Evaluation of Anti-cancer Effect of Carotenoids Produced by A Halophilic Archaeon, Haloarcula Sp. Strain A15 Isolated from Saline Environment of Iran on Breast Cancer Cells

doi:10.21203/rs.3.rs-2475233/v1

Download PDF

Research Article

Evaluation of Anti-cancer Effect of Carotenoids Produced by A Halophilic Archaeon, Haloarcula Sp. Strain A15 Isolated from Saline Environment of Iran on Breast Cancer Cells

https://doi.org/10.21203/rs.3.rs-2475233/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The halophilic microorganisms living in Extreme environments contain high concentrations of carotenoids with notable medical abilities. We evaluated the anti-cancer activity of carotenoids extracted from native Iranian halophilic microorganisms with the ability to inhibit breast cancer cell line. To begin the study, 40 halophilic strains were cultured and eight strains capable of producing pigmented colonies were chosen from among those cultured strains. In the next step, from among eight strains using MTT assay, one of them capable of reducing cell viability of the breast cancer MCF-7 cell line was chosen as a selective strain. The principal carotenoid was characterized based on the UV-Visible, FT-IR spectroscopic and LC-MASS analyses. Using Real time PCR technique, the expression of genes specific for apoptosis, in the presence or absence of carotenoid was examined. Among all strains, carotenoid extracted from strain A15 showed the strongest cytotoxic effect on breast cancer cell line (IC50 = 0.0625 mg/mL). 16S rRNA analysis indicated that strain A15 showed similarity with Haloarcula hispanica for about 99.5%. According to the results of the analysis, we can estimate that the principal carotenoid extracted form Haloarcula sp. strain A15 was similar to bacterioruberin. Both late and early apoptosis were increased significantly about 10% and 39%, respectively as a result of up-regulation of CASP3, CASP8, BAX genes expression in MCF-7 cell line. In contrast, the expression of genes MKI67, SOX2 were significantly down-regulated in treated MCF-7 cell line. Halophilic archaeon strain could be a good option to produce high added-value bacterioruberin due to its possible anti-cancer properties.

Carotenoids

Halophilic archaea

Bacterioruberin

Breast cancer

MCF-7 cell line

Apoptosis

Halophilic archaea include microorganisms living in hypersaline environments with high salt concentration. (Menasria 2018; Giri 2021). Carotenoids are indeed a wide range of natural biomolecules produced by plants, algae, yeast, fungi and some bacteria and archaea (Ram 2020; Dulinska-Litewka 2021). The most specific character of carotenoids is the existence of long polyene chain with alternative conjugated double bonds, so that the increasing of the bonds resulting in enhancement of color intensity (Mishra 2021; Raju 2021). Halophilic archaea can produce C50 bacterioruberin (BR) which contains 13 pairs of conjugated carbon double bonds and four hydroxyl groups (Calegari-Santos 2016). Generally, as chemo preventive agents, carotenoids can inhibit the development of cancer by a number of mechanisms including blocking the division of premalignant cells with DNA damage, impeding DNA damage, regulation of cell growth, anti-oxidant activity, stimulation of cell-to-cell gap junction communication, increased cell differentiation, antiproliferative activity, cell-cycle arrest and apoptosis (Basirnejad 2017). Therefore, nowadays attention and concentration on halophilic microorganisms is due to producing natural bioactive compounds with anti-cancer properties that are more effective than chemical drugs and have less toxic effect or side effects of cancer therapy. As we know, cancer is a significant reason for mortality globally, leading to a vast economic burden on people (Neelam 2019). Worldwide, more than 2 million women are diagnosed with breast cancer each year. Some people with breast cancer can be treated in early stages. Patients in the upper stages who do not have metastases are definitively treated with adjuvant therapy in 5–30% of cases. However, a large number of patients die due to the return of breast cancer, so the use of newer methods and drugs in these patients is very necessary (McTiernan 2021). We evaluated the anti-cancer effect of carotenoids extracted from native Iranian halophilic microorganisms with the ability to inhibit breast cancer cell lines.

Microorganisms and culture conditions

As total 40 strains of halophilic archaea and bacteria in saline environments already been isolated from different parts of Iran, were cultured in Modified Growth Medium (MGM) with 23% w/v total salt. After incubation, plates were observed and 8 strains capable of producing pigmented colonies were chosen from among 40 cultured halophilic strains. MGM broth medium includes NaCl (18.39 gr/lit), MgSO₄ (2.68 gr/lit), MgCl₂ (2.29 gr/lit), KCl (0.536 gr/lit), yeast extract (0.2 gr/lit) peptone from meat (0.5 gr/lit) (Amoozegar 2012).

Carotenoids of the strains were extracted. Cytotoxic effect of the extracted Carotenoid was determined by MTT test. So that one strain capable of reducing cell viability of the breast cancer MCF-7 cell line was selected as a superior strain for continues of further experiments in this study.

DNA Extraction and 16S rRNA Amplification

Extraction of the genomic DNA was done by Cinnagen DNA kit as instructed. The 16S rRNA gene amplification was done in 30 µl volumes including 15 µl of Master mix, 1 µl each of the primer, 1 µl of template DNA. The primers used were archaeal-specific primer 21F (5′-TTCCGGTTGATCCTGCCGGA-3′) (DeLong 1992) combined with the universal reverse primer 1492R (5′-GGTTACCTTGTTACGACTT-3′) (Weisburg 1991). DNA sequencing was done using Macrogen Inc. (Korea) by universal primers.

Phylogenetic analysis of 16S rRNA

Determination of the assembled DNA sequence data was done by BLAST and compared with the 16S RNA gene sequences of the National Centre for Biotechnology Information database (NCBI) DNA sequences achieved from isolated strain were aligned by ClustalW in Bioedit software. The aligning results are used to form a phylogeny tree by Mega 7 software (Thompson 1994) (Kumar 2016) (Altschul 1990) (Vila 2019).

Effect of salinity, pH, temperature, carbon and nitrogen source to produce hyper carotenoid

In order to achieve high growth rate and more carotenoid production, the effect of various factors was determined by incubating inoculated culture at various NaCl concentration, temperature, pH, carbon source, nitrogen source. Afterwards, growth rate was measured by spectrophotometer with three replications based on the OD 600 every 24 hrs (Zhao 2019).

Extraction of carotenoids

After 7 days, 100 ml of MGM broth cultures was subjected to centrifugation at 8000 rpm for 15minutes. The pellet obtained was suspended with 5 ml of methanol, followed by incubation in a water bath for 15 minutes at 60 °C until the visible pigments were extracted and centrifugation was done at 4000 rpm for 15 minutes. The colored supernatant was isolated and filtered through Whatman qualitative filter paper No.1. So the total carotenoid level was determined by the value achieved at the maximum absorption wavelength (Cojoc 2019).

Thin Layer Chromatography

The pigment was located on a TLC silica gel 60 F254 plate, (Merck) and developed in ethyl acetate: chloroform (8:2, v/v). At the end, the Rf value of spots on the TLC plate were calculated (Rezaeeyan 2017).

Liquid chromatography–mass spectrometry (LC-MS)

In this study, LC-MS was used for determining the molecular weight of the carotenoid pigment (Flores 2020). We recorded the mass spectra in the positive ion mode in the mass range between 200 and 2000 m/z. Ions were observed in the scan mode.

Fourier Transform Infrared Spectroscopy (FTIR)

Fourier Transform Infrared Spectroscopy (PUYCOM spectrometer model 1100) SP was used to investigate the chemical structure of the isolated fraction. For this purpose, the intended fraction when separated, was irradiated with infrared radiation ranging 4000-600 cm^-1 with a resolution of 4 cm^-1 and then was separated from the related sample spectrum by scanning.

Human cell culture

The used human cancer cell lines were MCF-7 for breast cancer. The cells were grown RPMI 1640 (Roswell Park Memorial Institute) (Gibco Cat.12800-082) including 10% fetal bovine serum (FBS) (Gibco Cat.12800-082), sodium bicarbonate and 2 mM of L-glutamine, 100 U/ mL penicillin-streptomycin at 37 °C in a humidified environment of 95% air and 5% CO2 (Hou and Cui 2018).

MTT assay

The MTT colorimetric test was applied for the determination of the cytotoxicity of the carotenoid extracts (CE) on human normal and cancer cell line (MCF-7) and the findings were expressed as viable cell percentages relative to the control cell. Three replicates related to each plate were subjected to incubation with various sub-lethal concentrations of carotenoid (1, 0.5, 0.25, 0.125, 0.0625, 0.0312 mg/mL). After 48 hrs of treatment, to evaluate the cytotoxic activity of carotenoid extract, 10 μL of MTT solution (Sigma) was transferred to each well and incubated for 4 hrs at 37 °C. Then, the medium was isolated and 100 μL of the DMSO (Merck) was added and absorbance was read using ELISA plate reader at 560 nm. Finally, the percentage of viable cell (IC50 value) was calculated using mean OD_{560 (Treated group)}/ mean OD_{560 (Control group)} × 100.

IC50 (inhibitory concentration at median level) value was regarded as the carotenoid extract concentration at which there was 50 % growth inhibition of the cells (Neelam 2019).

In vitro assessment of apoptotic activity by flow cytometry

In the first stage, to examine the apoptosis test by Annexin V-FITC/PI Staining Kit (Sigma), the human cancer cell line MCF-7 was treated with pigment extract IC50 dose. Forty-eight hours after treatment, cells were harvested through trypsinization, added 2 ml of cold PBS for washing and centrifuged for 5 minutes (1500 rpm). The cell precipitate was suspended in 1X Binding buffer. Then, incubation of the cells was done with Annexin V-FITC (5μl) and PI (3μl) for 15 minutes at 4 ° C in darkness. After incubation, 1 ml of 1X Binding Buffer solution was added to the cells, followed by centrifugation at 1500 rpm for 5 minutes and resuspended in 1X Binding Buffer. Samples were also read by BD FACS Calibur (BD biocsencies, San Jose, CA, USA) (Hegazy 2020).

Cell cycle test

At first, 5000 cells were subjected to centrifugation at 1500 rpm for 5 minutes at 4 ° C. Then 50 μl of cold PBS was added to the cells which were vortexed. In the next stage, 500 μl of 70% cold ethanol was added dropwise to the sample. The cells were centrifuged and after discarding ethanol, they were washed once with PBS. Thereafter, PBS was removed from the cell pellet and 1ml PI MASTER MIX solution containing PI 1 mg/mL:40 μL, RNase (DNase FREE) 10 mg/mL:10 μL and PBS:950 μL, was added to the cells. Finally, the cells are incubated for 30 minutes at room temperature and read by flow cytometry BD FACS Calibur (BD biocsencies, San Jose, CA, USA) (Gong 2018).

RNA Isolation and RT-PCR analysis

MCF-7 breast cancer cells were treated with the carotenoid extract IC50 dose for 48 hrs. After harvesting the cells, the total RNA was separated from treated and control cell lines after 48 hrs by TRIzol Reagent (Invitrogen). cDNA was synthesized by the Revert Aid H Minus First Strand cDNA Synthesis Kit (Fermentas, Waltham, USA). SYBR Premix Ex Taq II (USA) was applied to carry out quantitative real-time reverse transcription-PCR (RT-PCR) by Rotor-Gene 6000 (Corbett). The sequence of target primers was listed in Table 1. The HPRT and GAPDH genes were applied as a normalizer. The REST software was used to determine the expression fold changes (Safarpour 2019).

Table 1. Primers used in Quantitative real-time RT-PCR analysis

Reverse primer	Forward primer	Gene
5' AGGGTCTCTCTCTTCCTCTTG 3'	5' GTGGTCTCCTCTGACTTCAAC 3'	GAPDH
5' CAAGTTTCTGAATGTTTCCCTGAG 3'	5' AAGCGAATCAATGGACTCTGG 3'	CASP3
5' GTCTCCCGCGATTCCTCTG 3'	5' AGAGCCTTAGCAATAGCAACG 3'	MKI67
5' CGAGATTGTCATTACCCCACA 3'	5' CAGCAGCCTTGAAGGAAGTC 3'	CASP8
5' TGGGCATCCTTTAACTCTA 3'	5' GTATTTCACCCTCAAGATCC 3'	P53
5' CTTGGAGTGATAGAAATCTGTCA 3'	5' CTTGCACTCTGGTGTCTG 3'	P21
5' GCAGCGTGTACTTATCCTTCTT 3'	5' GCCGAGTGGAAACTTTTGTCG 3'	SOX2
5′ TCACCCAACCACCCTGGTCTT 3'	5' TGGCAGCTGACATGTTTTCTGAC 3'	BAX

Statistical analysis

Values were expressed as the mean±standard error of the mean, and statistical significance of data was estimated by t-test in GraphPad Prism8.

Identification of Haloarchaeal Strain

In the first place, 40 halophilic strains were cultured and eight strains potency of producing pigmented colonies were chosen from among those cultured strains. Cytotoxic effect of the extracted Carotenoid was determined by MTT test. So that one strain from among those eight strains capable of reducing cell viability of the breast cancer MCF-7 cell line was selected as an eligible strain for continues of further experiments in this study. The selective strain (A15) was Gram-stain-negative, non-spore-forming and polymorph form rod to cocci. Region of 16S rRNA strain A15 was amplified successfully that was resulted in 1100 bp as bond size. A homology assay based on the 16S rRNA gene sequence of strain A15 showed that the strain belonged to the genus Haloarcula and matched with the identity of Haloarcula hispanica for about 99.5%.

By bootstrap 1000 resampling value, a close relationship can be seen with the family Haloarculaceae (Figure 1b). The GenBank accession for the 16S rRNA gene sequence was LC085245.1. Twenty nucleotide sequences were evaluated and conducted in MEGA7.

Effects of different factors on growth rate and biomass and carotenoids production

NaCl concentration

NaCl concentration ranging from 10, 15, 23 and 25% (w/v) were assessed for the biomass and carotenoid generation in Haloarcula sp. A15. The highest growth rate was observed at 23% salt concentration for a period of 168 hrs with 1.77 A_600nm mL^-1 broth. The optimal NaCl for carotenoid and biomass generation (Weight =238.09 μg/L) was at a concentration of NaCl 23% (w/v) (Figure 2).

The Incubation Temperature

The influence of temperature (30, 37, 40 and 45° C) on biomass growth and carotenoid generation in Haloarcula sp. A15 was estimated and the optimum temperature for carotenoid and biomass generation with 262.95 μg/L, was observed at 40 °C. Also, the highest growth rate was obtained at 40 °C for a period of 144 hrs with 1.802 A_600nm mL^-1 broth (Figure 2).

Carotenoid and Growth production in strain A15 within the pH ranges 5,6,7,8 was surveyed, so that the optimum pH value for intense pigment production (Weight = 479.88 μg/L) was at pH 7. Also the highest growth rate was observed at pH 7 for a period of 168 hrs with 1.69 A_600nm mL^-1broth (Figure 2).

Carbon Sources

The influence of several carbon sources (lactose, sucrose, fructose, glucose) on carotenoids production and biomass was surveyed under culture conditions with concentration of NaCl 23% (w/v) and pH 7 at 40 °C. As shown in Fig 2, the highest growth rate i.e., for a period of 144 hrs with 1.725 A_{600 nm}mL^-1 broth was obtained when sucrose was used, but A significantly high yield of carotenoids production resulted in weight 734.1 μg/L when fructose was used as the carbon source (Figure 2).

Nitrogen Sources

We examined the effect of several different nitrogen sources (i.e., yeast extract, ammonium sulfate, ammonium nitrate, meat extract) on biomass and carotenoid production with culture media containing 5% (w/v) fructose, NaCl 23% (w/v), pH 7.0, at 40 °C. The concentration of the nitrogen source was 2g l^-1 for all of the cultures. Yeast extract was the most appropriate nitrogen source for carotenoids production resulted in weight 258.09 μg/L, and the highest growth rate i.e., for a period of 144 hrs with 1.87 A_{600 nm}mL^-1 broth was observed using yeast extract (Figure 2) (Vazquez-Madrigal 2021).

Determination of Total Carotenoids

We measured the total carotenoid content in the methanol extract using the absorbance at λ max (490 nm), based on the below formula:

The total carotenoid content (μg.g) = A × V (mL) × 10⁴/ A^1%_1cm× P(g).where: A = absorbance; V = total extract volume; and P = sample weight; A^1%_1cm = 2660 (Extinction coefficient of Bacterioruberin) (de la Vega 2016). The total carotenoid content of Haloarcula sp. strain A15 was found to be 734.1 μg/L in an optimized medium.

Characterization of Haloarcula sp. A15 Carotenoid

After developing of TLC test, three red spots were observed on the TLC silica gel plate for strain A15. The lowest spot showed the most intense red color and it was considered as the main pigment of strain A15. In order to perform more analysis and more characterization, the silica sorbent of high intensity spot on the TLC plate was scraped off, and dissolved in a little methanol. Absorption spectrum related to the pigment scraped from TLC plate was recorded at 350-600 nm by a UV-Vis spectrophotometer, to determine the maximum peak.

Pigment detection using a uv-vis spectroscope revealed maximum absorption at wavelengths of 490 nm with 2 shoulders on the left and right sides, indicating a carotenoid spectrum. According to Britton et al., bacterioruberin and its derivatives show the characteristic spectral peaks of red carotenoids 370 and 385 nm for two cis peaks and at 467, 493 and 527 nm for three fingered peaks (Britton 1995). Based on Figure 3a, the purified carotenoid extracted from the isolated strain A15 showed absorption peaks at 490, 475 and 520 nm and minor peak at 390 nm, and probably, indicated that bacterioruberin is as the major pigment in the extracted specimen (Figure 3a).

The FTIR spectrum of the extracted carotenoid shown in the figure 3b, is similar to the bacterioruberin spectrum compared to other sources, and the bands of polyene are visible. The peak descriptions can be described as follows: the broad peak at 3363 cm^-¹ (which is between 2900 to 3500 cm^-1) indicates hydrogen bonded O-H. The peak at 1641 cm^-1 is related to C=C alkene stretching, showing the existence of some aliphatic compounds in the carotenoid extract. In addition, a band at 1083 cm^-1 is for C-C skeletal vibrations. The peaks at 749 cm^-1 and 1420 cm^-1 are respectively assigned to C-H and O-H stretch.

Figure 3c, exhibits that the molecular weight (MW) of carotenoid is 763.5 m/z as the fragment with higher relative abundance. Because of recording mass spectra in the positive ion mode, sodium ion (MW of Na⁺ =23) was adducted to the molecular weight of the extract carotenoid, so the molecular weight obtained by Mass spectrometry was reduced from MW of Na+ =23. Therefore, in the present study, the MW of carotenoids is 740.5, which is equivalent to the MW of bacterioruberin. Accordingly, the predominant carotenoid extracted form Haloarcula strain A15 is probably similar to bacterioruberin.

Carotenoid extracts effect on cell viability

There was a significant decrease in cell viability in the MCF-7 cells treated with increased concentrations of the CE after 48 hrs of treatment with the concentration of 0.0625 mg/mL, with no adverse effect on mesenchymal cell line (Figure 4). There was a 50% decrease in cell viability in MCF-7, 48 hrs post-treatment. The IC50 value of extract was detected at 0.0625 mg/mL (p <0.0001). Therefore, among all isolated strains, Haloarcula sp. strain A15 strongly decreased cell viability of breast cancer MCF-7 cell line. Therefore, this strain was considered for the more experiments in the current study.

The effect of carotenoid extract of strain A15 on induce apoptosis and cell cycle in the breast cancer cells

As shown in Figure 5a, the percentage of both late and early apoptosis was increased significantly (about 10% and 39%, respectively) in MCF-7 post-treatment with carotenoid extract of strain A15. In other words, as the Figures illustrates, the flow cytometric analysis of the annexin V/PI- stained early and late apoptotic cell population in CE-treated cancer cells, was totally 54.9%. Results indicate that carotenoid of Haloarcula sp. strain A15 exhibited an anti-cancer effect, causing about 50% death in breast cancer cell line (MCF-7) (Figures 5a-5d).

Furthermore, cell cycle analysis for treated and untreated cells showed that treatment with extracted carotenoid from the strain A15 decreased the percentage of cells in S phase of the cell cycle in MCF-7 cells from 20.76% to 10.66% (p <0.0001) and in G2 phase from 10.49% to 2.35% (p <0.0001). As a result, cell cycle was arrested in S and G2 phases (Figures 5e-5g).

Quantitative real-time RT-PCR analysis for apoptotic genes

The cells were treated at 0.0625 mg/ml Haloarcula sp. strain A15CE in each T25 flask. Expression ofCASP3, BAX and CASP8, was up-regulated significantly in MCF-7 cell line at a concentration of 0.0625 mg/mL for 48 hrs as compared to HPRT control gene. (p <0.05, p < 0.01) (Figure 6). However, the increasing level of expression ofP53, P21 geneswere notsignificant.

In contrast, the SOX2 and MKI67 relative expression was evaluated using quantitative real-time PCR and was down-regulated significantly in treated MCF-7 cell line (p< 0.05) (Figure 6). The GAPDH, HPRT genes were used for normalizing of aforementioned data.

We extracted carotenoid (CE) from strain of halophilic archaea collected from hypersaline lake in Iran. Glucose metabolism is variable in halophiles; it is degraded via different variants of the ED pathway within them (Vazquez-Madrigal 2021). The effect of glucose on growth and pigmentation in strain A15 was evaluated so that 690 µg/L of carotenoids were produced, but a significantly higher yield of carotenoids production (734.1 µg/L) was observed when fructose was considered as the carbon source. Our results suggest that the effect of glucose on pigment production depends on the species. Vázquez-Madrigal et al. (2021) also demonstrated that when glucose was added, pigment production was improved in Haloarcula sp. M1, but it was decreased in Halolamina sp. M3. Results are similar with those of Ferdes et al. (2011). They observed that, for the tested Rhodotorula strain, the highest pigments yield has been obtained in the case of adding fructose to medium, followed by the concentrations accumulated when glucose and sucrose were used (Ferdes 2011). Furthermore, in the present study, the most suitable nitrogen source for carotenoids production, was yeast extract with 258.09 µg/L, which is consistent with the studies of Zhao et al. (2019) (Zhao 2019).

The spectra of Haloarcula sp. strain A15 pigment is characterized by peaks at 490, 475, 520, 390 nm. According to Quillaci et al. (2017), the absorption peaks of red carotenoids from Haloterrigena turkmenica were 460, 490, and 520 nm, which were consistent with the absorption peaks of the C50 carotenoid bacterioruberin (Squillaci 2017). In the study of Biswas et al. (2017), Maximum absorption was observed at 469, 492 and 525 nm (Biswas 2016). So in the present study, the spectrum of Haloarcula sp. strain A15 carotenoid was similar to absorption peak of bacterioruberin. The spectrum of FTIR carotenoid pigment was also similar to the spectrum of bacterioruberin in comparison with the other sources, and specific absorption bands of polyenes i.e., peak at 1641 cm^− 1(C = C stretching), 1083 cm^− 1 (C-C stretching) could be seen. In their studies by Alvares et al. (2021) and Asgarani et al. (2014), it was observed respectively that the bacteriorubein includes peak at 3317 cm^− 1, 2912 cm^− 1, 1625 cm^− 1, 1421 cm^− 1, 1041 cm^− 1, and 3447 cm^− 1, 2929 cm^− 1,1090 cm^− 1, 809 cm^− 1 (Asgarani 2014; Alvares and Furtado 2021). The MW of 740.5 Daltons for this carotenoid was obtained. According to Flores et al. (2020), the molecular ion of 741.6 m/z had also been found as the fragment characterized by higher relative abundance (Flores 2020). Therefore, on the bases of results which obtained, the main carotenoid of this archaeon was probably similar to the bacterioruberin.

Different concentrations of pigment extract including 1, 0.5, 0.25, 0.125, 0.0625, 0.0312 mg/ml was evaluated on MDA-MB-468 cell viability at 24, 48, 72 hours. The results showed that a concentration of 0.0625 mg/ml pigment reduced significantly the viability of breast cancer cells by 50% during 48 hours. According to Rezaeeyan et al. (2017), reported that carotenoids extracted from Kocuria sp.QWT-12 has the ability to reduce the bioavailability of MCF-7 human breast cancer cell lines at 1 mg/ml by up to 50% (Rezaeeyan 2017). In the study of Hou et al. (2018), the carotenoid extracts from Hgm. limi and Hpn.vescus indicated marked anti-proliferative activities against HepG2 cells (Hou and Cui 2018). Furthermore, according to Kumar Neelam et al. (2019), Cell proliferation assay findings indicated that C12A1 broth extract (BEP) reduced cell viability in breast cancer MDA-MB-231 cells evidenced by the MTT assay (Neelam 2019).

Caspases cause reinforcement of the apoptotic signaling pathway by proteolytic activity and finally, cell death (Hounsell and Fan 2021; Yadav 2021). Caspase-3 leads to DNA fragmentation, reorganization of cytoskeletal, disintegration of the cell into apoptotic bodies and eventually, expression of ligands of phosphatidylserine for phagocytes on the apoptotic bodies’ surface. Annexin V, is a recombinant phosphatidylserine-binding protein that is applicable to detect apoptosis (Hegazy 2020). Annexin V-stained apoptotic cell populations were 54.9% of the carotenoid-treated human breast cancer MCF-7 cell line. Besides obtaining the percentage of early and late apoptosis, it was found that the expression level of CASP3, CASP8, BAX genes were increased significantly and accordingly, the expression level of MKI67, SOX2 genes were down-regulated significantly in treated MCF-7 cell line. Thus, the increase in apoptosis in MCF-7 cells was possibly correlated to up and down-regulation expression level of aforementioned genes. In the study of Moshtaghi et al. (2016), Real time PCR results indicated that the expression of CASP3 gene under concentrations of 200 and 400 µg/ml of Nigella Sativa extract significantly increased (Moshtaghi 2016). The results of the Hegazy et al. (2020), study indicated that the pigment produced by haloalkaliphilic sp. M6 resulted in apoptosis induction via caspases on Caco-2 cancer cell lines, which was consistent with our study (Hegazy 2020).

The results in the present study, highly suggest that carotenoid extract of strain A15, belonging to genus Haloarcula can be served as possible therapeutic agents against breast cancer as a due to an inducing apoptosis and cytotoxic effect. So halophilic archaea strains are new natural sources to detect novel bioactive substances such as carotenoids. It seems that from among the various mechanisms, induction of programmed cell death, antiproliferative activity and cell-cycle arrest are the most important mechanisms affecting the anti-cancer activity of carotenoid extract which is also confirmed by the findings of this study.

Funding

Not applicable.

Conflicts of interest

All authors have no conflict of interest to declare

Ethics approval

Not applicable

Consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and material

All data supporting the conclusions of this article are included within the article

Code availability

Not applicable

Acknowledgments

We express our deep and sincere appreciation to Masoud Shahbazi, for English editing of the manuscript- department of Foreign Languages, Kharazmi University, Tehran, Iran.

Author contributions

Saghar Shahbazi, Mohammad Reza Zolfaghari: Methodology, Software, Formal analysis, Data Curation, Writing- original draft. Mohsen Zargar and Mohammad Ali Amoozegar: Conceptualization, Writing- original draft, Writing- review and editing, Investigation, Project administration, Resources, Validation, Supervision, Funding acquisition.

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J. Mol. Biol 215:403-410 doi: 10.1016/s0022-2836(05)80360-2
Alvares JJ, Furtado IJ (2021) Characterization of multicomponent antioxidants from Haloferax alexandrinus GUSF-1 (KF796625). 3 Biotech 11:58 doi: 10.1007/s13205-020-02584-9
Amoozegar MA, Makhdoumi-Kakhki A, Shahzadeh Fazeli SA, Azarbaijani R, Ventosa A (2012) Halopenitus persicus gen. nov., sp. nov., an archaeon from an inland salt lake. Int J Syst Evol Microbiol 62:1932-1936 doi: 10.1099/ijs.0.036921-0
Asgarani E, Safari N, Zare D (2014) PArtial purification and characterization of carotenoid pigment from haloarcula sp. iru-i, an extremely halophilic archaeon isolated from uromia salt lake.
Basirnejad M, Milani A, Bolhassani A (2017) Carotenoids and cancer: biological functions. Acta sci. pharm. sci 1:11-20
Biswas J, Haque F, Paul A (2016) Carotenogenesis in Haloferax sp. Strain BKW301, a Halophilic Archaeon from Indian Solar Saltarns. J. adv. microbiol 1:1-11 doi: 10.9734/jamb/2016/31559
Britton G, Liaaen-Jensen S, Pfander H (1995) Carotenoids: Spectroscopy. Vol. 1B. Birkhäuser Verlag
Calegari-Santos R, Diogo RA, Fontana JD, Bonfim TM (2016) Carotenoid Production by Halophilic Archaea Under Different Culture Conditions. Curr Microbiol 72:641-651 doi: 10.1007/s00284-015-0974-8
Cojoc LR et al. (2019) Carotenoids produced by halophilic bacterial strains on mural paintings and laboratory conditions. FEMS Microbiol Lett 366 doi: 10.1093/femsle/fnz243
de la Vega M, Sayago A, Ariza J, Barneto AG, Leon R (2016) Characterization of a bacterioruberin-producing Haloarchaea isolated from the marshlands of the Odiel river in the southwest of Spain. Biotechnol Prog 32:592-600 doi: 10.1002/btpr.2248
DeLong EF (1992) Archaea in coastal marine environments. Proc Natl Acad Sci U S A 89:5685-5689 doi: 10.1073/pnas.89.12.5685
Dulinska-Litewka J et al. (2021) Recent Progress in Discovering the Role of Carotenoids and Their Metabolites in Prostatic Physiology and Pathology with a Focus on Prostate Cancer-A Review-Part I: Molecular Mechanisms of Carotenoid Action. Antioxidants (Basel) 10 doi: 10.3390/antiox10040585
Ferdes M, Ungureanu C, Mihalcea A, Chirvase AA, Mocanu E (2011) The influence of the carbon source on torularhodin pigment biosynthesis. Rev. Chim 62:339-343
Flores N et al. (2020) Haloterrigena sp. Strain SGH1, a Bacterioruberin-Rich, Perchlorate-Tolerant Halophilic Archaeon Isolated From Halite Microbial Communities, Atacama Desert, Chile. Front Microbiol 11:324 doi: 10.3389/fmicb.2020.00324
Giri P, Mittal L, Ignacio G, Camarillo I, Sundararajan R (2021) Analysis of pathways in triple-negative breast cancer cells treated with the combination of electrochemotherapy and cisplatin. Bioint. Res. App. Chem 11:13453-13464
Gong X, Smith JR, Swanson HM, Rubin LP (2018) Carotenoid lutein selectively inhibits breast cancer cell growth and potentiates the effect of chemotherapeutic agents through ROS-mediated mechanisms. Molecules 23:905
Hegazy GE et al. (2020) In vitro dual (anticancer and antiviral) activity of the carotenoids produced by haloalkaliphilic archaeon Natrialba sp. M6. Sci Rep 10:5986 doi: 10.1038/s41598-020-62663-y
Hou J, Cui HL (2018) In Vitro Antioxidant, Antihemolytic, and Anticancer Activity of the Carotenoids from Halophilic Archaea. Curr Microbiol 75:266-271 doi: 10.1007/s00284-017-1374-z
Hounsell C, Fan Y (2021) The Duality of Caspases in Cancer, as Told through the Fly. Int J Mol Sci 22 doi: 10.3390/ijms22168927
Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33:1870-1874 doi: 10.1093/molbev/msw054
McTiernan A (2021) Dietary prevention of breast cancer in high-risk women: role of carotenoids. In. Oxford University Press, pp 499-500
Menasria T et al. (2018) Diversity and bioprospecting of extremely halophilic archaea isolated from Algerian arid and semi-arid wetland ecosystems for halophilic-active hydrolytic enzymes. Microbiol Res 207:289-298 doi: 10.1016/j.micres.2017.12.011
Mishra N, Gupta E, Singh P, Prasad R (2021) Application of microalgae metabolites in food and pharmaceutical industry. In: Preparation of Phytopharmaceuticals for the Management of Disorders. Elsevier, pp 391-408
Moshtaghi F, Esmaeilzadeh Bahabadi S, Mazaheri M, Najafi S, Dahmardeh Ghalenoo F (2016) Increasing of Caspase3 Gene Expression in Mcf7 Breast Cancer Cell Line by Nigella Sativa Hydro Alcoholic Extract. SSU_Journals 24:1-11
Neelam DK et al. (2019) A Piscibacillus sp. Isolated from A Soda Lake Exhibits Anticancer Activity Against Breast Cancer MDA-MB-231 Cells. Microorganisms 7 doi: 10.3390/microorganisms7020034
Raju M, Sowmya PR-R, Ambedkar R, Arathi BP, Lakshminarayana R (2021) Carotenoid metabolic pathways and their functional role in health and diseases. In: Global Perspectives on Astaxanthin. Elsevier, pp 671-691
Ram S, Mitra M, Shah F, Tirkey SR, Mishra S (2020) Bacteria as an alternate biofactory for carotenoid production: A review of its applications, opportunities and challenges. Journal of Functional Foods 67 doi: 10.1016/j.jff.2020.103867
Rezaeeyan Z, Safarpour A, Amoozegar MA, Babavalian H, Tebyanian H, Shakeri F (2017) High carotenoid production by a halotolerant bacterium, Kocuria sp. strain QWT-12 and anticancer activity of its carotenoid. EXCLI J 16:840-851 doi: 10.17179/excli2017-218
Safarpour A, Ebrahimi M, Shahzadeh Fazeli SA, Amoozegar MA (2019) Supernatant Metabolites from Halophilic Archaea to Reduce Tumorigenesis in Prostate Cancer In-vitro and In-vivo. Iran J Pharm Res : IJPR 18:241-253
Squillaci G, Parrella R, Carbone V, Minasi P, La Cara F, Morana A (2017) Carotenoids from the extreme halophilic archaeon Haloterrigena turkmenica: identification and antioxidant activity. Extremophiles 21:933-945 doi: 10.1007/s00792-017-0954-y
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673-4680 doi: 10.1093/nar/22.22.4673
Vazquez-Madrigal AS et al. (2021) Effect of Carbon Sources in Carotenoid Production from Haloarcula sp. M1, Halolamina sp. M3 and Halorubrum sp. M5, Halophilic Archaea Isolated from Sonora Saltern, Mexico. Microorganisms 9 doi: 10.3390/microorganisms9051096
Vila E, Hornero-Mendez D, Azziz G, Lareo C, Saravia V (2019) Carotenoids from heterotrophic bacteria isolated from Fildes Peninsula, King George Island, Antarctica. Biotechnol Rep (Amst) 21:e00306 doi: 10.1016/j.btre.2019.e00306
Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697-703 doi: 10.1128/jb.173.2.697-703.1991
Yadav P, Yadav R, Jain S, Vaidya A (2021) Caspase‐3: A primary target for natural and synthetic compounds for cancer therapy. Chem Biol Drug Des 98 doi: 10.1111/cbdd.13860
Zhao Y, Guo L, Xia Y, Zhuang X, Chu W (2019) Isolation, Identification of Carotenoid-Producing Rhodotorula sp. from Marine Environment and Optimization for Carotenoid Production. Mar Drugs 17 doi: 10.3390/md17030161

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Evaluation of Anti-cancer Effect of Carotenoids Produced by A Halophilic Archaeon, Haloarcula Sp. Strain A15 Isolated from Saline Environment of Iran on Breast Cancer Cells

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1