride;

Acknowledgments

Not applicable

Authors’ Contributions

J. Li, X. Zeng, and X. Zhou designed the experiment. T. Wang, C. Xin, Y. Shi, S. Zhang, and J. Wang performed the experiment. Y. Ren, D. Yang, Y. Wang, N. Ji, H. Xu, Q. Chen and J. Li, Y. Hua, Y. Hu J. Wang, X. Tian and Y. Wang analyzed the data and drafted the manuscript. All authors read and approved the final version of the manuscript.

Funding

This work was supported by grants from the National Natural Science Foundation of China (81872211, 82072999, and 8273320 to J. Li, U19A2005 and 82270986 to X. Zeng, 81922042 to X. Zhou), CAMS Innovation Fund for Medical Sciences (2019-I2 M-5-004 to Q. Chen), the Province Natural Science Foundation of Sichuan (23NSFSC0145 to J. Li), the Innovation Research Project of Sichuan University (2022SCUH0029 to J. Li), and the 1·3·5 Project of Excellent Development of Discipline of West China Hospital of Sichuan University (No. ZYYC21001 to X. Zhou).

Availability of data and materials

The data and study materials that support the findings of this study will be available to other researchers from the corresponding authors on reasonable request.

Ethics approval and consent to participate

This work was approved by the Ethics Committee of Sichuan University, and informed consent was obtained from all patients.

Consent for publication

All authors consent to publication.

Competing interests

The authors declare no potential conflicts of interest.

Bach D-H, Lee SK, Sood AK. Circular RNAs in cancer. Mol Ther-Nucleic Acids. 2019;16:118–29.
Lacas B, Carmel A, Landais C, Wong SJ, Licitra L, Tobias JS, et al. Meta-analysis of chemotherapy in head and neck cancer (MACH-NC): An update on 107 randomized trials and 19,805 patients, on behalf of MACH-NC Group. Radiother Oncol. 2021;156:281–93.
Wang C, Liu XQ, Hou JS, Wang JN, Huang HZ. Molecular mechanisms of chemoresistance in oral cancer. Chin J Dent Res. 2016;19:25–33.
Holohan C, Van Schaeybroeck S, Longley DB, Johnston PG. Cancer drug resistance: an evolving paradigm. Nat Rev Cancer. 2013;13:714–26.
Chen L-L, Yang L. Regulation of circRNA biogenesis. RNA Biol. 2015;12:381–8.
Barrett SP, Salzman J. Circular RNAs: analysis, expression and potential functions. Development. 2016;143:1838–47.
Xu N, Chen S, Liu Y, Li W, Liu Z, Bian X, et al. Profiles and bioinformatics analysis of differentially expressed circrnas in taxol-resistant non-small cell lung cancer cells. Cell Physiol Biochem. 2018;48:2046–60.
Li Z, Cheng Y, Wu F, Wu L, Cao H, Wang Q, et al. The emerging landscape of circular RNAs in immunity: breakthroughs and challenges. Biomark Res. 2020;8:1–13.
Cui C, Yang J, Li X, Liu D, Fu L, Wang X. Functions and mechanisms of circular RNAs in cancer radiotherapy and chemotherapy resistance. Mol Cancer. 2020;19:58.
Zhou R, Chen KK, Zhang J, Xiao B, Huang Z, Ju C, et al. The decade of exosomal long RNA species: an emerging cancer antagonist. Mol Cancer. 2018;17:1–14.
Rawluk J, Waller CF, Gefitinib.Small Mol Oncol. 2018;235–46.
Ju C, He J, Wang C, Sheng J, Jia J, Du D, et al. Current advances and future perspectives on the functional roles and clinical implications of circular RNAs in esophageal squamous cell carcinoma: more influential than expected. Biomark Res. 2022;10:1–18.
Liu F, Zhang J, Qin L, Yang Z, Xiong J, Zhang Y, et al. Circular RNA EIF6 (Hsa_circ_0060060) sponges miR-144-3p to promote the cisplatin-resistance of human thyroid carcinoma cells by autophagy regulation. Aging. 2018;10:3806.
Zhao Z, Ji M, Wang Q, He N, Li Y, Circular. RNA Cdr1as upregulates SCAI to suppress cisplatin resistance in ovarian cancer via miR-1270 suppression. Mol Ther-Nucleic Acids. 2019;18:24–33.
Xiong D, Dang Y, Lin P, Wen D, He R, Luo D, et al. A circRNA–miRNA–mRNA network identification for exploring underlying pathogenesis and therapy strategy of hepatocellular carcinoma. J Transl Med. 2018;16:1–21.
Wang Y, Tang S, Li L, Sun C, Liu Y, Zhao Y. Depletion of circPDSS1 inhibits ITGA11 production to confer cisplatin sensitivity through miR-515-5p in gastric cancer.J Chemother. 2022;1–13.
Wei Z, Wang Y, Peng J, Li H, Gu J, Ji N, et al. CircRFWD3 promotes HNSCC metastasis by modulating miR-27a/b/PPARγ signaling. Cell Death Discov. 2022;8:1–14.
Zhao H, Yu X, Ding Y, Zhao J, Wang G, Wu X, et al. MiR-770-5p inhibits cisplatin chemoresistance in human ovarian cancer by targeting ERCC2. Oncotarget. 2016;7:53254–68.
Qu W, Huang W, Yang F, Ju H, Zhu G. Long noncoding RNA LINC00461 mediates cisplatin resistance of rectal cancer via miR-593-5p/CCND1 axis. Biomed Pharmacother. 2020;124:109740.
Zhang L, Peng H, Xu Z, Yang Q, Wang Y, Wang H, et al. Circular RNA SOX13 promotes malignant behavior and cisplatin resistance in non-small cell lung cancer through targeting microRNA-3194-3p/microtubule-associated protein RP/EB family member 1. Bioengineered. 2022;13:1814–27.
Yesharim L, Talebi S, Mojbafan M, Alemrajabi M, Teimourian S. An evaluation of gastric adenocarcinoma-associated CircRNAs based on microarray meta-analysis and ceRNA networks. Transl Oncol. 2023;28:101611.
Sang C, Rao D, Wu C, Xia Y, Si M, Tang Z. Role of circular RNAs in the diagnosis, regulation of drug resistance and prognosis of lung cancer. Oncol Lett. 2022;24:1–14.
Cui X, Zhang B, Li B, Li X. Circular RNA circ_0002360 regulates the Taxol resistance and malignant behaviors of Taxol-resistant non-small cell lung cancer cells by microRNA-585-3p-dependent modulation of G protein regulated inducer of neurite outgrowth 1. Bioengineered. 2022;13:9070–85.
Fang L, Lv J, Xuan Z, Li B, Li Z, He Z, et al. Circular CPM promotes chemoresistance of gastric cancer via activating PRKAA2-mediated autophagy. Clin Transl Med. 2022;12:e708.
Song W, Long Q, Tingting C, Li X, Yan J, Hao H et al. Advances in the study of circRNAs in tumor drug resistance.Front Oncol. 2022;1562.
Zhu K-P, Zhang C-L, Ma X-L, Hu J-P, Cai T, Zhang L. Analyzing the interactions of mRNAs and ncRNAs to predict competing endogenous RNA networks in osteosarcoma chemo-resistance. Mol Ther. 2019;27:518–30.
Wang X, Zhang J, Cao G, Hua J, Shan G, Lin W. Emerging roles of circular RNAs in gastric cancer metastasis and drug resistance. J Exp Clin Cancer Res. 2022;41:1–13.
Chang F, Li J, Sun Q, Wei S, Song Y. Hsa_circ_0017639 regulates cisplatin resistance and tumor growth via acting as a miR-1296-5p molecular sponge and modulating sine oculis homeobox 1 expression in non-small cell lung cancer. Bioengineered. 2022;13:8806–22.
Jiang Y, Guo H, Tong T, Xie F, Qin X, Wang X, et al. lncRNA lnc-POP1-1 upregulated by VN1R5 promotes cisplatin resistance in head and neck squamous cell carcinoma through interaction with MCM5. Mol Ther. 2022;30:448–67.
Huang L, Zhang J, Deng Y, Wang H, Zhao P, Zhao G et al. Niclosamide (NA) overcomes cisplatin resistance in human ovarian cancer.Genes Dis. 2023
Du L, Guo D, Sun C, Yan X, Lin S, Xu S. CircPIM3 regulates taxol resistance in non-small cell lung cancer via miR-338-3p/TNFAIP8 axis. Anticancer Drugs. 2023;34:115–25.
Wang F, Yu C, Chen L, Xu S. Landscape of circular RNAs in different types of lung cancer and an emerging role in therapeutic resistance. Int J Oncol. 2023;62:1–23.
Chen Z-W, Hu J-F, Wang Z-W, Liao C-Y, Kang F-P, Lin C-F, et al. Circular RNA circ-MTHFD1L induces HR repair to promote gemcitabine resistance via the miR-615-3p/RPN6 axis in pancreatic ductal adenocarcinoma. J Exp Clin Cancer Res. 2022;41:1–23.
Cui Y, Fan J, Shi W, Zhou Z. Circ_0001667 knockdown blocks cancer progression and attenuates adriamycin resistance by depleting NCOA3 via releasing miR-4458 in breast cancer. Drug Dev Res. 2022;83:75–87.
Hu C, Xia R, Zhang X, Li T, Ye Y, Li G, et al. circFARP1 enables cancer-associated fibroblasts to promote gemcitabine resistance in pancreatic cancer via the LIF/STAT3 axis. Mol Cancer. 2022;21:1–21.
Li P, Song R, Yin F, Liu M, Liu H, Ma S, et al. circMRPS35 promotes malignant progression and cisplatin resistance in hepatocellular carcinoma. Mol Ther. 2022;30:431–47.
Li H, Luo F, Jiang X, Zhang W, Xiang T, Pan Q et al. CircITGB6 promotes ovarian cancer cisplatin resistance by resetting tumor-associated macrophage polarization toward the M2 phenotype.J Immunother Cancer. 2022;10.
Ling Y, Liang G, Lin Q, Fang X, Luo Q, Cen Y, et al. circCDYL2 promotes trastuzumab resistance via sustaining HER2 downstream signaling in breast cancer. Mol Cancer. 2022;21:1–16.
Zhang L-X, Gao J, Long X, Zhang P-F, Yang X, Zhu S-Q, et al. The circular RNA circHMGB2 drives immunosuppression and anti-PD-1 resistance in lung adenocarcinomas and squamous cell carcinomas via the miR-181a-5p/CARM1 axis. Mol Cancer. 2022;21:1–20.
Song L, Cui Z, Guo X. Comprehensive analysis of circular RNA expression profiles in cisplatin-resistant non-small cell lung cancer cell lines. Acta Biochim Biophys Sin. 2020;52:944–53.
Xin C, Huang F, Wang J, Li J, Chen Q. Roles of circRNAs in cancer chemoresistance. Oncol Rep. 2021;46:1–11.
Wei D, Zeng J, Rong F, Xu Y, Wei R, Zou C. Circ_0020123 enhances the cisplatin resistance in non-small cell lung cancer cells partly by sponging miR-140-3p to regulate homeobox B5 (HOXB5). Bioengineered. 2022;13:5126–40.
Solassol I, Pinguet F, Quantin X. FDA-and EMA-approved tyrosine kinase inhibitors in advanced EGFR-mutated non-small cell lung cancer: safety, tolerability, plasma concentration monitoring, and management. 2019;9:668.
Zhu M, Yang L, Wang X. NEAT1 Knockdown Suppresses the Cisplatin Resistance in Ovarian Cancer by Regulating miR-770-5p/PARP1 Axis. Cancer Manag Res. 2020;12:7277–89.
Zhang D, Li Y, Sun P. miR–770–5p modulates resistance to methotrexate in human colorectal adenocarcinoma cells by downregulating HIPK.Exp Ther Med. 2020;8.
Chen Z, Xu X. Roles of nucleolin: Focus on cancer and anti-cancer therapy. Saudi Med J. 2016;37:1312–8.
Tominaga K, Srikantan S, Lee EK, Subaran SS, Martindale JL, Abdelmohsen K, et al. Competitive regulation of nucleolin expression by HuR and miR-494. Mol Cell Biol. 2011;31:4219–31.
Ke J, Gu C, Zhang H, Liu Y, Zhang W, Rao H et al. Nucleolin promotes cisplatin resistance in cervical cancer by the YB1-MDR1 pathway. J Oncol. 2021;2021.

No competing interests reported.

Additionalfile1.docx
Additional file 1: Table S1. The information of 186 patients after chemotherapy for HNSCC from TCGA.
Additionalfile2.docx
Additional file 2: Table S2. The correlation between clinicopathological features and expression of nucleolin.
Additionalfile3.docx
Additional file 3: Table S3. Sequence of small interfering RNA and miRNA.
Additionalfile4.docx
Additional file 4: Table S4. Primer information.
Additionalfile5.docx
Additional file 5: Table S5. Normalized intensity of 32 candidate circRNAs.
Additionalfile6Fig.S1..pdf
Additional file 6: Fig. S1. The drug sensitivity of HNSCC cells with silenced circTPST2. A qRT‒PCR assays showed the expression of circTPST2 after simultaneous transfection of si-circTPST2-1, si-circTPST2-2, si-circTPST2-3 and si-NC in HN31 and HSC-4 cells. B CCK8 assay was used to test the IC50 of cisplatin, ADR and 5-Fu in four HNSCC cell lines. (Values are expressed as the means ± SDsss; *P < 0.05, **P < 0.01 and ***P < 0.001)
Additionalfile7Fig.S2..pdf
Additional file 7: Fig. S2. Predictive miRNAs directly bound to circTPST2 and the functional test of miR-370-3p. A Schematic illustration showing binding site sequences between circTPST2 and five predicted downstream miRNAs (miR-770-5p, miR-383-3p, miR-593-5p, miR-370-3p, and miR-637). B Flow cytometry assay was applied to test the number of late apoptotic cell deaths after the inhibition of miR-370-3p. (Values are expressed as the means ± SDsss; *P < 0.05, **P < 0.01 and ***P < 0.001)
Additionalfile8Fig.S3..pdf
Additional file 8 Fig. S3. The expression of nucleolin and hnRNPm with silenced circTPST2 and the functional test of hnRNPm. A Western blot experiments showed hnRNPm or Nucleolin expression in HSC-4 cells after transfection of siRNA and si-NC. B Flow cytometry was used to testthe number of late apoptotic cells after the inhibition of hnRNPm expression in HN31 and HSC-4 cells.
Additionalfile9Fig.S4..pdf
Additional file 9 Fig. S4. qPCR was used to test the expression level of circTPST2 in constructed stable circTPST2 knockdown or circTPST2 overexpression cell lines. (Values are expressed as the means ± SDsss; *P < 0.05, **P < 0.01 and ***P < 0.001)

Download PDF

Version 1

posted

You are reading this latest preprint version

CircTPST2 inhibits cisplatin sensitivity in head and neck squamous cell carcinoma by sponging miR-770-5p and interacting with Nucleolin

Status:

Version 1

Abstract

Figures

Background

Methods

Patients and follow-up

Circrna Microarray Analysis

Cell Cultures

Transfection Assay

Stable Cell Line Generation

Flow Cytometry

Rna Isolation And Qrt‒pcr

Rnase R Digestion Treatment And Sanger Sequencing

Cck8 Experiment

Fluorescence In Situ Hybridization (Fish) Assay

Rna Pull-down Assay

Rapid Silver Staining Experiment For Mass Spectrometry

Western Blot Analysis

Immunohistochemistry

Statistical analysis

Results

The Expression Level Of Circtpst2 Is Negatively Correlated With The Cisplatin Sensitivity Of Hnscc Cells

Circtpst2 Functions As A Sponge For Mir-770-5p In Hnscc

Circtpst2 Physically Interacts With The Nucleolin Protein In Hnscc

Circtpst2 Inhibits Cisplatin Sensitivity By Sponging Mir-770-5p And Interacting With Nucleolin

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1