Combination therapy with platelet-rich plasma and epidermal neural crest stem cells increases treatment efficacy in vascular dementia

doi:10.21203/rs.3.rs-2475245/v1

Download PDF

Article

Combination therapy with platelet-rich plasma and epidermal neural crest stem cells increases treatment efficacy in vascular dementia

https://doi.org/10.21203/rs.3.rs-2475245/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

This study aimed to evaluate effects of platelet-rich plasma (PRP) and neural crest-derived epidermal stem cells (ESC) in alone administration and their combination in vascular dementia (VaD) model by tow-vessels occlusion (2VO).

Methods

the rats were divided into control, sham, 2VO + vehicle, 2VO + PRP, 2VO + ESC, and 2VO + ESC + PRP groups. The treated-groups received one million cells on days 4, 14, and 21 with or without 500µl PRP (twice a week). The behavioral performance was evaluated by open-field, passive-avoidance, and Morris-water maze. The basal-synaptic transmission (BST) and long-term potentiation (LTP) were assessed by field-potential recording. The mRNA expression levels of IGF-1, TGF-β1, PSD-95, and GSk-3β were measured in rat hippocampus by qRT-PCR.

Results

The results showed a learning, memory, and synaptic plasticity impairment with a significant decrease in IGF1, TGF-β1, PSD-95, and increase in expression of GSk-3β 2VO rats. Although treatment with ESC alone and ESC + PRP show comparable improvement effects on spatial memory and LTP induction associated with PSD-95 up-regulation and GSK-3β down-regulation, the BST only recovered in the ESC + PRP group. Moreover, combination therapy was superior to monotherapy with PRP.

Conclusions

The transplantation of ESC showed better effects than PRP alone, and combination therapy increased treatment efficacy with the recovery of BST.

Biological sciences/Neuroscience/Neural ageing

Biological sciences/Neuroscience/Stem cells in the nervous system

vascular dementia

LTP

memory

platelet-rich plasma

epidermal stem cells

Following aging and in chronic cerebral hypoperfusion without obvious symptoms, progressive cerebral microvascular damage increases the risk of vascular dementia (VaD) over months to years ¹. Usually, in people with VaD, cognitive deficits are seen to various degrees ². In this patient, working memory loss, intellectual deficit, severe anxiety, and hallucination impair daily activity and social relationships ³. Unfortunately, the incidence rate of dementia continues to increase exponentially while there is still no effective treatment for it. Cell therapy has shown promising results in enhancing functional recovery in irreversible neurological disorders ⁴. It seems that cell therapy as a potential therapeutic approach may exert beneficial effects against senile dementia. Recently, hair follicle stem cells with abundant neural stem cells have been introduced as a reliable source of cell therapy, especially in neurodegenerative disorders ^5–8. In-vitro studies have reported that epidermal neural crest stem cells (EPI-NCSC) of hair follicles could differentiate into neural cells, oligodendrocytes, astrocytes, and Schwann cells ^9,10. Our previous study found that the intravenous infusion of 1×10⁶ EPI-NCSC performed better than the 2.5×10⁶ cells in the tow-vessels occlusion (2VO) rats ¹¹. Additionally, in-vivo studies have shown the migration potential of EPI-NCSC to the injury side, enhanced functional recovery in different animal models of neurodegenerative diseases such as ischemic stroke ⁵, Alzheimer's diseases ¹², peripheral nerve injury ¹³, and spinal cord injury ¹⁴.

Platelet-rich plasma (PRP) with releasing various types of neuroprotective growth factors has shown neuroprotective potential in experimental studies ^15,16. In particular, PRP with cell adhesion molecules and chemotactic properties can increase the migration potential of stem cells to the site of injury ¹⁷. Stem cell and PRP therapy were used as effective treatment methods for orthopedic injuries ¹⁸ and experimental spinal cord injuries ¹⁹.

However, the combined use of PRP and neural crest-derived epidermal stem cells (ESC) has not yet been evaluated in VaD models. Therefore, in the present study, we aimed to investigate the combined use of 1×10⁶ ESC and PRP on learning–memory impairment following the 2VO model.

2.1. Behavioral tests

2.1.1. Open field test

In the 2VO + V group, the time spent in the peripheral significantly increased compared to the sham groups (879.8 ± 4.9 s, vs. 786.3 ± 13.6 s; P < 0.01) while the time spent in the center decreased (20.19 ± 4.9 s, vs. 201.1 ± 88.4 s; P < 0.01) (Fig. 3A–B). However, cell transplantation alone in the 2VO + ESC group improved both the time spent in the peripheral (795.5 ± 16.6 s) and central (104.5 ± 16 s) regions relative to the 2VO + V group (both; P < 0.01). In the same way, combination therapy also recovered the time spent in the peripheral (796.4 ± 20.4 s) and central (103.6 ± 20.4 s) regions, which were significant relative to the 2VO + V group (both; P < 0.01). Furthermore, PRP treatment in the 2VO + PRP group failed to improve the time spent in the peripheral and central relative to 2VO + V group (Fig. 3A–B).

In the 2VO + V group, the grooming number increased relative to the sham group (13.4 ± 1.2 vs. 7.4 ± 0.8; P < 0.001) while both combination and single therapy improved the grooming number at the same level. The treatment with PRP, cell transplantation alone, and combination therapy significantly [(F (5, 52) = 18.05; P < 0.0001] decreased the grooming number to (6.8 ± 0.4, 5.2 ± 0.5 and 4 ± 0.6) respectively compared to 2VO + V group (all; P < 0.001). (Fig. 3C).

2.1.2. Passive avoidance test

We measured the time spent in the light chamber before each animal's entrance to the dark as STL time. The fear memory impairment is shown by STL depression. As shown in Fig. 4A, the STL time in the 2VO + V group was depressed compared to the sham (98.5 ± 29.4 vs. 256.7 ± 29.7; P < 0.01). We found that PRP injection significantly increased the STL in the 2VO + PRP group (240.3 ± 34.6 s) compared to the 2VO + V group (P < 0.01). In addition, the STL time increased in the 2VO + ESC and 2VO + ESC + PRP groups compared to the 2VO + V group (273.2 ± 16.9 s) and (292.7 ± 5.2) respectively (P < 0.001) [F (5, 52) = 7.845, P = 0.0001]. There was no significant difference in shock numbers between all studied groups (Fig. 4B).

2.1.3. Morris water maze test

In this test, the time spent finding the hidden platform, known as the escape latency time, was measured during 12 trials in 3 blocks. As shown in Fig. 5A. In the 2VO + V rats, escape latency was significantly higher compared to the sham group in the first (49.6 ± 4.6 vs. 24 ± 3.9; P < 0.01), second (45.1 ± 4.6s vs 12.1 ± 2.2; P < 0.001) and third blocks (44.7 ± 5.3s vs 11. 2 ± 2.2; P < 0.001). The PRP infusion in 2VO + PRP led to a significant decline in the escape latency time in the second (24.5 ± 2.9 s and third block (17.5 ± 2.6s) compared to the 2VO + V group (P < 0.05 and P < 0.01). We found a significant decline in the escape latency time during the three blocks in the 2VO + ESC and 2VO + ESC + PRP groups compared to the 2VO + V group (block 1; P < 0.01, blocks 2 and 3; P < 0.05).

Twenty-four hours after the last learning trial, we evaluated spatial memory retention. After removing the platform, the percentage of swimming time spent in the target quadrant for each rat was calculated as an index for memory retention (Fig. 5B). Decrease in this index is correlated with memory impairment. This percentage significantly decreased in 2VO + V group compared to the sham group (17.8 ± 1.3% vs 28.4 ± 1.9%; P < 0.01). We found better memory retention in 2VO + ESC (25.9 ± 2.3%) and 2VO + ESC + PRP (30. 1 ± 1.3%) groups relative to the 2VO + V group (P < 0.05 and P < 0.001) [F (5, 52) = 7.21, P < 0.0001]. Additionally, in the 2VO + PRP group (20.5 ± 0.95%), injection of PRP alone did not improve memory retention relative to 2VO + V. However, the combined use of PRP and ESC shows a significant increase in time spent in the target quadrant relative to PRP group (30. 1 ± 1.3% vs. 20.5 ± 0.95%; P < 0.01). There was no significant difference in the swimming speed between all groups (Fig. 5C).

2.2. Field potential recording at Schaffer collateral-CA1 synapse in 2VO rats.

2.2.1. Basal synaptic transmission

As shown in Fig. 6A, a functional decline of BST in the 2VO + V group compared to the sham group by a downward and right shift in the I/O curve. One-Way ANOVA analysis showed a significant reduction in the half-maximal fEPSP amplitude in the 2VO + V group to the sham group (398.7 ± 50.2 vs. 749.4 ± 38.5; P < 0.05). Although the cell therapy alone failed to recover the half-maximal fEPSP amplitude, PRP improved this parameter to some extent. In addition, the combination therapy of PRP and cells show better effects and significantly increased the half-maximum response compared to 2VO + V group (765.8 ± 137; P < 0.01) [F (5, 40) = 4.663, P = 0.0019] (Fig. 6B).

2.2.2. Short-term synaptic plasticity

As shown in (Fig. 7A-C), for evaluation of the short-term plasticity, we calculated the ratio of fEPSP amplitude of the second response to the first response as the paired-pulse ratio (PPR) in the inter-stimulus intervals (ISI) 25–250 ms. Facilitation in synaptic transmission is shown by a PPR value greater than one. There was no significant difference between all groups in PPR (Fig. 7A-C).

2.2.3. Long-term synaptic plasticity (LTP)

We evaluated the hippocampal LTP in all groups for 60 minutes after HFS. In different groups, we assessed the sample traces of responses (Fig. 8A) and the mean of the fEPSP magnitude (Fig. 8B). In the 2VO + V group, the magnitude of LTP was lower compared to the sham group (111.1 ± 5.9% vs. 268.1 ± 26.1%; P < 0.001) (Fig. 8A–C). Although, the PRP treatment in the 2VO + PRP group still showed a significant decrease relative to sham P < 0.01, we found the significant LTP induction in 2VO + ESC (190.3 ± 19.9%; P < 0.05) and 2VO + ESC + PRP (214.2 ± 17.3%; P < 0.01) relative to the 2VO + V group [F (5, 40) = 8.588; P < 0.0001] as much as the sham group (Fig. 8C).

2.3. mRNA expression levels of IGF1, TGF-β1, PSD-95, and GSk-3β in rat hippocampus

The hippocampal mRNA expression level of IGF-1, PSD-95, and TGF-β1 was significantly decreased in 2VO + V compared with the sham group (P < 0.05 and P < 0.01, respectively). Conversely, the mRNA expression levels of GSK-3β significantly increased in 2VO + V (2.55 ± 0.68) compared to sham (0.77 ± 0.29), P < 0.05 (Fig. 9A-D). However, the GSK-3β expression decreased following alone treatment with PRP (0.70 ± 0.32), ESC (0.41 ± 0.13; P < 0.05) and combined treatment (0.20 ± 0.14; P < 0.01) compared to 2VO + V (Fig. 9D). Also, significant increases were seen in PSD-95 expression following cell transplantation (3.27 ± 0.72) and combination therapy (3.85 ± 1.65) relative to 2VO + V (0.17 ± 0.09; P < 0.05) (Fig. 9C), but alone treatment with PRP was failed to recover the PSD-95 level. The same profile was seen for IGF-1, cell transplantation and combination therapy partially recovered the IGF-1 expression, but alone treatment with PRP did not show any effects on IGF-1. Moreover, we found that, following treatment with PRP and combination therapy, the TGF- β1 expression partially was recovered, but alone treatment with ESC could not show any effects on TGF- β1 expression in 2VO rats (Fig. 9B).

In the present study, we aimed to investigate the advantage of the combined use of ESC and PRP relative to ESC transplantation or PRP injection when used alone to recover memory and synaptic plasticity impairment in 2VO rats.

We performed the allograft transplantation of 1 million ESC without immunosuppression was repeated three times after 2VO surgery. In our previous study, the transplantation of 1 million cells showed better functional recovery in the 2VO rats to 2.5 million cell grafting ¹¹.

Our data indicated impairment in fear memory, spatial learning memory, LTP, BST and anxiety-like behavior in 2VO rats compared to the sham group. Moreover, in the 2VO model, the mRNA expression levels of IGF-1, PSD-95, and TGF-β1 significantly decreased, and GSK-3β expression significantly increased relative to the sham group. In addition, following treatment with PRP alone, we found significant recovery in fear memory, spatial learning, and grooming number relative to 2VO rats. Also, twice weekly PRP injections could not recover BST and LTP impairment after 2VO. However, in the 2VO + PRP group, the expression of TGF-β1 showed a partial increase, and GSK-3β expression significantly decreased relative to 2VO rats. Particularly, stem cell therapy showed significant performance recovery in all behavioral tests and LTP induction relative to the 2VO model. The results of RT-PCR showed a significant increase in PSD-95 and a significant decrease in GSK-3β expression in 2VO + ESC compared to 2VO + V. Furthermore, similar to the 2VO + ESC group in the combined treatment group, we found significant recovery in fear memory, spatial learning memory, grooming number, LTP, and BST relative to 2VO rats, but combination therapy showed better outcomes and results for BST compared to ESC alone. Therefore, we found BST recovery only in the combined treatment group, while LTP was induced in both ESC and ESC + PRP groups. A previous study reported that for the rescue of BST a longer period may be needed relative to LTP ²⁰. It seems that the combined use of PRP with ESC could accelerate BST recovery relative to PRP or ESC when used alone. Thus, after combination therapy, BST recovery might be a key player in LTP induction. We also had the best recovery in spatial memory in the combined group, which was accompanied by BST recovery. Several reports have indicated that spatial memory loss occurs in the early stage of Alzheimer's disease (AD) and synaptic dysfunction rather than neuronal death can represent the primary cause of spatial memory impairment ^21,22.

At individual synapses, BST involves the neurotransmitters released in response to a single action potential ²³. In the field potential recording, the slope of the input/output curve following increasing stimulus intensity from 100–1200 µA shows the strength of BST or synaptic excitability. Several factors affecting the BST decline after cerebral hypoperfusion includes; enhancing inhibitory synaptic transmission, reducing evoked transmitter release through elevated presynaptic calcium ²⁴, increasing the number of silent hippocampal synapses by 30–55% ²⁴, dendritic degeneration, neuronal death ²⁵, and presynaptic plasticity impairment ²⁶. The possible mechanisms for BST recovery after cell therapy might be forming new synapses between host cells and grafted cells and/or increasing the number of functional synapses through neurotrophic support. The spontaneous excitatory post-synaptic currents in graft-derived cells were recorded seven weeks after transplantation ²⁷. However, another study has recorded the post-synaptic currents in grafted cells at least four weeks post-transplantation ^28,29. Our study found BST improvement only after combination therapy in the 2VO + ESC + PRP group.

Unfortunately, we did not use the stem cell tracking method. Previous studies demonstrated the homing potential and fate of EPI-NCSC to sites of the inflammatory area following brain injury ^5,12,30. In our study, based on the time elapsed between transplantation and field potential recording (4 weeks), we can make this hypothesis that the better functional performance in behavioral test and synaptic plasticity following stem cell therapy might be mediated primarily by synaptotrophic support of the host cells and then new synaptic circuit between host and grafted cells. It seems that the co-administration of PRP with ESC can promote the new bidirectional synapse between host and transplanted cells to achieve more effective synaptic transmission than ESC or PRP alone. Perhaps the synergistic effect of combination therapy in releasing the growth factors on the host neural circuits caused this functional improvement without any new circuits between the host and grafted cells. Previous reports have suggested the hippocampal synaptic plasticity improvement following stem cell transplantation in 2VO and myocardial infarction models ^11,31. It has been indicated that EPI-NCSCs could express the vascular endothelial growth factor (VEGF), Neurotrophic growth factor (NGF), and Brain-derived neurotrophic factor (BDNF), ^32–34. BDNF can enhance synaptic transmission ³⁵, and synaptogenesis ³⁶, and improve BST, LTP,²⁰, and synaptic interactions ³⁷. It also can increase axonal branching by activating TrkB and TrkC ^38,39. These results showed that ESC-derived growth factors might effectively improve synaptic transmission.

We also found that the hippocampal expression of TGF-β1 was significantly decreased four weeks after 2VO. Sun et al. reported a significant increase in TGF-β1 concentration in the corpus callosum of 2VO rats on days 3 and 7 after the surgery model; however, on day 28, it decreased and reached the same levels as in the sham group ⁴⁰. We also found a significant down-regulation of TGF-β1 in the 2VO + ESC group compared to the sham and a partially non-significant increase in TGF-β1 following treatment with PRP alone and combination method. Therefore, it is possible that PRP injection had a key role in hippocampal TGF-β1 expression four weeks after 2VO in 2VO + PRP and 2VO + ESC + PRP groups. Several studies reported the TGF-β1 up-regulation following treatment with PRP in different types of tissue injuries ^41,42. Moreover, TGF-β1 is one of the several PRP-derived growth factors that can stimulate the proliferation and differentiation of different stem cells in injury models ^43,44. The administration of TGF- β1 could recover memory loss and hippocampal synaptic plasticity through the PI3K/Akt signaling pathway in an Alzheimer’s model ⁴⁵. It was reported that synaptic plasticity and the number and length of the dendritic spine are facilitated by PRP-derived growth factors ^46,47. These might help to justify LTP recovery in 2VO + PRP and combined treatment groups. In addition, we found the GSK-3β up-regulation in the hippocampus of 2VO rats and GSK-3β down-regulation in all types of treatment, including ESC, PRP (p < 0.05), and ESC + PRP (p < 0.01). Previous studies have indicated the over-activation of GSK-3β in the hippocampus of 2VO rats, while its suppression has shown the therapeutic target for 2VO memory deficit ⁴⁸. An increase in the activity of GSK-3β in AD brains increases tau phosphorylation and contributes to the formation of neurofibrillary tangles (NFTs) and amyloid plaques ⁴⁹. GSK-3β activity blocks synaptic LTP and induces long-term depression ⁵⁰.

We also found a significant down-regulation of PSD-95 in 2VO rats. At the same time, the mRNA expression of PSD-95 as a synaptic plasticity-associated protein significantly increased following injection of ESC and ESC + PRP without significant difference between the two groups. Zho et al. reported that the level of PSD‑95 was significantly increased in a transgenic mouse model of Alzheimer's disease following neural stem cell transplantation ⁵¹. It seems that stem cell-derived growth factors facilitate the mRNA expression of PSD-95 in the hippocampus of animals.

In our study, an open field test showed a significant increase in anxiety-like behavior of 2VO rats compared to sham. Cell transplantation in the 2VO + ESC group was associated with reduced anxiety behavior based on the increase in the central time and a decrease in peripheral time and grooming number compared with 2VO + V rats. We found a significant decrease in the amount of grooming behavior in the PRP groups without any change in central and peripheral time. Previous studies showed that the grooming number alone could be interpreted as decision-making ⁵². A decrease in grooming numbers without any recovery in central and peripheral time may not be a reliable indicator of animal stress and anxiety ^53,54. People with dementia have difficulties performing a variety of decision-making in daily living ⁵⁵. Brain regions associated with decision-making are frontal, temporal, and parietal regions and these areas vulnerable to age-related change ⁵⁶.

Experimental research showed that the Morris water maze is reliable for evaluating hippocampal function (place learning). However, in the passive avoidance disturbance, damaged regions extend from the hippocampus to the amygdala and surrounding area ⁵⁷. Following PRP injection, we could see a significant recovery in decision-making and fear memory without any improvement in spatial memory. Based on our results, the possibility exists that the neurotropic effect of PRP- derived growth factors in a large area of the brain might contribute to decision-making and fear-memory improvement. We also found that in 2VO + PRP + ESC and 2VO + ESC groups recovered, spatial memory disturbance in 2VO rats. So, it seems that spatial memory recovery needs the neurotropic effects of ESC-derived growth factors and/or new circuits between host cells and grafted cells or an increase in hippocampal neurogenesis. Several trophic factors can influence hippocampal neurogenesis including BDNF ⁵⁸, Insulin-like growth factor-I (IGF-I) ⁵⁹, NGF ⁶⁰, VEGF, and Fibroblast growth factor-2 (FGF-2). EPI-NCSCs-derived growth factors include BDNF, NGF, and VEGF ^32–34.

The hair follicles' multipotential cells are an accessible stem cell source. Auto-transplantation of these cells can be a promising therapeutic approach in neurodegenerative disorders. However, further studies are required before use in a clinical trial to clarify the migration, homing potential, and differentiation of EPI-NCSC when used with PRP compared to EPI-NCSC alone.

Conclusion: Our results indicate that the transplantation of EPI-NCSC showed better performance in spatial memory improvement than PRP alone, and combined use of EPI-NCSC with PRP could restore BST in 2VO rats. This finding may be a clue for the combination therapy of EPI-NCSC and PRP for vascular dementia.

4.1. Animals and ethics statement

Sixty-six adult male Sprague Dawley rats, aged 6–8 weeks (bodyweight 220 − 250g), were purchased from the Experimental Animal Center of Shiraz University of Medical Sciences. Animals were housed in controlled facilities; light: dark cycle (12:12 h) with free access to food and water at a temperature (23 ± 1°C) and humidity (50 ± 10%). All methods were carried out in accordance with relevant guidelines and regulations. All methods are reported in accordance with ARRIVE guidelines. The all-experimental protocols were approved by the Institutional Ethics Committee of Shiraz University of Medical Sciences (IR.SUMS.REC.1399.1179).

4.2. Experimental groups

After 1 week of adaptation to the new environment, 66 rats were randomly divided into the following groups: the control (n = 9), sham-operation (n = 9), bilateral common carotid occlusion with vehicle (2VO + V (PBS); n = 12), bilateral common carotid occlusion with PRP (2VO + PRP; n = 12), and we considered 12 rats in each transplantation groups (2VO + ESC and 2VO + ESC + PRP). Eight rats died after 2VO surgery, and the final grouping is as follows:

The control (n = 9), sham-operation (sham, n = 9), 2VO + V (n = 10), 2VO rats that received PRP twice-weekly from day 4 to 30 postoperatively (2VO + PRP; n = 9), 2VO rats that received 1×10⁶ cells (2VO + ESC; n = 11) on days 4, 14, and 21 after surgery, and 2VO rats that received combined cells and PRP (2VO + ESC + PRP; n = 10). In our study, there was no report of animal death following cell transplantation. The different methods, such as surgery, cell transplantation, behavioral tests, PRP injection, field potential recording, and Real-time PCR, were performed according to our previously published study ¹¹ (Fig. 1).

4.3. Preparation of PRP

We used thirty male Sprague–Dawley rats (250 − 300 g) for PRP preparation. Following the cardiac puncture and whole blood extraction, the animal's blood was mixed with 3.2% sodium citrate in special tubes. Then blood samples were centrifuged for 10 minutes at 400× g. After removing the supernatant in another centrifuge tube, it was centrifuged with higher centrifugal force at 1000 × g for 10 min. After discarding the upper layer, the remaining was collected as PRP and frozen at − 80°C for use ⁶¹. The percentage of platelet is over 90% by this method. We used hemocytometers with Rees and Ecker method to count the platelets. Finally, in every 500 µl injection, there were 375,000,000 platelets (250 µl PRP + 250 µl PBS, i.p.) ¹⁶. The beneficial therapeutic effects of PRP injection with the same dose have been shown in our previous studies on memory impairment in animal models of vascular dementia ¹⁶ and hepatic encephalopathy ¹⁵. The freezing and thawing method activates PRP before injection ⁶². We stored PRP at − 80°C maximum for one month ⁶³.

4.4. Preparation of EPI-NCSCs

The EPI-NCSCs were isolated from individual hair follicles of the rat whiskers pad (Fig. 2A). After carefully washing the isolated skin, each hair follicle was separated by a longitudinal section (Fig. 2B). The bulge area within the follicles was cut from the capsule under microdissection. The isolated bulge regions were placed in a collagen-coated plate. It was fed with essential medium‐α (α‐MEM, Sigma‐Aldrich) containing 10% fetal bovine serum (FBS, Gibco), 5% day‐11 chick embryo extract, and 1% penicillin/streptomycin (P/S, Gibco) and then incubated at 37°C in a humidified atmosphere with 5% CO₂. Every day, half of the culture medium was renewed. After 7–9 days, we could see stem cell migration from the bulge area (Fig. 2C), finally, these cells were detached and passage with 0.25% trypsin/EDTA (Gibco). This procedure was described in detail in previous publications ^32,64.

4.5. EPI-NCSCs verification

For verification of expanded EPI-NCSCs, immunostaining was performed against nestin and SRY-Box Transcription Factor 10 (Sox10) as neural crest stem cell markers. Briefly, after fixation of cultured EPI‐NCSCs with 4% paraformaldehyde and washing them with PBS containing 0.05% Tween‐20, the cells were blocked with 1% bovine serum albumin containing 0.2% Triton X‐100 and then overnight incubation was performed at 4°C with primary antibodies: mouse anti-nestin (1:50; Abcam, #ab6142) and rabbit anti- Sox-10 (1:100; proteintech, 10422-1-AP). The cells were incubated with goat anti-mouse IgG AlexaFluor488 (1:1000, ThermoFisher, #A-11001) or goat anti-rabbit IgG AlexaFluor488 (1:1000, Abcam, #ab150085) secondary antibodies at room temperature for two hours. Finally, cells were counterstained with DAPI (Sigma, #D9564). Images were captured with the Olympus inverted fluorescence microscope (Fig. 2D-F). EPI‐NCSCs at passage four were transplanted in 2VO rats. The viability of stem cells was also assessed by fluorescein diacetate (FDA) staining. In brief, EPI‐NCSCs in passage number 4 were washed with PBS and fixed using 4% paraformaldehyde. Following additional washing steps stem cells were stained with 25 µg/mL fluorescein diacetate (FDA, Sigma #F7378) and 5 µg/mL Hoechst 33342 (Sigma #B2261) working solutions for 5 min. Cell nuclei were counterstained with DAPI in PBS (1 min) at room temperature in the dark. Then, cells were washed with PBS buffer and imaged using a ZOE Fluorescent Cell Imager ¹¹ (Fig. 2D-F).

4.6. Bilateral common carotid arteries occlusion

Chronic cerebral hypoperfusion (CCH) was induced, as described previously in more detail ⁶⁵. In brief, the rats were anesthetized by intraperitoneal injection of ketamine (90 mg/kg) and xylazine (5mg/ kg). After cleaning the neck skin with alcohol and povidone-iodine, an incision was made in the ventral midline of the neck area, and the right and left common carotid arteries were exposed. For induction of CCH, under a surgical microscope, the vagal nerve fibers and cervical sympathetic were carefully exposed without any injury to the blood vessels or nerve fibers. In the small area of the carotid sheath, a small incision was made to pass a piece of 5 − 0 type surgical silk under the carotid artery. Right and left common carotid arteries were ligated permanently. The sham operation group involved the same surgical procedure without common carotid artery ligation ⁶⁵.

4.7. PRP injection

The intraperitoneal injection of 500 µl of PRP solution (250 µl PRP + 250 µl PBS) was started from day 4 after 2VO surgery until day 30, two times per week. 500 µl from this solution contains 375,000,000 platelets.

4.8. Cell transplantation

In the 2VO + ESC and 2VO + ESC + PRP groups, 1×10⁶ cells in 300 µl PBS were injected into the tail vein on days 4,14, and 21 after surgery.

Before infusion, with a pipette, the cells were gently re-suspended to ensure they were not aggregated. At the same time, animals in the 2VO + V were just injected with 300 µl PBS as in the above procedures.

4.9. Behavioral studies

All behavioral tests were performed from 3 to 6 pm. The anxiety-like behavior was evaluated by an open field test on day 26 after 2VO. Also, the passive avoidance test was performed on days 27 and 28. By Morris Water Maze (MWM) tests, the spatial memory performance was evaluated on days 29 and 30 post-2VO surgery ⁶⁶. An experimenter blindly tested the animals. One personnel managed the cell implantation, and another completed a behavioral assessment, ensuring that the person who performed the behavioral testing was blind to the type of animal groups. Data were collected by a video image motion analyzer (Ethovision, Noldus Information Technology; the Netherlands).

4.9.1. Open-field test

An open-field apparatus was used to evaluate the locomotion and anxiety-like behaviors. It consists of a square Plexiglas box (90 [W] × 90 [L] with a height of 45cm). The field floor was divided into 16 squares and defined as central and peripheral regions. For 15 minutes, the video tracking software evaluated the time spent in the peripheral and central regions (seconds), and the number of grooming of the animal was recorded and analyzed offline, using EthoVision (Noldus Information Technology, Netherlands) ⁶⁶.

4.9.2. Passive avoidance test

A shuttle box was used for the evaluation of fear learning and memory according to our previous published studies ^16,67. The shuttle box has two white and black chambers separated by a Plexiglas sliding guillotine door. On the 27th day after surgery, the fear learning was achieved with punishment by an electrical foot shock (0.5 mA, 50 Hz, 2 s once) upon entrance to the black chamber. This learning trial was repeated every 5 minutes until the rats did not pass from the white to the black side. The number of electrical shocks was considered a learning index for each animal. The step-through latency (STL) is the time each animal stays on the white side before crossing through the gate to the black chamber. On the 28th day post-surgery, the STL time was recorded as fear memory index without any electric shock.

4.9.3. Morris water maze

The Morris water maze (MWM) test was used to evaluate spatial learning and memory, as described previously in more detail ⁶⁶. Briefly, memory acquisition was performed on the 29th-day post-surgery, during 12 trials in three blocks. In each trial, one rat was permitted to swim in a water maze for 60 s and the time spent in the target quadrant to find the hidden platform is considered a criterion for spatial learning. The inter-trial and inter-block intervals were considered 35 sec and 30 min, respectively. On the 30th day post-surgery, during the probe trial, the platform was removed, and the percentage of the time spent in the target quadrant was recorded as indexes for spatial memory retention. Animal with better spatial memory retention spends a longer time in the target quadrant.

4.10. Field potential recording

On the 30th day post-surgery, the field potential recording was performed from the hippocampal CA1 area as described previously in more detail ^16,68. Briefly, the head of the anesthetized rats was fixed in a stereotaxic apparatus. The Schaffer collateral pathway (-4AP and 3 L) and the CA1 region (-3AP and 2 L) were drilled for insertion of stimulating and recording electrodes (0.2 mm diameter, Advent, UK). The typical shape of the field excitatory post-synaptic potential (fEPSP) wave is considered an index for confirmation of the correct position of the electrode in the CA1 area. After a 15-minute rest, the input/output curve was plotted using increment stimulation intensity from 50 to 1200 µA. In baseline recording and high-frequency stimulation (HFS), we used 40% and 80% of the maximum amplitude responses recorded from the input-output curve. The baseline fEPSP was recorded for 25 min before HFS. For evaluation of short-term plasticity, the paired-pulse ratio (pulse2 / pulse1) was calculated at inter-stimulus intervals of 25, 50, 100, 150, 200, and 250 ms before and after HFS. The HFS consisted of 3 trains (0.1 Hz), each train composed of 20 pulses at a frequency of 200 Hz. After HFS, recording continued for 60 min at the intensity of stimulation at 40% of the maximum response in the I/O curve. The percentage of change of the fEPSP amplitude after HFS to the baseline value is considered an index for LTP induction.

4.11. qRT-PCR – Quantitative Reverse Transcription PCR

Total RNA was extracted from 50 mg of rat hippocampi using RNAX Plus (Sinaclon, Tehran, Iran) and diluted to 500 ng/ul with RNase-free water. The purity of total RNA was assessed with the NanoDrop 2000/2000c spectrophotometer (Thermo Scientific, USA). RNA was then reverse transcribed into cDNA using an Easy cDNA Synthesis kit (Parstous, Mashhad, Iran). qPCR was performed using a RealQ Plus 2x Master Mix Green (Ampliqon, Denmark) in a reaction volume of 10 µl with a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific) using the following thermocycling conditions: 95°C for 600 s, followed by 40 cycles of primer specific temperature for 5 s and 72°C for 60 s, 95°C for 15 s, primer specific temperature for 60 s and 95°C for 15 s. We used the primer sequences as shown in the table.1. All values were normalized to the house keeping gene GAPDH. Table 1 shows the sequences of primers used in this study. Finally, ∆∆Ct method was applied to compare the relative gene expression ³².

Table 1

Primer sequences (5′–3′) used in qPCR
Gene Name (ID)	Forward primer (F1) (5’ to 3’) Reverse primer (R1) (5’ to 3’)	Ta(c)	Product length (BP)	Exons
IGF1 (Insulin growth factor Gene ID: 24482	F1-TGGTGGACGCTCTTCAGTTC R1-TCCGGAAGCAACACTCATCC	57–61	123	2–3
Gsk-3β(glycogen synthase kinase 3 beta) Gene ID: 84027	F1-AGCTGATCTTTGGAGCCACC R1-CTGATCCACACCACTGTCCC	56–61	119	6–7
TGF-β1 (transforming growth factor, beta 1) Gene ID: 59086	F1- TGACATGAACCGACCCTTCC R1- TGCCGTACACAGCAGTTCTT	57–62	138	5–6
PSD95 (discs large MAGUK scaffold protein 4) Gene ID: 29495	F1- CTGCATCCTTGCGAAGCAAC R1- AAGAAACCGCAGTCCTTGGT	57–62	85	11–12

4.12. Statistical analysis

The means of values in passive avoidance, open field, water maze, paired-pulse ratio, EPSP slope in the I/O curve, and relative mRNA expression levels in 6 groups with normal distribution were compared with the one-way ANOVA with Tukey’s posthoc test. All values are expressed as Mean ± SEM. The normalized amplitude of EPSP before and after HFS was compared with the paired t-test. Two-way Repeated-Measures ANOVA was employed for evaluation of the fEPSP changes in repeated times after delivery of HFS and time spent in 3 blocks of the MWM test. All the data analyses were performed using PRISM. 6 software, and the significance level was set at P < 0.05.

Acknowledgements

The authors acknowledge the Research Council of Shiraz University of Medical Sciences, Shiraz, Iran for the financial support of this study (Grant Number: 22041), as a thesis for acquiring Ph.D. degree in physiology.

Author contributions:

Somayeh Akbari: B, C, E, and F

Masoud Haghani: A, B, C, D, E, and F

Mojtaba Ghobadi: B, C, E, and F

Etrat Hooshmandi: B, C, E, and F

Afshin Borhani Haghighi: B, C, D, E, and F

Mohammad Saied Salehi: B, C, E, and F

Sareh Pandamooz: B, C, E, and F

Negar Azarpira: B, C, E, and F

Afsoon Afshari: B, C, E, and F

Shahrbanoo Zabihi: B, C, E, and F

Marzieh Nemati: B, C, E, and F

Mahnaz Bayat: A, B, C, D, E and E

A= made a substantial contribution to the concept or design of the article

B=Writing- Reviewing and Editing

C=analysis

D=interpretation of data for the article

E= Drafted the article or revised it critically for important intellectual content

F= Approved the version to be published

Data Availability:

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Declarations of interest: none

Broughton, B. R., Reutens, D. C. & Sobey, C. G. Apoptotic mechanisms after cerebral ischemia. Stroke 40, e331-339, doi:10.1161/STROKEAHA.108.531632 (2009).
Safouris, A. et al. Chronic brain hypoperfusion due to multi-vessel extracranial atherosclerotic disease: a potentially reversible cause of cognitive impairment. J Alzheimers Dis 43, 23–27, doi:10.3233/JAD-141203 (2015).
Cipriani, G., Danti, S., Picchi, L., Nuti, A. & Fiorino, M. D. Daily functioning and dementia. Dement Neuropsychol 14, 93–102, doi:10.1590/1980-57642020dn14-020001 (2020).
De Gioia, R. et al. Neural Stem Cell Transplantation for Neurodegenerative Diseases. Int J Mol Sci 21, doi:10.3390/ijms21093103 (2020).
Zhang, X. et al. Transplanted hair follicle stem cells migrate to the penumbra and express neural markers in a rat model of cerebral ischaemia/reperfusion. Stem Cell Res Ther 11, 413, doi:10.1186/s13287-020-01927-w (2020).
Blanpain, C., Lowry, W. E., Geoghegan, A., Polak, L. & Fuchs, E. Self-renewal, multipotency, and the existence of two cell populations within an epithelial stem cell niche. Cell 118, 635–648, doi:10.1016/j.cell.2004.08.012 (2004).
Wilson, C. et al. Cells within the bulge region of mouse hair follicle transiently proliferate during early anagen: heterogeneity and functional differences of various hair cycles. Differentiation 55, 127–136, doi:10.1046/j.1432-0436.1994.5520127.x (1994).
Kanno, H. Regenerative therapy for neuronal diseases with transplantation of somatic stem cells. World J Stem Cells 5, 163–171, doi:10.4252/wjsc.v5.i4.163 (2013).
El Seady, R., Huisman, M. A., Lowik, C. W. & Frijns, J. H. Uncomplicated differentiation of stem cells into bipolar neurons and myelinating glia. Biochem Biophys Res Commun 376, 358–362, doi:10.1016/j.bbrc.2008.08.166 (2008).
Amoh, Y., Li, L., Katsuoka, K., Penman, S. & Hoffman, R. M. Multipotent nestin-positive, keratin-negative hair-follicle bulge stem cells can form neurons. Proc Natl Acad Sci U S A 102, 5530–5534, doi:10.1073/pnas.0501263102 (2005).
Akbari, S. et al. The neuroprotective properties and therapeutic potential of epidermal neural crest stem cells transplantation in a rat model of vascular dementia. Brain Res 1776, 147750, doi:10.1016/j.brainres.2021.147750 (2022).
Esmaeilzade, B. et al. Delivery of epidermal neural crest stem cells (EPI-NCSC) to hippocamp in Alzheimer's disease rat model. Iran Biomed J 16, 1–9, doi:10.6091/ibj.1029.2012 (2012).
Amoh, Y. et al. Implanted hair follicle stem cells form Schwann cells that support repair of severed peripheral nerves. Proc Natl Acad Sci U S A 102, 17734–17738, doi:10.1073/pnas.0508440102 (2005).
Najafzadeh, N., Nobakht, M., Pourheydar, B. & Golmohammadi, M. G. Rat hair follicle stem cells differentiate and promote recovery following spinal cord injury. Neural Regen Res 8, 3365–3372, doi:10.3969/j.issn.1673-5374.2013.36.001 (2013).
Bayat, M. et al. Effects of platelet-rich plasma on the memory impairment, apoptosis, and hippocampal synaptic plasticity in a rat model of hepatic encephalopathy. Brain Behav 12, e2447, doi:10.1002/brb3.2447 (2022).
Bayat, M., Zabihi, S., Karbalaei, N. & Haghani, M. Time-dependent effects of platelet-rich plasma on the memory and hippocampal synaptic plasticity impairment in vascular dementia induced by chronic cerebral hypoperfusion. Brain research bulletin 164, 299–306, doi:10.1016/j.brainresbull.2020.08.033 (2020).
Boswell, S. G., Cole, B. J., Sundman, E. A., Karas, V. & Fortier, L. A. Platelet-rich plasma: a milieu of bioactive factors. Arthroscopy 28, 429–439, doi:10.1016/j.arthro.2011.10.018 (2012).
Houdek, M. T. et al. Stem Cells Combined With Platelet-rich Plasma Effectively Treat Corticosteroid-induced Osteonecrosis of the Hip: A Prospective Study. Clin Orthop Relat Res 476, 388–397, doi:10.1007/s11999.0000000000000033 (2018).
Salarinia, R. et al. Combined use of platelet-rich plasma and adipose tissue-derived mesenchymal stem cells shows a synergistic effect in experimental spinal cord injury. J Chem Neuroanat 110, 101870, doi:10.1016/j.jchemneu.2020.101870 (2020).
Patterson, S. L. et al. Recombinant BDNF rescues deficits in basal synaptic transmission and hippocampal LTP in BDNF knockout mice. Neuron 16, 1137–1145, doi:10.1016/s0896-6273(00)80140-3 (1996).
Yang, X. et al. A novel mechanism of memory loss in Alzheimer's disease mice via the degeneration of entorhinal-CA1 synapses. Mol Psychiatry 23, 199–210, doi:10.1038/mp.2016.151 (2018).
Hsia, A. Y. et al. Plaque-independent disruption of neural circuits in Alzheimer's disease mouse models. Proc Natl Acad Sci U S A 96, 3228–3233, doi:10.1073/pnas.96.6.3228 (1999).
Panatier, A. et al. Astrocytes are endogenous regulators of basal transmission at central synapses. Cell 146, 785–798, doi:10.1016/j.cell.2011.07.022 (2011).
Jalini, S., Ye, H., Tonkikh, A. A., Charlton, M. P. & Carlen, P. L. Raised Intracellular Calcium Contributes to Ischemia-Induced Depression of Evoked Synaptic Transmission. PLoS One 11, e0148110, doi:10.1371/journal.pone.0148110 (2016).
Chen, X. et al. MicroRNA-195 prevents dendritic degeneration and neuron death in rats following chronic brain hypoperfusion. Cell Death Dis 8, e2850, doi:10.1038/cddis.2017.243 (2017).
Yan, M. L. et al. MicroRNA-153 impairs presynaptic plasticity by blocking vesicle release following chronic brain hypoperfusion. Cell Commun Signal 18, 57, doi:10.1186/s12964-020-00551-8 (2020).
Buhnemann, C. et al. Neuronal differentiation of transplanted embryonic stem cell-derived precursors in stroke lesions of adult rats. Brain 129, 3238–3248, doi:10.1093/brain/awl261 (2006).
Daadi, M. M. et al. Functional engraftment of the medial ganglionic eminence cells in experimental stroke model. Cell Transplant 18, 815–826, doi:10.3727/096368909X470829 (2009).
Englund, U., Bjorklund, A., Wictorin, K., Lindvall, O. & Kokaia, M. Grafted neural stem cells develop into functional pyramidal neurons and integrate into host cortical circuitry. Proc Natl Acad Sci U S A 99, 17089–17094, doi:10.1073/pnas.252589099 (2002).
Jackson, J. S., Golding, J. P., Chapon, C., Jones, W. A. & Bhakoo, K. K. Homing of stem cells to sites of inflammatory brain injury after intracerebral and intravenous administration: a longitudinal imaging study. Stem Cell Res Ther 1, 17, doi:10.1186/scrt17 (2010).
Lee, T. M. et al. Intramyocardial injection of human adipose-derived stem cells ameliorates cognitive deficit by regulating oxidative stress-mediated hippocampal damage after myocardial infarction. J Mol Med (Berl) 99, 1815–1827, doi:10.1007/s00109-021-02135-6 (2021).
Salehi, M. S. et al. Epidermal neural crest stem cell transplantation as a promising therapeutic strategy for ischemic stroke. CNS Neurosci Ther 26, 670–681, doi:10.1111/cns.13370 (2020).
Hu, Y. F., Zhang, Z. J. & Sieber-Blum, M. An epidermal neural crest stem cell (EPI-NCSC) molecular signature. Stem Cells 24, 2692–2702, doi:10.1634/stemcells.2006-0233 (2006).
Pandamooz, S. et al. Enhancing the expression of neurotrophic factors in epidermal neural crest stem cells by valproic acid: A potential candidate for combinatorial treatment. Neurosci Lett 704, 8–14, doi:10.1016/j.neulet.2019.03.033 (2019).
Gomez-Palacio Schjetnan, A. & Escobar-Rodriguez, M. L. [Memory coding and retention: brain-derived neurotrophic factor (BDNF) in synaptic plasticity]. Rev Neurol 45, 409–417 (2007).
Gonzalez, A., Moya-Alvarado, G., Gonzalez-Billaut, C. & Bronfman, F. C. Cellular and molecular mechanisms regulating neuronal growth by brain-derived neurotrophic factor. Cytoskeleton (Hoboken) 73, 612–628, doi:10.1002/cm.21312 (2016).
Sasi, M., Vignoli, B., Canossa, M. & Blum, R. Neurobiology of local and intercellular BDNF signaling. Pflugers Arch 469, 593–610, doi:10.1007/s00424-017-1964-4 (2017).
Cheung, Z. H., Chin, W. H., Chen, Y., Ng, Y. P. & Ip, N. Y. Cdk5 is involved in BDNF-stimulated dendritic growth in hippocampal neurons. PLoS Biol 5, e63, doi:10.1371/journal.pbio.0050063 (2007).
Cohen, M. S., Bas Orth, C., Kim, H. J., Jeon, N. L. & Jaffrey, S. R. Neurotrophin-mediated dendrite-to-nucleus signaling revealed by microfluidic compartmentalization of dendrites. Proc Natl Acad Sci U S A 108, 11246–11251, doi:10.1073/pnas.1012401108 (2011).
Sun, Z. et al. Reduction in pericyte coverage leads to blood-brain barrier dysfunction via endothelial transcytosis following chronic cerebral hypoperfusion. Fluids Barriers CNS 18, 21, doi:10.1186/s12987-021-00255-2 (2021).
Hofny, E. R. M., Hussein, M. R. A., Ghazally, A., Ahmed, A. M. & Abdel-Motaleb, A. A. Increased expression of TGF-beta protein in the lesional skins of melasma patients following treatment with platelet-rich plasma. J Cosmet Laser Ther 21, 382–389, doi:10.1080/14764172.2019.1668016 (2019).
Boakye, L. A. et al. Platelet-rich plasma increases transforming growth factor-beta1 expression at graft-host interface following autologous osteochondral transplantation in a rabbit model. World J Orthop 6, 961–969, doi:10.5312/wjo.v6.i11.961 (2015).
Qian, Y. et al. Platelet-Rich Plasma Derived Growth Factors Contribute to Stem Cell Differentiation in Musculoskeletal Regeneration. Front Chem 5, 89, doi:10.3389/fchem.2017.00089 (2017).
Sanchez, M., Garate, A., Delgado, D. & Padilla, S. Platelet-rich plasma, an adjuvant biological therapy to assist peripheral nerve repair. Neural Regen Res 12, 47–52, doi:10.4103/1673-5374.198973 (2017).
Qiang Duan, C. C. Transforming growth factor β1 restores hippocampal synaptic plasticity and memory loss in an Alzheimer’s disease model through the PI3K/Akt signaling pathway. Int J Clin Exp Med 13, 4193–4201 (2020).
Conner, J. M. et al. NGF is essential for hippocampal plasticity and learning. J Neurosci 29, 10883–10889, doi:10.1523/JNEUROSCI.2594-09.2009 (2009).
Latzer, P. et al. Blocking VEGF by Bevacizumab Compromises Electrophysiological and Morphological Properties of Hippocampal Neurons. Front Cell Neurosci 13, 113, doi:10.3389/fncel.2019.00113 (2019).
Ma, S. et al. Erythropoietin Rescues Memory Impairment in a Rat Model of Chronic Cerebral Hypoperfusion via the EPO-R/JAK2/STAT5/PI3K/Akt/GSK-3beta Pathway. Mol Neurobiol 55, 3290–3299, doi:10.1007/s12035-017-0568-5 (2018).
Toral-Rios, D., Pichardo-Rojas, P. S., Alonso-Vanegas, M. & Campos-Pena, V. GSK3beta and Tau Protein in Alzheimer's Disease and Epilepsy. Front Cell Neurosci 14, 19, doi:10.3389/fncel.2020.00019 (2020).
Sayas, C. L. & Avila, J. GSK-3 and Tau: A Key Duet in Alzheimer's Disease. Cells 10, doi:10.3390/cells10040721 (2021).
Zhu, Q. et al. Neural stem cell transplantation improves learning and memory by protecting cholinergic neurons and restoring synaptic impairment in an amyloid precursor protein/presenilin 1 transgenic mouse model of Alzheimer's disease. Mol Med Rep 21, 1172–1180, doi:10.3892/mmr.2020.10918 (2020).
Sestakova, N., Puzserova, A., Kluknavsky, M. & Bernatova, I. Determination of motor activity and anxiety-related behaviour in rodents: methodological aspects and role of nitric oxide. Interdiscip Toxicol 6, 126–135, doi:10.2478/intox-2013-0020 (2013).
Kalueff, A. V., Aldridge, J. W., LaPorte, J. L., Murphy, D. L. & Tuohimaa, P. Analyzing grooming microstructure in neurobehavioral experiments. Nat Protoc 2, 2538–2544, doi:10.1038/nprot.2007.367 (2007).
Kalueff, A. V. & Tuohimaa, P. Grooming analysis algorithm for neurobehavioural stress research. Brain Res Brain Res Protoc 13, 151–158, doi:10.1016/j.brainresprot.2004.04.002 (2004).
Sun, W., Matsuoka, T. & Narumoto, J. Decision-Making Support for People With Alzheimer's Disease: A Narrative Review. Front Psychol 12, 750803, doi:10.3389/fpsyg.2021.750803 (2021).
van Duinkerken, E. et al. Medical and Research Consent Decision-Making Capacity in Patients with Alzheimer's Disease: A Systematic Review. J Alzheimers Dis 65, 917–930, doi:10.3233/JAD-180311 (2018).
Burwell, R. D., Saddoris, M. P., Bucci, D. J. & Wiig, K. A. Corticohippocampal contributions to spatial and contextual learning. J Neurosci 24, 3826–3836, doi:10.1523/JNEUROSCI.0410-04.2004 (2004).
Zigova, T., Pencea, V., Wiegand, S. J. & Luskin, M. B. Intraventricular administration of BDNF increases the number of newly generated neurons in the adult olfactory bulb. Mol Cell Neurosci 11, 234–245, doi:10.1006/mcne.1998.0684 (1998).
Aberg, M. A., Aberg, N. D., Hedbacker, H., Oscarsson, J. & Eriksson, P. S. Peripheral infusion of IGF-I selectively induces neurogenesis in the adult rat hippocampus. J Neurosci 20, 2896–2903 (2000).
Cuello, A. C. & Bruno, M. A. The failure in NGF maturation and its increased degradation as the probable cause for the vulnerability of cholinergic neurons in Alzheimer's disease. Neurochem Res 32, 1041–1045, doi:10.1007/s11064-006-9270-0 (2007).
Franco, D., Franco, T., Schettino, A. M., Filho, J. M. & Vendramin, F. S. Protocol for obtaining platelet-rich plasma (PRP), platelet-poor plasma (PPP), and thrombin for autologous use. Aesthetic Plast Surg 36, 1254–1259, doi:10.1007/s00266-012-9957-3 (2012).
İbrahim Eker, S. Y., Rıza A Çetinkaya, Aytekin Ünlü, Aysel Pekel, Rahşan I Sağkan, Zerrin Ertaş, Orhan Gürsel,, Hacı U Muşabak, E. Y., Sebahattin Yilmaz, Cengizhan Açikel, İsmail Y Avci, Ferit Avcu, Emin Kürekçi1, & Petrone, P. A Cycle of Freezing and Thawing as a Modified Method for Activating Platelets in Platelet-rich Plasma to Use in Regenerative Medicine. Panamerican Journal of Trauma Critical Care & Emergency Surgery 9, 101–104 (2021).
McClain, A. K. & McCarrel, T. M. The effect of four different freezing conditions and time in frozen storage on the concentration of commonly measured growth factors and enzymes in equine platelet-rich plasma over six months. BMC Vet Res 15, 292, doi:10.1186/s12917-019-2040-4 (2019).
Sieber-Blum, M. & Grim, M. The adult hair follicle: cradle for pluripotent neural crest stem cells. Birth defects research. Part C, Embryo today: reviews 72, 162–172, doi:10.1002/bdrc.20008 (2004).
Bayat, M., Sharifi, M. D., Haghani, M. & Shabani, M. Enriched environment improves synaptic plasticity and cognitive deficiency in chronic cerebral hypoperfused rats. Brain research bulletin 119, 34–40, doi:10.1016/j.brainresbull.2015.10.001 (2015).
Shabani, M. et al. Modulation of sphingosine-1-phosphate receptor by FTY720 contributes in improvement of hepatic encephalopathy induced by bile duct ligation. Brain research bulletin 146, 253–269, doi:10.1016/j.brainresbull.2019.01.012 (2019).
Mohammadian, F. et al. Inhibition of inflammation is not enough for recovery of cognitive impairment in hepatic encephalopathy: Effects of minocycline and ibuprofen. Brain research bulletin 149, 96–105, doi:10.1016/j.brainresbull.2019.04.015 (2019).
Firouzjaei, M. A., Haghani, M. & Shid Moosavi, S. M. Renal ischemia/reperfusion induced learning and memory deficit in the rat: Insights into underlying molecular and cellular mechanisms. Brain Res 1719, 263–273, doi:10.1016/j.brainres.2019.05.018 (2019).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Combination therapy with platelet-rich plasma and epidermal neural crest stem cells increases treatment efficacy in vascular dementia

Status:

Version 1

Abstract

Figures

1. Introduction

2. Results

2.1. Behavioral tests

2.1.1. Open field test

2.1.2. Passive avoidance test

2.1.3. Morris water maze test

2.2. Field potential recording at Schaffer collateral-CA1 synapse in 2VO rats.

2.2.1. Basal synaptic transmission

2.2.2. Short-term synaptic plasticity

2.2.3. Long-term synaptic plasticity (LTP)

2.3. mRNA expression levels of IGF1, TGF-β1, PSD-95, and GSk-3β in rat hippocampus

3. Discussion

4. Materials And Methods

4.1. Animals and ethics statement

4.2. Experimental groups

4.3. Preparation of PRP

4.4. Preparation of EPI-NCSCs

4.5. EPI-NCSCs verification

4.6. Bilateral common carotid arteries occlusion

4.7. PRP injection

4.8. Cell transplantation

4.9. Behavioral studies

4.9.1. Open-field test

4.9.2. Passive avoidance test

4.9.3. Morris water maze

4.10. Field potential recording

4.11. qRT-PCR – Quantitative Reverse Transcription PCR

4.12. Statistical analysis

Declarations

References

Additional Declarations

Status:

Version 1