Effect of (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone from Blumea axillaris (Lam.) DC. plant against An. stephensi and Cx. quinquefasciatus vector mosquitoes (Diptera: Culicidae) and expression of different functional genes

doi:10.21203/rs.3.rs-2476047/v1

The present study was conducted to evaluate the mosquitocidal efficiency using a compound isolated from Blumea axillaris (Lam.) DC. against Culex quinquefasciatus and Anopheles stephensi. The compound isolated from leaves of B. axillaris is (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone. This isolated compound was exposed to eggs and larvae of An. stephensi and Cx. quinquefasciatus and with different concentrations of 0.5, 1.0, 1.5, and 2.0 ppm. Primarily, the hexane extract of an isolated compound exhibited promising larvicidal activities of LC⁵⁰ and LC⁹⁰ values of 155.811 and 566.763 ppm against An. stephensi and 77.215 and 99.653 against Cx. quinquefasciatus at 24 hours. Secondly, the compound isolated from B. axillaris at 2-ppm concentration exhibited LC⁵⁰ and LC⁹⁰ values of 0.85 and 3.59 and 1.19 and 3.678 ppm against Cx. quinquefasciatus and An. stephensi larvae, respectively. Furthermore, histopathological studies revealed serious damage to the larval midgut cells in both Cx. quinquefasciatus and An. stephensi (treated with compound). Additionally, it showed 81.0% and 84.2% ovicidal activity against both Cx. quinquefasciatus and An. stephensi eggs at 120 h post-treatment. In addition, we also analyzed the influence of isolated compound on the expression of different functional genes of An. stephensi and Cx. quinquefasciatus namely (1) White (Wh) gene, which is responsible for eye pigmentation; (2) the Glutathione transferase (GST) gene that helps for survival when exposed to any insecticides or pesticides; (3) Cytochrome P450 monooxygenase (CYP450) gene that enhances resistance in mosquitoes to digest pesticides and (4) Esterase (Est) gene, which helps in resistance to the variety of insecticides. These overall studies and results clearly suggest that compounds from B. axillaris could act as good mosquitocidal agents against both Cx. quinquefasciatus and An. stephensi and the compound were also first time reported as mosquitocidal activity.

Blumea axillaris

Mosquito

Larvicidal

Ovicidal

Histopathology

qRT-PCR

Mosquitoes are the major transporter of viruses and are responsible for severe health problems in humans and domestic animals all over the world (Medlock et al. 2012; Organization 2013; Hillary et al. 2020). Globally, every year, more than 1 billion cases and 1 million deaths are recorded due to these mosquito-borne infectious diseases. Mosquitoes belonging to the genera Aedes, Anopheles, and Culex transmit dengue, chikungunya, yellow fever, zika, malaria, and filariasis to humans (Hillary and Ceasar 2021). Bite of these mosquitoes causes allergic responses with high fever, rash, nausea, limb swelling, and sometimes bleeding and death. Therefore, real vector control approaches are needed to avoid mosquito-borne diseases and improve community health (Hillary and Ceasar 2021).

In recent years, the most commonly used methods to control vector mosquitoes depend on chemical pesticides such as organophosphates, organochlorides, carbamates, methoprene, pyriproxyfen, and N, N-Diethyl-meta-toluamide (DEET) (Liu et al. 2005; Amer and Mehlhorn 2006). However, these chemicals, being pesticides, risk human life and the environment (Wang and Jacobs-Lorena 2013). Therefore, researchers focus on environment-friendly alternatives like plant extract, bacteria, and fungi instead of using chemical insecticides (Khan et al. 2012). Among these, the literature reveals a sufficient amount of work on mosquito control using plant extracts and plant compounds (Govindarajan et al. 2008; Anstrom et al. 2012). So far, more than 300 plants (including Azadirachta indica, Cassis tora, Cestrum nocturnum, Delonix elata, Carapa guinesis, Solanum xanthocarpum, Orthosiphon thymiflorus, etc.) have been identified, which have insecticidal activity against vector-borne mosquitoes (Schmutterer 1990; Shaalan et al. 2005; Kumar et al. 2012). Several phytocompounds (like nilocotin, 3, 5-dimethoxy-3′, 4′, 6, 7- bismethylendioxyflavone, N-methyl-N-cis-styrylcinnamamide, saponin, ecbolin A, ecbolin B, etc.) isolated from various plants are also been utilized for controlling the vector-borne mosquitoes (Cecilia, 2014; Reegan et al., 2014).

Therefore, in the present study, we selected medicinal plant Blumea axillaris and isolated compounds and used against An. stephensi and Cx. quinquefasciatus mosquitoes. B. axillaris (Lam.) DC is a Synonyms of Blumea wightiana (DC), Blumea mollis (D. Don) Merr. It’s belongs to the Asteraceae family (Tribe Inuleae). It's an aromatic annual herb that is native to Southeast Asia, south of Sahara, and South America (Sreelekha et al. 2017). The B. axillaris having many medicinal properties and used for treating diarrhoea, asthma, dropsy, skin diseases, wounds, and external parasites (Sreelekha et al. 2017). This plant also reported to be an anti-inflammatory, anticancer, antibacterial, anti-phytofungal and antioxidant activities (Sreelekha et al. 2017; Sivanandhan et al. 2018). Isolated essential oil and alcoholic extract of this plant also showed promising mosquito larvicidal activities (Senthilkumar et al. 2008). Previously, few compounds isolated from B. axillaris, such as 4-hydroxy-7-ethoxycarvotanacetone (ethanol extract of the whole plant) (Bohlmann et al. 1979), 4-hydroxy-7-tigloyloxycarvotanacetone (ethanol extract of the whole plant) (Bohlmann et al. 1979), 4R, 5S)-4-hydroxy-7-tigloyloxy carvotan acetone and its acetate derivative 4R, 5S)-4-acetoxy-7-tigloyloxy carvotan acetone, which showed good mosquitocidal activities (Sivanandhan et al. 2018, 2021; Subramaniyan et al. 2021).

Therefore, in this present study we isolated an active compound from B. axillar leaves (n-hexane extract) and checked mosquitocidal activities, particularly An. stephensi and Cx. quinquefasciatus (omitted Aedes aegypti, since mortality could not be observed). The isolated compound was screened for larvicidal, ovicidal and histopathological effects against An. stephensi and Cx. quinquefasciatus. In addition, we also studied the influence of phyto-compound on the expression of different functional genes of An. stephensi and Cx. quinquefasciatus namely (1) White (Wh) gene, which is responsible for the eye pigmentation; (2) Glutathione transferase (GST) gene that helps for the survival when exposed to any insecticides or pesticides; (3) Cytochrome P450 monooxygenase (CYP450) gene that enhances resistance in mosquitoes to digest pesticides and (4) Esterase (Est) gene, which helps in resistance to the variety of insecticides.

Plant collection and identification

B. axillaris plant was collected from Cuddalore District, Tamil Nadu, India. The plant was collected during the flowering stage in the month of March to May 2018. Taxonomist Dr. Pandikumar from Entomology Research Institute (ERI), Loyola College, Chennai, performed the taxonomical identification of the plant species. Voucher specimen (ERISS-02) of B. axillaris plant was deposited in the herbarium at ERI.

Preparation Of Crude Extract

The collected plant materials were shade-dried at room temperature and coarsely powdered using an electric blender. The powdered material (100 g) of the B. axillaris plant was sequentially extracted using hexane, chloroform, and methanol solvents. After 72 h of soaking, the extract was filtered through Whatman No.1 filter paper and dried in a vacuum. Solvents in the extract were removed using a rotary vacuum evaporator at 45–55°C and the crude extracts were stored at 4°C in the refrigerator for further bioassay.

Mosquito Larvae Rearing

An. stephensi and Cx. quinquefasciatus mosquitoes’ larvae were collected from stagnant water in the Coovam River, Chennai, during August 2018. The collected larvae were maintained in the Entomology Research Institute, Loyola College, Chennai at a temperature of 28 ± 2 ˚C and relative humidity (RH) of 75 ± 5% with a photoperiod of 12 ± 0.5 hours (hrs). Larvae were kept in plastic containers at a density of 75 larvae per container containing 100 ml of water (pH-7.0) to which 3:2 g of dog biscuits and brewer’s yeast were added and were kept free from pathogens, repellents, and insecticides. The plastic containers were covered with netting material. The first (F1) generation larvae were used for the experiment (Cecilia et al., 2014).

Extraction and Column chromatography for B. axillaris hexane extract

The B. mollis hexane extract was subjected to column chromatography. The dried crude extract (25 gm) was blended with silica gel (Acmae’s 60–120 mesh) and loaded on a glass column, which was packed with silica gel (Acmae’s 100–200 mesh). The silica column was initially washed with hexane and the extract was eluted with solvents of increasing polarity starting in the following order: (1) hexane (100%); (2) hexane: ethyl acetate (9:1); (3) hexane: ethyl acetate (8:2); (4) hexane: ethyl acetate (6:4); (5) hexane: ethyl acetate (1:1); (6) ethyl acetate (100%); and (7) methanol (100%). All fractions were collected in 250 ml conical flasks separately. The collected fractions were subjected to TLC and their R_f values were calculated. In total, 150 fractions were obtained and all the fractions were subjected to TLC analysis. Based on the TLC profile, similar fractions were pooled together and finally, seven fractions were obtained. The seven fractions were screened for larvicidal activity, which was reported by Sivanandhan et al. (2020). The fractions, which showed good larvicidal activities, were selected to identify new active compounds.

Chemicals And Instruments

Acmes’s silico gel (100–200 mesh) was used for column chromatography. Silico gel F₂₅₄ pre-coated aluminium plates (Merck, 0.2 mm thickness) were used for TLC. 10% alcoholic H₂SO₄ was used for visualization (heated at 110 degrees for 5 min until colours appeared).

FT-IR spectrum was taken on a Perkin-Elmer grating spectrophotometer in a KBr disc. ¹H-NMR (700 MHz) and ¹³C-NMR (175 MHz) spectra were recorded on a Bruker instrument in CDCl₃. Chemical shift values are given in 𝛿 scale with TMS (Tetramethylsilane) as the internal standard.

2D NMR (COSY, HSQC, HMBC, and NOESY) were also recorded. HRESI-MS was recorded on the LC-MS TOF Shimadzu instrument. Preparatory HPLC was run on a JASCO instrument. Analytical grade chemicals and solvents used were for this study.

Isolation Of The Active Constituent

The active hexane extract was subjected to column chromatography over silica gel (Acmes’s 100–200 mesh) packed in hexane. The column was eluted with hexane and ethyl acetate mixtures with increasing amounts of ethyl acetate resulting in 7 fractions. Fraction 4 eluted with hexane–ethyl acetate 6:4 showed good antifungal activity reported by Sivanandhan et al. 2020.

Purification Of Active Principle By Preparatory Hplc

Fraction 4 eluted with hexane–ethyl acetate 3:2 and was washed with little methanol. Further purification of the compound was achieved by preparative HPLC (Column COSMOSIL 5C18 MS 11, JASCO Gulliver System, 250 × 20 mm, 5 µm, gradient elution acetonitrile - H₂O 40–60%, 2 ml/min UV 215 nm). The same active fraction, the compound (4R, 5S) – 4 – hydroxyl – 7 - tigloyloxy carvotan acetone already been reported from the plant by Sivanandhan et al. (2020). The active compound identified was (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone.

Larvicidal Assay Using (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

Larvicidal assay was done via a previously used method of WHO (2005) with small modifications (Organization 2005). Twenty (20) F1 generation larvae each of An. stephensi and Cx. quinquefasciatus were introduced to the test concentrations of 0.5, 1, 1.5, and 2.0 ppm for the isolated compound. The isolated compound was prepared using DMSO (249 ml of water and 1 ml of DMSO); five replications were maintained for each concentration. The azadirachtin (Sigma Aldrich) and temephos (Sigma Aldrich) were used as positive controls at the same test concentrations of 0.5, 1, 1.5, and 2.0 ppm, with five replicates. The water was served as a negative control. An. stephensi and Cx. quinquefasciatus larvae mortality rate was observed after 24 hrs of exposure. Then mortality rate for each assay of dead larvae was done using the following formula (a). The corrections for mortality were done using Abbot’s formula when control mortality was below 5% (b) (Abbott 1925).

(a) Percentage of mortality:\(\frac{\text{N}\text{o}. \text{o}\text{f} \text{d}\text{e}\text{a}\text{d} \text{l}\text{a}\text{r}\text{v}\text{a}\text{e}}{\text{N}\text{o}. \text{o}\text{f} \text{l}\text{a}\text{r}\text{v}\text{a}\text{e} \text{i}\text{n}\text{t}\text{r}\text{o}\text{d}\text{u}\text{c}\text{e}\text{d}}\)

(b) Corrected percentage of mortality:\(\frac{1-n \text{i}\text{n} T \text{a}\text{f}\text{t}\text{e}\text{r} \text{t}\text{r}\text{e}\text{a}\text{t}\text{m}\text{e}\text{n}\text{t}}{n \text{i}\text{n} C \text{a}\text{f}\text{t}\text{e}\text{r} \text{t}\text{r}\text{e}\text{a}\text{t}\text{m}\text{e}\text{n}\text{t}}\)

Where n is the number of larvae, T is the number of treated larvae, and C is the number of larvae in control. The corrected percentage mortality value for each concentration was consider to estimate LC₅₀ and LC₉₀ values by using US EPA probit analysis software (version 1.5).

Ovicidal Assay Using (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

The ovicidal activity was assessed using the prescribed method of Elango et al. (2009) with slight modifications. Twenty (20) freshly laid eggs of An. stephensi and Cx. quinquefasciatus were exposed to the test concentrations of 0.5, 1, 1.5, and 2.0 ppm for the compound. The isolated compound was prepared using DMSO (249 ml of water and 1 ml of DMSO); five replications were maintained for each concentration. The azadirachtin (Sigma Aldrich) and temephos (Sigma Aldrich) were used as positive controls at the same test concentrations of 0.5, 1, 1.5, and 2.0 ppm with five replicates. The water was served as a negative control. The ovicidal activity was evaluated up to 120 hrs post-treatment. After 120 hrs post-treatment, the control, and treated eggs were observed under the microscope and photographed using a stereo zooming microscope (Wild M7S TYP 308700, Switzerland). The unhatched eggs with unopened opercula were counted in each experiment; hatchability of the egg was observed using a compound microscope at 120 hrs post-treatment, and the ovicidal treatment was assessed in percentage by using the following formula.

Percentage of egg mortality:\(\frac{\text{N}\text{u}\text{m}\text{b}\text{e}\text{r} \text{o}\text{f} \text{u}\text{n}\text{h}\text{a}\text{t}\text{c}\text{h}\text{e}\text{d} \text{e}\text{g}\text{g}\text{s}}{\text{T}\text{o}\text{t}\text{a}\text{l} \text{n}\text{u}\text{m}\text{b}\text{e}\text{r} \text{o}\text{f} \text{e}\text{g}\text{g}\text{s}} \times 100\)

Effect Of Isolated Compounds On Non-target Organisms

The effect of active compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone was tested based on the Maheswaran and Ignacimuthu (2012) method against non-target organisms such as Poecilia reticulata (predatory fish) collected from a pond of Fishery Research Institute, Chetpet, Chennai, India. The collected predator was exposed to different test concentrations of 0.5, 1, 1.5, and 2.0 ppm for the active compound. Temephos and azadirachtin were used as a positive control with 5 replicates. The mortality rate was observed after a 24 hrs exposure. After the treatment, the predators were free from the isolated compound and left free to normal water. The LC₅₀ and LC₉₀ values were obtained using probit analysis (version 1.5).

Percentage of mortality:\(\frac{\text{N}\text{o}. \text{o}\text{f} \text{d}\text{e}\text{a}\text{d} \text{l}\text{a}\text{r}\text{v}\text{a}\text{e}}{\text{N}\text{o}. \text{o}\text{f} \text{l}\text{a}\text{r}\text{v}\text{a}\text{e} \text{i}\text{n}\text{t}\text{r}\text{o}\text{d}\text{u}\text{c}\text{e}\text{d}}\)

Histopathology

The treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone) and control larvae of An. stephensi and Cx. quinquefasciatus were performed according to the previously described method (Raymond et al., 2007) with slight modifications. The tissues were fixed in Carnoy 2 (Sigma-Aldrich, India) for 72 hrs. Sequential dehydration was done in the tissue using alcohol viz., 50, 60, 70, 80, 90, and 100% for every 2 hrs. After sequential dehydration, the samples were placed in xylene for 6 hrs and then transferred to a hot air oven with wax for embedding for 2 hrs. After 2 hrs, de-waxing was done with xylene for 5 minutes. Then the tissues were stained with Ehrlich’s hematoxylin and eosin. Finally, the tissues were washed with 100% alcohol. Then the observation was made with the microscope (Motic images plus 2.0 ML, China) connected to a computer and treated and untreated larvae of An. stephensi and Cx. quinquefasciatus were photographed. The larval midgut cells of treated larvae were observed and compared with the control.

Gene Identification And Primer Design

Nucleotide sequences of Wh, GST, CYP50, Est, and Actin genes of An. stephensi and Cx. quinquefasciatus were retrieved from the NCBI database. The primers were designed in the conserved regions of the mosquito nucleotide sequence using the online Primer3 software tool (https://primer3.ut.ee/) (Tables 1, 2).

Table 1

**Details of** An. stephensi **gene specific primers used for qRT-PCR**. The details such as name of the gene, gene ID, forward and reverse primer, and product length with their temperature are provided.
Name of the gene	Forward primer (5’ to 3’)	Reverse Primer (5’ to 3’)	Product length	Tm (˚C)
Wh	CATCAACGGAGCGCTTTTC	GGATAGGTGATCGAGGTGAAC	210	59
CYP 450	ATGCCGAAGGATACCGCCAA	CGTGCGCAGATTGTTCACCA	198	59
EST	CGGGCCGGATTTCTTGGTTC	TTCGGGTCCCTCCAAAGGC	186	59.1
GST	CCAACGCCGACAACGAGAAG	CTTCTTGCACCGCTCCAACC	200	59
ACTIN	ATCGACAATGGGTCGGGCAT	GTCCTTCTGGCCCATTCCGA	126	59
Abbreviations: Wh, white; CYP450, Cytochrome P450 monooxygenase; Est, Esterase; GST, Glutathione transferase.

Table 2

**Details of** Cx. quinquefasciatus **gene specific primers used for qRT-PCR**. The details such as name of the gene, gene ID, forward and reverse primer, and product length with their temperature are provided.
Name of the gene	Forward primer (5’ to 3’)	Reverse Primer (5’ to 3’)	Product length	Tm (˚C)
Wh	CATCAACGGAGCGCTTTTC	GGATAGGTGATCGAGGTGAAC	210	59
CYP 450	ATGCCGAAGGATACCGCCAA	CGTGCGCAGATTGTTCACCA	198	59
EST	CGGGCCGGATTTCTTGGTTC	TTCGGGTCCCTCCAAAGGC	186	59.1
GST	CCAACGCCGACAACGAGAAG	CTTCTTGCACCGCTCCAACC	200	59
ACTIN	ATCGACAATGGGTCGGGCAT	GTCCTTCTGGCCCATTCCGA	126	59
Abbreviations: Wh, white; CYP450, Cytochrome P450 monooxygenase; Est, Esterase; GST, Glutathione transferase.

Rna Extraction And Cdna Synthesis

For gene expression analysis, 12 hrs treated third instar larvae were collected. RNA was extracted using the Nucleospin RNA Plus kit (TAKARA, Japan) in triplicates for each sample from treated ((4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone), negative control (water), and positive controls (Temephos and azadirachtin). The concentration RNA was evaluated via NanoDrop Spectrophotometer (ND-2000, Thermo Scientific, USA). cDNA was synthesized using 500 ng each total RNA sample using QuantiTec reverse transcription kit with genomic DNA wipeout option (Qiagen, USA).

Quantitative Reverse-transcriptase Pcr (Qrt-pcr)

The qRT-PCR was performed utilizing four different gene-specific primers and one reference gene actin for An. stephensi and Cx. quinquefasciatus mosquitoes. For quantification, 10 µL reactions were employed containing 5 µL of SYBR green Master mix (Bio-Rad Laboratories, USA), 1 µL of F & R primer mix (500 nM each primer), and 4 µL of cDNA (1:50 dilution). The qRT-PCR cycling conditions were activation at 95 °C for 30 sec, 35 cycles of denaturation at 95 °C for 5 sec, annealing and extension at 59 °C for 30 sec. Finally, melting curve analysis was included by increasing the temperature from 65 to 95 °C with 0.5 °C increments followed by signal capture. Gene expression profiles were evaluated using the Cycle threshold (Ct) values of the actin gene for all An. stephensi and Cx. quinquefasciatus mosquitoes using the formula 2^−ΔΔCt. Three biological replicates and each consisting of three technical replicates were used for each sample.

Statistical analysis

The observed mortality data were corrected for each concentration of larvicidal using Abbott’s formula (Sakuma 1998) to estimate lethal concentrations (LC₅₀ and LC₉₀). Three replicates were done for each treatment. Data from three replicates in each treatment (n = 3×3 = 9) were expressed as mean ± standard deviation. For RNA isolation and cDNA synthesis, three biological replicates and each consisting of 3 technical replicates were used for each sample. One-way ANOVA was used to determine significant differences among mean values. The data were analyzed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA) and the values were considered as significant at P < 0.05.

Characterization of isolated compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone

Crystallization of the active fraction 4 from hexane gave the active principle (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone as colourless crystals.

Isolation Of Active Constituent (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

The hexane extract of the leaves of B. axillaris 40g was chromatograph over silica gel (acme’s 100–200 mesh) packed in hexane. The column was eluted with hexane-ethylacetate and finally with ethyl acetate. Similar fractions were obtained, the fraction 3 eluted with hexane: ethylacetate 3:1 was found to be an active. The active fractions was dried and washed with acetone-methanol mixture. The residue was subjected to preparative HPLC cosmosil, 5C18-MS- II 250×2.0mm, 50µm, JASCO Gulliver system, gradient elution with acetonitrile-water 40–60%, 15ml/min, 215mm). The compound obtained was dried when a colourless gummy residue was uptained. α-D -193^о (CHCl2) and It analysed for C₁₅H₂₂O₄ by HRESI-MS (m/z).

IR

IR: 𝜈_maxKBr cm⁻¹ 3438 (hydroxyl), 2958, 2873, 1707, (α, β-unsat. ester carbonyl), 1676 (α, β –unsat. Keton carbonyl), 1650 (olefinic), 1458, 1417, 1384 (methyl bending), 1230 (ester C–O str.), 1147, 1083, 948, 928, 849, 761 (olefinic) cm⁻¹ showed in supplementary Fig. S1. The active compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone) was obtained as colourless gummy residues.

HR-ESI-MS gave the molecular formula C₁₅H₂₂O₄ (Fig. S5). The IR spectrum showed hydroxyl (3438 cm^− 1), α, β unsaturated ester carbonyl (1707, 1230 cm^− 1), α, β unsaturated keton carbonyl 1676 cm^− 1, and olefinic fiction (948, 928, 849, 761 cm^− 1).

The NMR spectrum showed (Fig S2) the presence of 4 methyl groups, 2 secondary methyl groups H-9 and H-10 of the isopropyl group at C-3 appeared as 3 proton doublets (J = 6.6 Hz) at δ 1.04 and 0.96. The two trans methyl group of an angelate moiety H-4' and H-5' appeared at δ 4.55 (J = 6.1 and 3.3 Hz) while the adjacent proton H-3 appeared as multiplet δ 1.82. The methylene protons H-2 adjacent to the ketone appeared at δ 2.52 as double doublets (J = 16.5 and 12.1 Hz, H-2 β) and δ 2.55 as a double doublets (J = 16.5 and 4.8 Hz, H-2α). The methylene proton H-7, each appeared as doublets J = 14.9 Hz) due to germinal coupling at δ 4.83 and 4.87. H-3' appeared as dq at δ6.11, J = 5.3 and 1.7 Hz). The broad singlet’s 2.23 are assigned to hydroxyl group; the C¹³ NMR values also confirmed structure of the compounds (Fig. S3 and S4).

The 2-D NMR spectra (COSY, HSQC, HMBC and ROESY) also confirmed the structure. Thus the compound was identified the (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone). The spectral data are comparable with Bhlman et al. (1985) who have isolated the compound from the aerial parts of Blumea mollis (B. axillaris) previously. The compound has also been reported from the essential oil of Laggera alata (D.Don) Sch.Bip. ex Oliv. by GC-MS analysis (Onyayade et al 1990).It can be noted that the corresponding tiglate has also been reported from Blumea mollis by Bohlman et al. 1979. We have reported from anti-plant fungal activity and mosquitocidal activity of both the tiglate and acetate and its acetate (Subramaniyan et al. 2021)

Larvicidal activities of the crude hexane extract of B. axillaris

Fraction-4 crude hexane extract of B. mollis was tested for larvicidal activity against mosquito larvae An. stephensi and Cx. quinquefasciatus. The hexane extract of B. mollis showed good larvicidal activity against An. stephensi and Cx. quinquefasciatus. The LC₅₀ and LC₉₀ values of the extract were recorded as 155.811 and 566.763 ppm respectively against An. stephensi and 77.215, and 99.653 ppm respectively against Cx. quinquefasciatus at 24 hours (Table 3) and azadirachtin used for comparison (Table 4). In negative control (water) no mortality were found and they exhibited active and normal movement.

Table 3

Larvicidal activity (in ppm) of hexane crude extract from *B. axillaris* against *An. stephensi* and *Culex quinquefasciatus*
Mosquito	Treatment	LC₅₀ (ppm)	95% Confidence limit		LC₉₀ (ppm)	95% Confidence limit		Intercept ± SE	Slope ± SE	X²
Mosquito	Treatment	LC₅₀ (ppm)	LL	UL	LC₉₀ (ppm)	LL	UL	Intercept ± SE	Slope ± SE	X²
An. stephensi	B. axillaris hexane crude extract	155.811	126.404	189.720	566.763	414.869	938.129	0.01 ± 0.7	1.6*	155.811
Cx. quinquefasciatus	B. axillaris hexane crude extract	77.215	51.965	99.653	336.656	248.655	566.936	1.2 ± 0.7	2.2*	77.215

Table 4

Larvicidal activities (in ppm) of standard compound Azadirachtin against *An. stephensi* and *Culex quinquefasciatus*
Mosquito	Treatment	LC₅₀ (ppm)	95% Confidence limit		LC₉₀ (ppm)	95% Confidence limit		Intercept ± SE	Slope ± SE	X²
Mosquito	Treatment	LC₅₀ (ppm)	LL	UL	LC₉₀ (ppm)	LL	UL	Intercept ± SE	Slope ± SE	X²
An. stephensi	Azadirachtin	3.64	2.87	3.99	9.91	7.88	14.77	0.6 ± 0.5	1.0 ± 0.1	0.3^*
Cx. quinquefasciatus	Azadirachtin	3.17	2.59	3.65	9.67	7.76	14.10	3.6 ± 0.2	3.0 ± 0.6	0.3^*

Larvicidal Activities Of (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

The compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone was tested for larvicidal activity against An. stephensi and Cx. quinquefasciatus larvae. The compound showed a promising larvicidal activity against 3rd instar larvae of An. stephensi and Cx. quinquefasciatus at 2 ppm concentrations. The LC₅₀ and LC₉₀ values of the compound were recorded as 1.19 and 3.678 ppm, respectively against An. stephensi, and 0.85 and 3.59 ppm respectively, against Cx. quinquefasciatus after 24 hrs of exposure and azadirachtin and temephos were used as positive control for comparison (Tables 5, 6). In negative control (water) no mortality were found and they exhibited active and normal movement.

Table 5

Larvicidal activities (in ppm) of phytocompound against the 3rd instar *An. stephensi* larvae compared with azadirachtin and temephos.
Mosquito	Treatment	LC₅₀ (ppm)	95% Confidence limit		LC₉₀ (ppm)	95% Confidence limit		Intercept ± SE	Slope ± SE	X²
Mosquito	Treatment	LC₅₀ (ppm)	LL	UL	LC₉₀ (ppm)	LL	UL	Intercept ± SE	Slope ± SE	X²
An. stephensi	(4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone	1.19	1.03	1.76	3.678	2.715	6.452	4.6 ± 0.1	2.8 ± 0.4	0.9*
	Azadirachtin	0.34	0.22	0.43	1.04	0.90	1.27	2.6 ± 0.3	6.2 ± 0.1	3.7^*
	Temephos	0.65	0.56	0.73	1.62	1.42	1.93	3.2 ± 0.3	5.5 ± 0.1	1.7^*
LC₅₀ lethal concentration that kills 50% of the exposed larvae, LC₉₀ lethal concentration that kills 90% of the exposed larvae, LL lower limit (95% confidence limit), and UL upper limit (95% confidence limit). ∗𝑃 ≤ 0.05, level of significance of chi-square values.

Table 6

Larvicidal activity (in ppm) of phytocompound against the 3rd instar *Cx. quinquefasciatus* larvae compared with azadirachtin and temephos.
Mosquito	Treatment	LC₅₀ (ppm)	95% Confidence limit		LC₉₀ (ppm)	95% Confidence limit		Intercept ± SE	Slope ± SE	X²
Mosquito	Treatment	LC₅₀ (ppm)	LL	UL	LC₉₀ (ppm)	LL	UL	Intercept ± SE	Slope ± SE	X²
Cx. quinquefasciatus	(4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone	0.85	0.60	1.02	3.59	2.43	8.447	2.1 ± 0.3	5.1 ± 0.1	4.1*
	Azadirachtin	0.28	0.12	0.37	0.55	0.46	0.66	4.3 ± 1.1	7.4 ± 0.3	0.1^*
	Temephos	0.92	0.11	1.66	1.82	1.17	646.1	4.3 ± 0.9	5.1 ± 0.1	2.4^*
LC₅₀ lethal concentration that kills 50% of the exposed larvae, LC₉₀ lethal concentration that kills 90% of the exposed larvae, LL lower limit (95% confidence limit), and UL upper limit (95% confidence limit). ∗𝑃 ≤ 0.05, level of significance of chi-square values.

Ovicidal Activities Of (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

The isolated (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound was tested for ovicidal activity against eggs of An. stephensi and Cx. quinquefasciatus. The ovicidal activities of results are given in Tables 7 and 8. The results showed 84% and 80% of ovicidal activities at 2 ppm against An. stephensi and Cx. quinquefasciatus, respectively. The positive control azadirachtin showed 74% and 18% and temephos showed 54% and 10% of ovicidal activity at 2 ppm concentration against An. stephensi and Cx. quinquefasciatus, respectively. The compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone treated eggs of An. stephensi and Cx. quinquefasciatus were found to be shrunken after 120 hrs post-treatment, and many eggs did not hatch. In water control (negative), most of the eggs hatched.

Table 7

Percent ovicidal activity of (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound against the eggs of *An. stephensi* (Mean ± STD)
Mosquito	Treatment	Concentrations (ppm)
Mosquito	Treatment	0.5	1	1.5	2
An. stephensi	(4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone	23 ± 2.82^b	41 ± 2.82^b	53.8 ± 3.34^b	84.2 ± 3.34^b
	Azadirachtin	32.19 ± 2.21^b	44.47 ± 1.95^b	66.46 ± 1.26^b	74.59 ± 2.38^b
	Temephos	4.7 ± 2.07^d	8 ± 3.18^d	13.79 ± 2.96^d	18.13 ± 2.15^d
Values are mean ± standard deviation (SD). Means are separated by Tukey’s test of multiple comparisons, One-way Analysis of Variance (ANOVA). *p ≤ 0.01, level of significance.

Table 8

**Percent ovicidal activity of** (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone **compound against the eggs of** Cx. quinquefasciatus **(Mean ± STD)**
Mosquito	Treatment	Concentrations (ppm)
Mosquito	Treatment	0.5	1	1.5	2
Cx. quinquefasciatus	(4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone	21.8 ± 1.78^b	33.4 ± 2.19^b	45.6 ± 4.38^b	81.0 ± 2.82^b
	Azadirachtin	16.72 ± 1.12^b	31.56 ± 1.45^b	39.54 ± 1.12^b	54.85 ± 1.17^b
	Temephos	4.84 ± 2.64^d	5.04 ± 2.16^d	8.22 ± 2.02^d	10.44 ± 2.10^d
Values are mean ± standard deviation (SD). Means are separated by Tukey’s test of multiple comparisons, One-way Analysis of Variance (ANOVA). *p ≤ 0.01, level of significance.

Effect Of (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone On Non-target Organisms

The effect of (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone was treated against Poecilia reticulate (guppy fish). The results showed lethal susceptibility at 2 ppm concentration with LC₅₀ = 2.78 and LC₉₀ = 4.81 of P. reticulata. The results were compared with the azadirachtin and temephos positive controls. The azadirachtin and temephos positive controls showed least susceptible of LC₅₀ = 2.34 and LC₉₀ = 3.56 and LC₅₀ = 1.74 and LC₉₀ = 2.36, respectively against P. reticulata non-target organism (Table 9).

Table 9

**Effect of** (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone **(in ppm) on non-target organism**
Non-target organism	Treatment	LC₅₀	LC₉₀
P. reticulata	(4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone	2.78	4.81
	Azadirachtin	2.34	3.56
	Temephos	1.74	2.35
LC₅₀ lethal concentration that kills 50% of the exposed larvae, LC₉₀ lethal concentration that kills 90% of the exposed larva

Histopathology

The An. stephensi and Cx. quinquefasciatus larvae exposed to (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone revealed severe damages in the midgut epithelial columnar cells (CC). The peritrophic membrane (pM) looks completely ruptured on compound treated An. stephensi and Cx. quinquefasciatus larvae while comparing with the control larvae. Further, midget content (MC) of both treated larvae was found to be oozed out compared to control larvae. But, adipose fabric (A.F) and circular muscles (CM) appeared normal (Figs. 1, 2).

Expression patterns of functional genes in An. stephensi larvae treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone and controls

In the gene expression analysis, the An. stephensi larvae was exposed with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound, negative control (water), and positive controls (temephos and azadirachtin) (Fig. 3). The Wh gene was found to be upregulated in the An. stephensi larvae treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound when compared to the positive control azadirachtin and temephos. The Wh gene of An. stephensi larvae exposed to positive controls (temephos and azadirachtin) showed similar downregulation. The Wh gene was found to be upregulated in the An. stephensi larvae treated with negative control (water) (Fig. 3). Interestingly, GST gene was found to be upregulated in the An. stephensi larvae treated with negative control water than the other An. stephensi larvae exposed with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound and positive controls (temephos and azadirachtin). The expression level of the GST gene in the An. stephensi larvae treated with temephos showed two-fold higher expression than that in An. stephensi larvae treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound (Fig. 3). The GST gene was found to be downregulated in the An. stephensi larvae treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone (Fig. 3). The CYP50 gene was found to be downregulated in the An. stephensi larvae treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound while comparing with the An. stephensi larvae treated with positive control temephos. The CYP50 gene was found to be downregulated in the An. stephensi larvae treated with positive control azadirachtin. The CYP50 gene was found to be upregulated in the An. stephensi larvae treated with negative control water (Fig. 11). Interestingly, the EST gene was not expressed in the An. stephensi larvae treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound. The EST gene of An. stephensi larvae treated with positive control temephos and negative control water showed upregulation. The EST gene was found to be downregulated in the An. stephensi larvae treated with positive control azadirachtin (Fig. 3).

Expression patterns of functional genes in Cx. quinquefasciatus larvae treated with compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone and controls

In the gene expression analysis, Cx. quinquefasciatus larvae was exposed with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound, negative control (water), and positive controls (temephos and azadirachtin) (Fig. 4). The Wh gene was found to be two-fold upregulated in the Cx. quinquefasciatus larvae treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound than the positive control azadirachtin, temephos, and water. The Wh gene of Cx. quinquefasciatus larvae exposed to positive controls (temephos and azadirachtin) showed similar downregulation. The Wh gene was found to be upregulated in the Cx. quinquefasciatus larvae treated with negative control water than the Wh gene of An. stephensi larvae exposed to positive controls (temephos and azadirachtin) (Fig. 4). Interestingly, the GST, CYP50, and EST genes did not express in the Cx. quinquefasciatus larvae exposed to (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound. The GST gene in the Cx. quinquefasciatus larvae treated with positive control temephos and negative control water showed similar upregulation. The GST gene in the Cx. quinquefasciatus larvae treated with positive control azadirachtin was found to be downregulated (Fig. 4). The CYP50 gene in the Cx. quinquefasciatus larvae treated with positive control temephos and negative control water showed similar upregulation. The CYP50 gene in the Cx. quinquefasciatus larvae treated with positive control azadirachtin was found to be downregulated (Fig. 4). The EST gene in the Cx. quinquefasciatus larvae treated with positive control temephos and negative control water showed similar upregulation. The EST gene in the Cx. quinquefasciatus larvae treated with positive control azadirachtin was found to be downregulated (Fig. 4).

India has a great wealth of many naturally occurring plant bioactive compounds, which have great potential for insecticidal properties. Numerous plant compounds have been identified as natural insecticides against vector-borne mosquitoes. The plant extracts and plant phytocompounds are easy to use, free of risk, cost-effective products in controlling vector-borne mosquitoes and vector-borne diseases.

In the present study, the fraction 4, which was isolated from the hexane extract of B. axillaris was found to be the most effective treatment against An. stephensi and Cx. quinquefasciatus. The LC₅₀ and LC₉₀ values of the fraction-4 hexane extract were recorded as 155.811 and 566.763 ppm, respectively against 3rd instar larvae of An. stephensi, and 77.215 and 99.653 ppm, respectively against 3rd instar larvae of Cx. quinquefasciatus.

Our study revealed that the isolated compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone from B. axillaris exhibited the lowest LC₅₀ value of 1.19 and LC₉₀ value of 3.678 against the 3rd instar An. stephensi larvae. The isolated compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone exhibited the lowest LC₅₀ value of 0.85 and LC₉₀ value of 3.59, against the 3rd instar Cx. quinquefasciatus larvae. This result was compared with our previous study of isolation of monoterpein ester from B. axillaris identified as (4R, 5S)-4-hydroxy-7-tigloyloxy carvotanacetone and converted into acetyl derivative, that is (4R, 5S)-4-acetoxy-7-tigloyloxy carvotanacetone. These compound showed good larvicidal activity against Cx. quinquefasciatus larvae. The observed LC₅₀ and LC₉₀ values of compounds 1 and 2 on Cx. quinquefasciatus larvae were 1.73, 1.27 and 4.59, 3.33 ppm mortality in 24 h, respectively (Subramaniyan et al. 2021). This result was also compared with the previous report by Xiao et al. (2012). They reported that the lignan compound isolated from the Phryma leptostachya plant exhibited LC₅₀ values of 1.21 and LC₉₀ of 4.2 against the Cx. pipiens (Xiao et al., 2012).

Compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone from B. axillaris showed better ovicidal activity of 84%, 80% against an eggs of An. stephensi and Cx. quinquefasciatus, respectively than the positive control temephos and azadirachtin at 2 ppm concentration. Similarly, the compound (4R, 5S)-4-hydroxy-7-tigloyloxy carvotanaceto and synthesized compound (4R, 5S)-4-acetoxy-7-tigloyloxy carvotanacetone from our previous study exhibited 68% and 77% ovicidal activity against eggs of Cx. quinquefasciatus at 120 h post-treatment. This result was also compared with the previous result published by Suman et al., 2013. The isolated compound pyriproxyfen and diflubenzuron showed only 47.3% and 25.5% ovicidal activity against Ae. aegypti mosquitoes (Suman et al. 2013). Overall, the activity of (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone showed better activity at 2 ppm concentration against An. stephensi and Cx. quinquefasciatus when compared to temephos and azadirachtin (Tables 7 and 8). These overall studies,

Previous results have reported that the compounds derived from the plant source produce damages in the midgut cells of mosquito larvae. In the present study, we use the (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone treated An. stephensi and Cx. quinquefasciatus larvae for histopathology. The results revealed serious damages in the midgut cells of the treated larvae (Figs. 1 and 2). Previously, several isolated compounds from plants like nilocotin, triterpenoid, and limonoids revealed severe damages in the midgut cells of targeted vector-borne mosquitoes (Schmutterer and Ascher 1987; Reegan et al. 2014). Further, the current results showed (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone is safe for non-target organism P. reticulata. The compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone is non-toxic, up to the tested concentration of 2 ppm. The P. reticulata showed normal movement (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound, azadirachtin, and temephos. From the result, we suggest that the isolated compound can be used without harming P. reticulata predators in Integrated Mosquito Management (IMM).

In this study, we used isolated compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone, positive controls (temephos and azadirachtin), and negative control (water) against the 3rd instar larvae of An. stephensi and Cx. quinquefasciatus and analyzed the influence of novel compound on the expression of functional genes in both An. stephensi and Cx. quinquefasciatus 3rd instar larvae, which was not reported before. The Wh gene that we targeted plays a classical role in eye pigmentation (Anaka et al. 2008; Xiao and Robertson 2017). No early reports have been reported for this white gene. The Wh gene encodes the ATP-binding cassette (ABC) transporter. Our results revealed upregulation of the genes for both An. stephensi and Cx. quinquefasciatus, which would block ATP-binding transporters and make mosquitoes to lose its pigment cells in the eyes. CYP50 gene is a most important gene that enhances resistance in mosquitoes to digest the pesticides. Xu et al. (2005) reported that the CYP50 gene is an important permethrin resistance property in An. gambiae and Cx. quinquefasciatus mosquitoes (Xu et al. 2005). In the resistance-developed mosquitoes against permethrin, CYP50 gene was found to be downregulation. Downregulation of CYP450 genes linked to the homeostatic response and the upregulation of CYP450 involved in the synthesis of protein for energy and oxygen (Xu et al. 2005). Our result showed downregulation in the expression level of CYP50 gene in An. stephensi mosquitoes when exposed to the novel compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone. Whereas, CYP50 gene in Cx. quinquefasciatus did not show any expression. Therefore, we conclude that our isolated compound has the capability to make changes in homeostatic responses of the mosquitoes. Ransen et al. (2001) reported the expression of GST gene in An. gambiae mosquitoes exposed to insecticide resistance (Ranson et al., 2001). They reported that totally three GST genes (aggst-8, aggst-9, and aggst-10) were responsible for the insecticide resistance when mosquito exposed to the DDT insecticides (Ranson et al., 2001). In 2003, Ortelli et al. found that the GST gene is responsible for the resistance in malarial vector when An. stephensi exposed to the 1,1,1-tricholoro-2, and 2-bis-(p-chlorophenyl) ethane (Ortelli et al. 2003). Therefore, our expression analysis of GST gene in the An. stephensi and Cx. quinquefasciatus larvae treated with (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound clearly showed that it would create a heritable change in the An. stephensi and Cx. quinquefasciatus. Paton et al. (2000) found that the expression of the EST gene present in the mosquitoes develop their own resistance when mosquitoes exposed to the organophosphorus-mediated insecticide (Paton et al., 2000). However, there is no expression pattern found when An. stephensi and Cx. quinquefasciatus larvae exposed to the (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone compound.

Overall, these studies, proved for the first time that the 4-hydroxycarvotanacetone (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone isolated from B. axillaris plant having good mosquitocidal properties.

Over the past decades, insecticides have been extensively utilized against vector-borne mosquitoes. In this chapter, the compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone derived from B. axillaris showed good larvicidal, ovicidal activities against An. stephensi and Cx. quinquefasciatus. The compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone did not affect the non-target organisms. Overall, our results clearly revealed that (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone from B. mollis plant have the most effective treatment against the An. stephensi and Cx. quinquefasciatus.

Author contribution

S.A.C., S.S., V.E.H., K.B., planned and designed the article; V.E.H., and S.S., wrote the article; S.A.C., S.S., and K.B. edited and revised the article.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

Not applicable

Declaration of competing interest

The authors declare no conflict of interest.

Acknowledgements

The authors are thankful to Entomology Research Institute, Loyola College, Chennai, Tamil Nadu, India for financial assistance and for providing laboratory facilities. The authors are partially supported for the instrument facility; Laboratory of Pharmacognosy and Natural Products Chemistry, Kagawa School of Pharmaceutical Sciences, Tokushima Bunri University, Japan and Department of Chemistry, Bioscience Research Foundation, Kandamangalam, Kanchipuram District, Tamil Nadu, India

Data accessibility

This article did not use any field or experimental data that can be archived.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Abbott WS (1925) A method of computing the effectiveness of an insecticide. J econ Entomol 18:265–267
Amer A, Mehlhorn H (2006) Repellency effect of forty-one essential oils against Aedes, Anopheles, and Culex mosquitoes. Parasitol Res 99:478–490
Anaka M, MacDonald CD, Barkova E, et al (2008) The white gene of Drosophila melanogaster encodes a protein with a role in courtship behavior. J Neurogenet 22:243–276
Anstrom DM, Zhou X, Kalk CN, et al (2012) Mosquitocidal properties of natural product compounds isolated from Chinese herbs and synthetic analogs of curcumin. J Med Entomol 49:350–355
Bohlmann F, Zdero C, Nair AGR (1979) A new carvotanacetone derivative from Blumea wightiana [aerial parts]. Phytochemistry
Cecilia D (2014) Current status of dengue and chikungunya in India. WHO South-East Asia J public Heal 3:22
Cecilia KF, Ravindhran R, Gandhi MR, et al (2014) Larvicidal and pupicidal activities of ecbolin A and ecbolin B isolated from Ecbolium viride (Forssk.) Alston against Culex quinquefasciatus Say (Diptera: Culicidae). Parasitol Res 113:3477–3484
Govindarajan M, Jebanesan A, Pushpanathan T (2008) Larvicidal and ovicidal activity of Cassia fistula Linn. leaf extract against filarial and malarial vector mosquitoes. Parasitol Res 102:289–292
Hillary VE, Ceasar SA (2021) Genome engineering in insects for the control of vector borne diseases
Hillary VE, Ceasar SA, Ignacimuthu S (2020) Genome engineering in insects: focus on the CRISPR/Cas9 system. In: Genome Engineering via CRISPR-Cas9 System. Elsevier, pp 219–249
Khan S, Guo L, Maimaiti Y, et al (2012) Entomopathogenic fungi as microbial biocontrol agent. Mol Plant Breed 3:
Kumar PM, Murugan K, Kovendan K, et al (2012) Mosquitocidal activity of Solanum xanthocarpum fruit extract and copepod Mesocyclops thermocyclopoides for the control of dengue vector Aedes aegypti. Parasitol Res 111:609–618
Liu H, Xu Q, Zhang L, Liu N (2005) Chlorpyrifos resistance in mosquito Culex quinquefasciatus. J Med Entomol 42:815–820
Medlock JM, Hansford KM, Schaffner F, et al (2012) A review of the invasive mosquitoes in Europe: ecology, public health risks, and control options. Vector-borne zoonotic Dis 12:435–447
Organization WH (2013) Larval source management: a supplementary malaria vector control measure: an operational manual
Organization WH (2005) Guidelines for laboratory and field testing of mosquito larvicides. World Health Organization
Ortelli F, Rossiter LC, Vontas J, et al (2003) Heterologous expression of four glutathione transferase genes genetically linked to a major insecticide-resistance locus from the malaria vector Anopheles gambiae. Biochem J 373:957–963
PATON MG, KARUNARATNE SHPP, GIAKOUMAKI E, et al (2000) Quantitative analysis of gene amplification in insecticide-resistant Culex mosquitoes. Biochem J 346:17–24
RANSON H, ROSSITER L, ORTELLI F, et al (2001) Identification of a novel class of insect glutathione S-transferases involved in resistance to DDT in the malaria vector Anopheles gambiae. Biochem J 359:295–304
Raymond, Faye O, Ndiaye M, et al (2007) Toxic effects of neem products (Azadirachta indica A. Juss) on Aedes aegypti Linnaeus 1762 larvae. African J Biotechnol 6:
Reegan AD, Gandhi MR, Paulraj MG, et al (2014) Effect of niloticin, a protolimonoid isolated from Limonia acidissima L.(Rutaceae) on the immature stages of dengue vector Aedes aegypti L.(Diptera: Culicidae). Acta Trop 139:67–76
Sakuma M (1998) Probit analysis of preference data. Appl Entomol Zool 33:339–347
Schmutterer H (1990) Properties and potential of natural pesticides from the neem tree, Azadirachta indica. Annu Rev Entomol 35:271–297
Schmutterer H, Ascher KRS (1987) Natural pesticides from the neem tree (Azadirachta indica A. Juss) and other tropical plants. GTZ
Senthilkumar A, Kannathasan K, Venkatesalu V (2008) Chemical constituents and larvicidal property of the essential oil of Blumea mollis (D. Don) Merr. against Culex quinquefasciatus. Parasitol Res 103:959–962
Shaalan EA-S, Canyon DV, Younes MWF, et al (2005) Effects of sub lethal concentrations of synthetic insecticides and Callitris glauscophylla extracts on the development of Aedes aegypti. J Vector Ecol 30:295–298
Sivanandhan S, Ganesan P, Jackson A, et al (2018) Activity of some medicinal plants against phytopathogenic fungi. Int J Sci Res Biol Sci 5:5
Sivanandhan S, Pathalam G, Antony S, et al (2021) Effect of monoterpene ester from Blumea axillaris (Lam.) DC and its acetyl derivative against plant pathogenic fungi and their in silico molecular docking. Nat Prod Res 35:5744–5751
Sivanandhan S, Pathalam G, Antony S, et al (2020) Effect of monoterpene ester from Blumea axillaris (Lam.) DC and its acetyl derivative against plant pathogenic fungi and their in silico molecular docking. Nat Prod Res 1–8
Sreelekha KP, TP AK, TP AK, et al (2017) Pharmaco-chemical characterization of leaves of Blumea mollis (D. Don) merr. from Western Ghats of wayanad region of Kerala, India. J Pharmacogn Phytochem 6:319–323
Subramaniyan S, Pathalam G, Antony S, et al (2021) Mosquitocidal effect of monoterpene ester and its acetyl derivative from Blumea mollis (D. Don) Merr against Culex quinquefasciatus (Diptera: Culicidae) and their insilico studies. Exp Parasitol 223:108076
Suman DS, Wang Y, Bilgrami AL, Gaugler R (2013) Ovicidal activity of three insect growth regulators against Aedes and Culex mosquitoes. Acta Trop 128:103–109
Wang S, Jacobs-Lorena M (2013) Genetic approaches to interfere with malaria transmission by vector mosquitoes. Trends Biotechnol 31:185–193
Xiao C, Robertson RM (2017) White-cGMP interaction promotes fast locomotor recovery from anoxia in adult Drosophila. PLoS One 12:e0168361
Xiao X, Hu Z, Shi B, et al (2012) Larvicidal activity of lignans from Phryma leptostachya L. against Culex pipiens pallens. Parasitol Res 110:1079–1084
Xu Q, Liu H, Zhang L, Liu N (2005) Resistance in the mosquito, Culex quinquefasciatus, and possible mechanisms for resistance. Pest Manag Sci Former Pestic Sci 61:1096–1102

No competing interests reported.

Effect of (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone from Blumea axillaris (Lam.) DC. plant against An. stephensi and Cx. quinquefasciatus vector mosquitoes (Diptera: Culicidae) and expression of different functional genes

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Plant collection and identification

Preparation Of Crude Extract

Mosquito Larvae Rearing

Chemicals And Instruments

Isolation Of The Active Constituent

Purification Of Active Principle By Preparatory Hplc

Larvicidal Assay Using (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

Ovicidal Assay Using (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

Effect Of Isolated Compounds On Non-target Organisms

Histopathology

Gene Identification And Primer Design

Rna Extraction And Cdna Synthesis

Quantitative Reverse-transcriptase Pcr (Qrt-pcr)

Statistical analysis

Results

Characterization of isolated compound (4R, 5S) 4-hydroxy-7-angeloyloxycarvatoneacetone

Isolation Of Active Constituent (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

IR

Larvicidal Activities Of (4r, 5s) 4-hydroxy-7-angeloyloxycarvatoneacetone

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1