Preliminary study of LACTB transcript 1 inhibiting gastric cancer cell migration and invasion by regulating autophagy

doi:10.21203/rs.3.rs-2478543/v1

Download PDF

Research Article

Preliminary study of LACTB transcript 1 inhibiting gastric cancer cell migration and invasion by regulating autophagy

https://doi.org/10.21203/rs.3.rs-2478543/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose: To analyze the expression level of β-lactamase gene (LACTB) in gastric cancer cells and the main types of transcripts expressed, and then explore the effect and mechanism of LACTB transcripts on the biological function of gastric cancer cells.

Methods: The expression level of LACTB and the main biological processes involved were analyzed by bioinformatics analysis and RT-qPCR. The expression level of LACTB transcript 1 was overexpressed or knocked down in AGS and HGC-27 cells, and the effect and mechanism of LACTB on gastric cancer cell migration and invasion were verified by in vitro cell experiments and western blotting experiments.

Results: 1.The UALCAN analysis website showed that LACTB mRNA was highly expressed in gastric cancer tissue, and the expression level of LACTB transcript 1 in peripheral blood of gastric cancer patients was consistent with the bioinformatics analysis. LinkedOmics and DAVID enrichment analysis found that LACTB co-expressed genes were mainly involved in biological processes such as immune response, inflammatory response, and proteolysis through lysosomes and immune synapses. 2.Knocking down the expression level of LACTB transcript 1 can inhibit the migration and invasion ability of gastric cancer cells, and at the same time can activate autophagy and inhibit EMT. However, overexpression of LACTB transcript 1 resulted in the opposite.

Conclusions: LACTB transcript 1 is an inhibitor that regulates autophagy to inhibit the migration and invasion of gastric cancer cells, and is highly expressed in peripheral blood, which has the potential as a biomarker of gastric cancer.

Gastric cancer

β-lactamase gene

epithelial-mesenchymal transition

autophagy

Gastric cancer is one of the cancers of high concern in the world. According to statistics in 2020, there are nearly 1.09 million new cases of gastric cancer worldwide, and it ranks fifth in the world in incidence and fourth in mortality[1]. The occurrence of gastric cancer is closely related to family history, diet, drinking, smoking, Helicobacter pylori, and EB virus infection[2]. At present, gastric cancer is mainly treated by surgery, supplemented by neoadjuvant chemotherapy, and has significant clinical efficacy[3]. However, the survival rate of advanced gastric cancer has not been significantly improved. The important reason for treatment failure is mostly cancer cell metastasis and the migration and invasion of gastric cancer are related to genetic genes. Therefore, it is still urgent to explore new gene markers and discover their effects and mechanisms on the biological function of gastric cancer cells for the diagnosis and treatment of gastric cancer.

LACTB is a new tumor-related gene discovered in recent years. LACTB is widely distributed in a variety of human tissues[4] and localized in the mitochondrial intermembrane space, it can affect the flux of metabolites at specific sites in the metabolic network[5]. Studies have shown that LACTB is closely related to tumors and can interfere with the proliferation and differentiation of cancer cells by regulating mitochondrial lipid metabolism through mitochondrial phosphatidylserine decarboxylase[6]. Its upstream can be regulated by microRNA, and its downstream can play a functional role by regulating MCP-1, P53, PCNA, MMP9, MMP2 and VEGF[7–10]. Early studies have shown that LACTB is downregulated in hepatocellular carcinoma[11], breast cancer[8], colorectal cancer[9, 12, 13], glioma [10], and melanoma[14]. Inducing the overexpression of LACTB in the above tumors can inhibit the invasion, migration and proliferation of tumor cells and act as a tumor suppressor. However, in recent years, studies have pointed out that the expression level of LACTB is up-regulated in nasopharyngeal carcinoma[15] and pancreatic cancer[16], and it can promote the ability of cancer cell invasion, migration and proliferation. The above studies suggest that the expression and mechanism of LACTB in different tumors are varied.

The previous enrichment analysis of LACTB-related genes suggested that LACTB is closely related to the function of lysosome, which is the center of autophagy[17]. Autophagy is a tightly coordinated process that disposes of damaged or aged organelles, misfolded proteins, and pathogens through lysosomes[18]. Furthermore, autophagy may play a role in regulating nuclear events that maintain genome stability[19]. In tumor microenvironment, LACTB can also inhibit pro-tumor inflammatory signals and enhance the anti-cancer immunity of myeloid cells to play an anti-tumor effect[20]. However, during metabolic stress, autophagy can promote the occurrence and development of tumors by providing nutrients to malignant tumor cells to maintain tumor cell survival[21–23]. Therefore, autophagy can not only attenuate the proliferation, migration and invasion of gastric cancer cells[24], but also induce autophagic cell death to inhibit tumor development[25] Other studies have shown that there is a crosstalk between autophagy and epithelial-mesenchymal transition (EMT) in tumor cells, which also has dual effects on EMT[26]. On the one hand, autophagy inhibitors can inhibit EMT in renal cancer cells[27]; on the other hand, induction of up-regulation of autophagy levels can reduce the expression of EMT phenotype in glioblastoma cells[28]. Therefore, changes in autophagy levels may accompany the development of EMT in cancer cells. EMT plays an important role in the migration and invasion of tumor cells [29, 30] and is generally considered to be an early key event that induces tumor invasion and metastasis[29–31]. When EMT occurs in cancer cells, cell adhesion molecules (such as E-cadherin) are down-regulated, and stromal markers (such as Vimentin and N-cadherin) are up-regulated, causing cell migration and invasion[32], which in turn promotes local invasion, intravasation, extravasation of the systemic circulation of tumor cells, and eventually establish early metastatic colonies to other sites [33]. A large number of studies have confirmed that EMT is closely related to the metastasis of gastric cancer, and can enhance the migration ability of gastric cancer cells by inducing the high expression of NFE2L3[34]or PADI4[35].

In conclusion, LACTB may affect the EMT of tumor cells by regulating autophagy, and further affect the migration and invasion ability of gastric cancer cells. Therefore, the effect of LACTB on the expression levels of autophagy and EMT key proteins in gastric cancer cells was examined by constructing a gastric cancer cell model with LACTB overexpression or knockdown. To further explore the mechanism of LACTB-mediated autophagy involved in the EMT of gastric cancer cells.

Cell Culture

Human gastric cancer cell lines GES-1, AGS, and HGC-27 were purchased from the Cell Bank of the Chinese Academy of Sciences. All cells were cultured in complete medium containing 10% fetal bovine serum (Gibco, USA) under 5% CO2 at 37°C. The cell growth state was observed under an inverted microscope, and the cells were passaged every 2-3 days, and the cells in the logarithmic growth phase were collected for the experiment.

Bioinformatics analysis

Query the information related to LACTB (GeneID: 114294) on NCBI, and conduct a preliminary analysis of its sequence. The expression of LACTB total mRNA in gastric cancer tissues was analyzed by using Oncomine and UALCAN analysis websites. LACTB-related differentially expressed genes were analyzed using the LinkFinder module of LinkedOmics, and GO and KEGG enrichment analysis was performed with DAVID.

Design of specific primers for LACTB gene

By querying the information related to LACTB (GeneID: 114294) through NCBI, it can be seen that LACTB has 7 exons and 3 standard mRNAs annotated as NM sequences: transcript 1 (V1, NM_032857.5) transcript 2 (V2, NM_171846 .4) and transcript 3 (V3, NM_001288585.2), 2 non-coding mRNAs annotated as XR sequences: XR1 (XR_931745.2) and XR2 (XR_429442.2). A reverse primer can be designed at the unique exon 6 of transcript 1. The primers used in RT-qPCR experiments are shown in table 1.

Table 1 Primer sequences for RT-qPCR

Name	Primer sequence
LACTB transcript variant 1	F1092	CAGGAAGAAAACGAGCCAGTG
LACTB transcript variant 1	R1230	GGTCACCCACTGTAGACAGAA
LACTB transcript variant 2	F945-2	CCTTTGTTCTTCAAACCTGGTAG
LACTB transcript variant 2	R1158	GCTAGACACAGCAGAAGGTA
LACTB transcript variant 3	F945-3	CCTTTGTTCTTCAAACCTGTCA
LACTB transcript variant 3	R1158	GCTAGACACAGCAGAAGGTA
HPRT	F148	ATGGCGACCCGCAGCCCT
HPRT	R266	CCATGAGGAATAAACACCCT

Real-time fluorescent quantitative PCR reaction

Total RNA was extracted from gastric cancer cell lines and peripheral blood samples with UNlQ-10 column Trizol total RNA extraction kit (Sangon Biotech, B511321-0100) according to the reagent instructions and reverse transcribed into cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser (Tarakra, RR047A). cDNA was analyzed by RT-qPCR using TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (Tarakra, RR820A). HPRT was used as an internal reference when determining the relative expression level of LACTB. The data were analyzed by the 2^-ΔΔCtmethod to analyze the relative expression of the target gene.

Western blotting

Add 80 μl PMSF-containing lysis buffer to each well of the 6-well plate, and lyse the cells on ice for 30 min to extract total protein. The protein concentration was determined using the BCA kit (Solarbio). During SDS-PAGE electrophoresis, the total mass of protein loaded in each well was 30µg. The corresponding protein was detected with a specific primary antibody, and the image was acquired with a Bole blot exposure apparatus. Finally, the integrated optical density value of the protein band was determined using the image J analysis software. The GAPDH protein band was also detected in each sample as an internal control. The following primary antibodies were used in the experimental procedure: N-Cadherin(13116T), Snail(3879T), Vimentin(5741T), LC3A/B(4108S), Atg5(12994T), Atg12(2011), p-mTOR(5536T), p-ULK1(14202T) were purchased from Cell Signaling T echnology,and SQSTM1/p62(ab109012), Beclin-1(ab210498), LACTB(ab131171) were purchased from Abcam.

Overexpression of lentiviral vector to construct LACTB overexpression stable strain

The target gene LACTB transcript 1 (NM_032857.5) was ligated into the vector Ubi-MCS-SV40-EGFP-IRES-puromycin (accession GV367, Gene Kai). AGS and HGC-27 gastric cancer cell lines were infected with LACTB overexpressing lentivirus and empty vector virus to construct HGC-27 empty cell line (HGC-27-Vector) and HGC-27LACTB overexpressing stable strain (HGC-27-LACTB) , AGS empty cell line (AGS-Vector) and AGS-LACTB overexpression stable strain (AGS-LACTB). Puromycin (2 μg/ml) was added for selection to obtain cells with 100% infection efficiency.

RNAi lentiviral vector to construct LACTB knockdown stable strain

The siRNA sequence(LACTB-RNAi-67213-1:GAGCAGGAGAATGAAGCCAAA) of LACTB transcript 1 (NM_032857.5) was ligated into the vector hU6-MCS-CBh-gcGFP-IRES-puro-mycin (number GV493, Jikai gene), and infected AGS cells to construct AGS cell LACTB knockdown strain (AGS-sh-LACTB) and AGS empty vector stable strain (AGS-Vector-shRNA). Puromycin (2 μg/ml) was added for selection to obtain cells with 100% infection efficiency.

Wound Healing Experiment

Seed in 6-well culture plates at a density of 8 × 10⁵ cells per well. Incubate for 24 hours in medium containing 10% fetal bovine serum. Using a 200 µl pipette tip to create a "cross"-shaped scratch on the cell surface of the dish, then aspirate the old medium and add medium containing 1% fetal bovine serum. Then cultured in a 5% CO2 incubator at 37°C, and collected images (100×) at 0 h, 24 h, and 48 h to calculate the width of the track, and calculate the scratch healing rate by Image J.

Cell Invasion/Migration Experiment

The pre-cooled 1640 medium was diluted with a 1:8 dilution ratio of Matrigel (Corning Costar, USA), and 60 μl was added to the upper chamber to solidify, and then the excess or uncoagulated gel was removed. Adding 200 μl of cell suspension to the upper chamber contains 80,000 cells. Adding 750 μL of medium containing 20% FBS to the lower chamber (the medium containing 10% FBS was used for migration experiments, and the chamber was not coated with matrigel). Incubate for a certain time in a 37°C, 5% CO2 incubator. Cells were first fixed with 4% paraformaldehyde for 30 minutes. Then stained with 0.1% crystal violet for 10 minutes, wiped off the cells on the upper layer of the filter membrane with a cotton swab, and left to dry naturally. The cells in the lower layer of the filter were observed under a microscope, and 5 different fields of view were randomly selected to collect photos (200X) and counted to obtain the average value. AGS cells in the LACTB overexpression group were incubated at 37°C for 24 hours in the invasion assay and 20 hours in the migration assay; the AGS cell LACTB knockdown group was incubated at 37°C for 30 hours in the invasion assay and 24 hours in the migration assay; HGC-27 cells in LACTB overexpression group were incubated at 37°C for 48h in the invasion assay and 30h in the migration assay.

Transmission Electron Microscopy (TEM)

When the cells are 80% full in the culture flask, the culture medium is dropped, the electron microscope fixative is added, and the cells are fixed at 4°C for 2-4 hours. The cells were centrifuged at low speed to obtain mung bean-sized cell clumps, which were then pre-embedded with 1% agarose, post-fixed with 1% osmic acid for 2 hours, dehydrated with alcohol at room temperature, embedded with acetone , and 812 embedding medium, and polymerized in an oven at 60 °C 48 hours. Ultramicrotome slices are 60-80 nm thick. Uranium-lead double staining (2% uranyl acetate saturated alcohol solution, lead citrate, each staining for 15 minutes), sections were dried overnight at room temperature. Observed under a transmission electron microscope, collected images for analysis.

Statistical analysis

SPSS.19.0(SPSS, Chicago, USA) and Graphpad Prism.8.0 were used for data analysis. When the measurement data conformed to a normal distribution, grouped independent samples t-test was used, and it was expressed as mean ± standard deviation (); P<0.05 was considered to be statistically significant.

Bioinformatics analysis of LACTB

The data of 449 specimens from TCGA were queried through the Ualcan bioinformatics analysis website, including 34 normal controls and 415 gastric cancer patients. Data analysis showed that the expression level of LACTB mRNA in gastric cancer tissues was higher than that in normal controls (P<0.001)(Fig.1a). The functional modules of LinkedOmics were used to analyze the co-expressed genes of LACTB in gastric cancer. The results are shown in the volcano plot (Fig.1b). The genes with statistically significant differences in expression were selected for enrichment analysis. The GO enrichment analysis results showed that LACTB-related genes were mainly located. In lysosomes, immune synapses, cell membranes, and other cellular structures (Fig.1c). It can participate in the formation of some proteasome complexes and exert molecular functions through its receptor activity, chemokine activity, and binding properties to proteins and carbohydrates (Fig.1d). It is ultimately involved in biological processes such as immune response, inflammatory response, cell adhesion, signal transduction, and proteolysis (Fig.1e).KEGG pathway analysis showed that LACTB-related genes were mainly involved in lysosome, proteasome, phagosome and some cytokine signaling pathways (Fig.1f).

Expression and diagnostic value of different transcripts of LACTB in peripheral blood of gastric cancer

The venous peripheral blood of 93 gastric cancer patients and 82 healthy controls were collected to extract RNA to detect the expression levels of different transcripts of LACTB. In the venous peripheral blood of gastric cancer patients, the expression level of LACTB transcript 1 was higher than that in the venous peripheral blood of the physical examination population (P<0.05)(Fi.2a); the mRNA quantitative detection results of LACTB transcripts 2 and 3 were negative. At the same time, the results of the ROC curve analysis of LACTB transcript 1 showed that the AUC of LACTB transcript 1 (AUC=0.6221, 95% CI: 0.5383 ~0.7059) was greater than 0.5 (Fig.2b), the maximum Youden index was 0.2865, and the corresponding cut-off value was 1.365, the sensitivity was 0.5914, and the specificity was 0.6951. The above results suggest that LACTB transcript 1 is mainly expressed in the peripheral blood of patients with gastric cancer, and its expression level has a certain diagnostic value for gastric cancer. Therefore, the follow-up experiments mainly changed the expression level of transcript 1 to explore its effect and mechanism on the biological function of gastric cancer cells.

Construction of LACTB transcript 1 overexpressed stable transgenic strain and LACTB knockdown stable transgenic strain

Taking the gastric mucosal cell line GES-1 as the control, LACTB transcript 1 was highly expressed in the gastric cancer cell line AGS and was lowly expressed in the undifferentiated gastric cancer cell line HGC-27 (P<0.05)( Fig.3a). AGS and HGC-27 gastric cancer cell lines were infected with lentivirus overexpressing LACTB transcript 1 to construct stable overexpression strains of AGS and HGC-27. The corresponding empty cell lines were constructed using Vector1 empty vector. In addition, RNAi lentiviral vector was used to interfere with the expression level of LACTB in AGS, of which LACTB-RNAi(67213-1) had the most significant knockdown effect. Thus, a stable LACTB knockdown strain was constructed, and Vector 2 was used to construct the corresponding empty cell line. Validation at the mRNA and protein levels indicated that the stable transgenic strain was successfully constructed (P<0.05)( Fig.3b and 3d).

The effect of LACTB on the migration and invasion ability of gastric cancer cells

Transwell migration assay and wound healing assay were used to analyze the effect of LACTB on the migration ability of gastric cancer cells. At the same time, Matrigel was placed on the basement membrane of the transwell chamber to simulate the human basement membrane to detect the effect of LACTB on the invasion ability of gastric cancer cells. The results showed that HGC-27 and AGS cells overexpressing LACTB had significantly higher numbers of cells passing through the bottom membrane and basement membrane of the chamber than the control group (P<0.001)(Fig.4a-d). And the wound healing rate at 48 hours was higher than the corresponding empty vehicle group (P<0.001)(Fig.4e-f). When the expression level of LACTB was reduced in AGS cells, the number of cells passing through the basement membrane and the wound healing rate was significantly lower than those in the control group (P < 0.001)(Figure 4a-f). It is suggested that reducing the expression of LACTB can inhibit the migration and invasion ability of gastric cancer cells.

The effect of LACTB on EMT of gastric cancer cells

The effect of LACTB on the EMT process of gastric cancer cells was detected by Western-Blot. Compared with the corresponding empty vector cells, the expression levels of epithelial marker E-cadherin in HGC-27 and AGS overexpressing LACTB decreased, while the expression levels of mesenchymal cell markers N-cadherin, Vimentin, and transcription factor Snail increased (P<0.05)(Fig. 5). Compared with empty vector cells, AGS-sh-LACTB showed increased E-cadherin expression, enhanced cell adhesion, and decreased N-cadherin, Vimentin, and Snail expression levels (P<0.05)(Fig.5). Among them, Vimentin showed the most significant difference. It is suggested that reducing the expression level of LACTB can inhibit the expression of EMT characteristic proteins, promote the expression of epithelial markers and inhibit the migration and invasion of gastric cancer cells.

The effect of LACTB on the level of autophagy in gastric cancer cells

Western-blot analysis detected that the expression levels of key proteins p-ULK1, Beclin-1, Atg5, and Atg12, and the ratio of LC3II/I in the autophagy signaling pathway in HGC-27 and AGS cells overexpressing LACTB were decreased, and the expression level of P62 was significantly increased. (P<0.05)( Fig.6a-e). In contrast, knockdown of LACTB increased the expression levels of key proteins p-ULK1, Beclin-1, Atg5, Atg12 and the ratio of LC3II/I, while the expression level of P62 was significantly decreased(P<0.05)( Fig.6a-e). The effect of LACTB on the autophagy level of gastric cancer cells was further verified by transmission electron microscopy experiments. The results showed that the number of autophagosomes, typical of vacuolar bilayer membrane-like structures containing cytoplasmic components, was significantly reduced in HGC-27 and AGS cells overexpressing LACTB compared with the empty group (Fig.6f-q). In contrast, the number of autophagosomes in AGS cells with knockdown of LACTB was significantly increased (Fig.6f-q). The above results suggest that LACTB can regulate the autophagy level of gastric cancer cells through the autophagy signaling pathway.

LACTB is a tumor-related gene discovered in recent years, and there are differences in expression in different tumors. LACTB is expressed at low levels in some tumors and functions as a tumor suppressor and is associated with poor prognosis, such as hepatocellular carcinoma[11], breast cancer[8], colorectal cancer [9, 12, 13], glioma tumor[10] melanoma [14]. When the expression level of LACTB is increased in the above tumors, the proliferation, migration, and invasion of tumor cells can be inhibited. In nasopharyngeal carcinoma[15]and pancreatic cancer[16], the elevated expression of LACTB is one of the reasons for promoting the malignant behavior of cancer cells and is an unfavorable prognostic indicator. In breast and colorectal cancers, LACTB is mainly negatively regulated by microRNAs[8, 13]. Induction of increased LACTB expression in colorectal cancer cells can inhibit cellular EMT and increase the expression of epithelial markers through the PI3K/AKT/mTOR signaling pathway of autophagy[12]. However, LACTB is expressed at a high level in some tumors, such as nasopharyngeal carcinoma. Silencing LACTB can inhibit the metastasis of nasopharyngeal carcinoma by increasing the stability of histone H3 by inhibiting ERBB3/EGFR signal transduction[15]. The above studies show that the functional roles of LACTB in different tumors are inconsistent, or even the opposite. The reason may be that the mechanism of LACTB in different tumors is variable.

UALCAN website analysis showed that the expression level of LACTB in gastric cancer tissues was higher than that in normal controls. The results of peripheral blood experiments showed that the expression level of LACTB transcript 1 in peripheral blood of gastric cancer patients was significantly higher than that of healthy people, which was consistent with the results of bioinformatics analysis. In addition, the expression level data of LACTB in peripheral blood was made into a ROC curve and found that LACTB transcript 1 has diagnostic value in gastric cancer. In conclusion, LACTB may be involved in the occurrence and development of gastric cancer and may be an unfavorable factor in the occurrence of gastric cancer. It may be possible to establish a reference range of transcript 1 expression levels in healthy people and then detect the expression of LACTB transcript 1 in venous peripheral blood of patients to play a certain role in the diagnosis of gastric cancer. It can be used in combination with existing tumor markers for the diagnosis and disease monitoring of gastric cancer and becomes a member of the non-invasive diagnostic indicators for gastric cancer.

In addition, the enrichment analysis of the LACTB-related gene found that it could be involved in cellular immunity, cell adhesion, and lysosome which is the core of autophagy in cells[18]. Cellular immunity[36] and adhesion are closely related to gastric cancer cell EMT. We speculate that LACTB may further affect the ability of gastric cancer cells to invade and migrate by regulating autophagy and EMT. Therefore, further experiments can be designed to verify the expression of LACTB in gastric cancer and its effect on the biological function of gastric cancer cells and to analyze whether it can regulate EMT through autophagy to affect the biological function of gastric cancer cells. Existing research results show that LACTB can affect the migration and invasion ability of cancer cells in a variety of solid tumors, but in some solid tumors it has an inhibitory effect [8, 9, 11], and others have a promoting effect [15]. In this study, the changes in migration and invasion ability of cancer cells were observed by regulating the expression levels of LACTB in AGS and HGC-27 gastric cancer cells. Induction of LACTB overexpression in AGS and HGC-27 gastric cancer cells can promote the migration and invasion ability of gastric cancer cells. Silencing the expression of LACTB in AGS attenuated the invasive and migratory abilities of gastric cancer cells. It shows that induction of high expression of LACTB can promote the migration and invasion ability of gastric cancer cells while silencing LACTB can inhibit the migration and invasion ability of LACTB, which is consistent with the research results of LACTB in nasopharyngeal carcinoma[15]. It can be seen that the proliferation, migration, and invasion of gastric cancer cells can be inhibited by reducing the expression level of LACTB. We can use this as a starting point to study the therapeutic methods for inhibiting the growth and metastasis of gastric cancer cells.

Through further experiments to explore the mechanism of LACTB promoting the migration and invasion of gastric cancer cells, it was found that inducing the overexpression of LACTB in HGC-27 and AGS cells can promote the EMT of gastric cancer cells, and silencing LACTB can inhibit the EMT process of gastric cancer cells. The results of the study indicated that the induction of LACTB overexpression caused the changes in EMT-specific indicators, and the levels of autophagy-related molecules were also found to decrease, especially the level of activated LC3II protein in and out of autophagosomes and the number of autophagosomes were significantly reduced. Elevated levels of expression of the "linker" molecule P62 lead to reduced selective uptake and degradation of autophagic substrates. Previous studies have also pointed out that EMT-related signaling pathways can trigger or inhibit autophagy [26]. This indicates that EMT is associated with autophagy levels in this study, and the increase in autophagy levels is beneficial to inhibit the development of gastric cancer. In conclusion, high levels of LACTB can induce gastric cancer cells to acquire the EMT phenotype by inhibiting the level of autophagy. Low levels of LACTB can increase the level of autophagy, indirectly inhibit EMT of gastric cancer cells, and further inhibit the ability of gastric cancer cells to invade and migrate. This indicates that inhibiting the expression of LACTB can prevent EMT by inducing autophagy. Therefore, inhibiting EMT by targeting autophagy may be a new anticancer therapeutic strategy.

The results of this study show that LACTB is highly expressed in gastric cancer, and its expression level can be used as one of the molecular markers for the diagnosis of gastric cancer. And the expression level of LACTB transcript 1 can significantly affect the migration and invasion ability of gastric cancer cells. Further research results suggest that LACTB attenuates the EMT process by regulating the level of autophagy, thereby inhibiting the migration and invasion of gastric cancer cells. The results suggest that it can interfere with the metastasis of gastric cancer by regulating the level of autophagy, which can be used as an experimental basis to explore the mechanism of LACTB in gastric cancer in the later stage.

Acknowledgements The authors thank Guizhou Medical University for providing the experimental environment for clinical laboratory diagnostics experiments.

Funding This work was supported by the Doctoral Start-up Fund of Guizhou Medical University and the Affiliated Hospital of Guizhou Medical University (Xiao Bo He J Zi [2021] No. 043 and gyfybsky-2021-66).

Conflict of interest The authors declare that there is no confict of interest.

Author Contributions All authors contributed to the study conception and design. Conceptualization and funding acquisition was performed by Fang Yang. Material preparation, data collection and analysis were performed by Wei Nie and Zhiqiang Yan..The first draft of the manuscript was written by Wei Nie and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Data availability All data generated or analyzed during this study are included in this article. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethical approval The project was approved by the Research Ethics Committee of the Affiliated Hospital of Guizhou Medical University.

Consent for publication Informed consent was obtained from all individual participants included in the study.

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209–49.
Machlowska J, Baj J, Sitarz M, Maciejewski R, Sitarz R. Gastric Cancer: Epidemiology, Risk Factors, Classification, Genomic Characteristics and Treatment Strategies. Int J Mol Sci. 2020;21:4012–31.
Ahmad S. Platinum-DNA interactions and subsequent cellular processes controlling sensitivity to anticancer platinum complexes. Chem Biodivers. 2010;7:543–66.
DAS M. Neoadjuvant chemotherapy: survival benefit in gastric cancer. Lancet Oncol. 2017;18:30321–22.
Polianskyte Z, Peitsaro N, Dapkunas A, Liobikas J, Soliymani R, Lalowski M, et al. LACTB is a filament-forming protein localized in mitochondria. Proc Natl Acad Sci U S A. 2009;106:18960–5.
Keckesova Z, Donaher JL, De Cock J, Freinkman E, Lingrell S, Bachovchin DA, et al. LACTB is a tumour suppressor that modulates lipid metabolism and cell state. Nature. 2017;543:681–6.
Lu JB, Yao XX, Xiu JC, Hu YW. MicroRNA-125b-5p attenuates lipopolysaccharide-induced monocyte chemoattractant protein-1 production by targeting inhibiting LACTB in THP-1 macrophages. Arch Biochem Biophys. 2016;590:64–71.
Zhang J, He Y, Yu Y, Chen X, Cui G, Wang W, et al. Upregulation of miR-374a promotes tumor metastasis and progression by downregulating LACTB and predicts unfavorable prognosis in breast cancer. Cancer Med. 2018;7:3351–62.
Zeng K, Chen X, Hu X, Liu X, Xu T, Sun H, et al. LACTB, a novel epigenetic silenced tumor suppressor, inhibits colorectal cancer progression by attenuating MDM2-mediated p53 ubiquitination and degradation. Oncogene. 2018;37:5534–51.
Li HT, Dong DY, Liu Q, Xu YQ, Chen L. Overexpression of LACTB, a Mitochondrial Protein That Inhibits Proliferation and Invasion in Glioma Cells. Oncol Res. 2019;27:423–9.
Xue C, He Y, Zhu W, Chen X, Yu Y, Hu Q, et al. Low expression of LACTB promotes tumor progression and predicts poor prognosis in hepatocellular carcinoma. Am J Transl Res. 2018;10:4152–62.
Xu W, Yu M, Qin J, Luo Y, Zhong M. LACTB Regulates PIK3R3 to Promote Autophagy and Inhibit EMT and Proliferation Through the PI3K/AKT/mTOR Signaling Pathway in Colorectal Cancer. Cancer Manag Res. 2020;12:5181–200.
Wang C, Shi Z, Hong Z, Pan J, Chen Z, Qiu C, et al. MicroRNA-1276 Promotes Colon Cancer Cell Proliferation by Negatively Regulating LACTB. Cancer Manag Res. 2020;12:12185–95.
Ma Y, Wang L, He F, Yang J, Ding Y, Ge S, et al. LACTB suppresses melanoma progression by attenuating PP1A and YAP interaction. Cancer Lett. 2021;506:67–82.
Peng LX, Wang MD, Xie P, Yang JP, Sun R, Zheng LS, et al. LACTB promotes metastasis of nasopharyngeal carcinoma via activation of ERBB3/EGFR-ERK signaling resulting in unfavorable patient survival. Cancer Lett. 2021;498:165–77.
Xie J, Peng Y, Chen X, Li Q, Jian B, Wen Z, et al. LACTB mRNA expression is increased in pancreatic adenocarcinoma and high expression indicates a poor prognosis. PLoS ONE. 2021;16:e0245908.
Mizushima N. Autophagy: process and function. Genes Dev. 2007;21:2861–73.
Levine B, Kroemer G. Biological Functions of Autophagy Genes: A Disease Perspective. Cell. 2019;176:11–42.
Belaid A, Cerezo M, Chargui A, Corcelle-Termeau E, Pedeutour F, Giuliano S, et al. Autophagy plays a critical role in the degradation of active RHOA, the control of cell cytokinesis, and genomic stability. Cancer Res. 2013;73:4311–22.
Ma Y, Galluzzi L, Zitvogel L, Kroemer G. Autophagy and cellular immune responses. Immunity. 2013;39:211–27.
Katheder NS, Khezri R, O’farrell F, Schultz SW, Jain A, Rahman MM, et al. Microenvironmental autophagy promotes tumour growth. Nature. 2017;541:417–20.
Kimmelman AC, White E. Autophagy and Tumor Metabolism. Cell Metab. 2017;25:1037–43.
Yang A, Herter-Sprie G, Zhang H, Lin EY, Biancur D, Wang X, et al. Autophagy Sustains Pancreatic Cancer Growth through Both Cell-Autonomous and Nonautonomous Mechanisms. Cancer Discov. 2018;8:276–87.
Sang H, Zhang W, Peng L, Wei S, Zhu X, Huang K, et al. Exosomal circRELL1 serves as a miR-637 sponge to modulate gastric cancer progression via regulating autophagy activation. Cell Death Dis. 2022;13:56.
Kim TW, Lee HG. Apigenin Induces Autophagy and Cell Death by Targeting EZH2 under Hypoxia Conditions in Gastric Cancer Cells. Int J Mol Sci. 2021;22:13455–72.
Chen HT, Liu H, Mao MJ, Tan Y, Mo XQ, Meng XJ, et al. Crosstalk between autophagy and epithelial-mesenchymal transition and its application in cancer therapy. Mol Cancer. 2019;18:101–19.
Singla M, Bhattacharyya S. Autophagy as a potential therapeutic target during epithelial to mesenchymal transition in renal cell carcinoma: An in vitro study. Biomed Pharmacother. 2017;94:332–40.
Catalano M, D'alessandro G, Lepore F, Corazzari M, Caldarola S, Valacca C, et al. Autophagy induction impairs migration and invasion by reversing EMT in glioblastoma cells. Mol Oncol. 2015;9:1612–25.
Krebs AM, Mitschke J, Losada ML, Schmalhofer O, Boerries M, Busch H, et al. The EMT-activator Zeb1 is a key factor for cell plasticity and promotes metastasis in pancreatic cancer. Nat Cell Biol. 2017;19:518–29.
Saitoh M. Involvement of partial EMT in cancer progression. J Biochem. 2018;164:257–64.
Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009;119:1420–28.
Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15:178–96.
Tsai JH, Donaher JL, Murphy DA, Chau S, Yang J. Spatiotemporal regulation of epithelial-mesenchymal transition is essential for squamous cell carcinoma metastasis. Cancer Cell. 2012;22:725–36.
Wang X, Li Y, Fang Z, Li Y. Elevated expression of NFE2L3 promotes the development of gastric cancer through epithelial-mesenchymal transformation. Bioengineered. 2021;12:12204–14.
Chang XT, Wu H, Li HL, Li HL, Zheng YB. PADI4 promotes epithelial-mesenchymal transition(EMT) in gastric cancer via the upregulation of interleukin 8. BMC Gastroenterol. 2022;22:25–36.
LI H, Wab GC, Lan L, Behrens A, Tomaschko M, Ruiz J, et al. High expression of vinculin predicts poor prognosis and distant metastasis and associates with influencing tumor-associated NK cell infiltration and epithelial-mesenchymal transition in gastric cancer.Aging. (Albany NY). 2021;13:5197–225.

Download PDF

Reviewers invited by journal
22 Jan, 2023
Editor assigned by journal
16 Jan, 2023
First submitted to journal
14 Jan, 2023

You are reading this latest preprint version

Preliminary study of LACTB transcript 1 inhibiting gastric cancer cell migration and invasion by regulating autophagy

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Statements & Declarations

References

Status:

Version 1