Moderate Biochar Application and Increases in Lignin and Silicon Concentrations in Stalks Synergistically Enhance Lodging Resistance of Rice

doi:10.21203/rs.3.rs-2486418/v1

Download PDF

Research Article

Moderate Biochar Application and Increases in Lignin and Silicon Concentrations in Stalks Synergistically Enhance Lodging Resistance of Rice

https://doi.org/10.21203/rs.3.rs-2486418/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

To clarify the effects of biochar on measuring the lodging-related traits, structural carbohydrates, and the activity and gene expression of enzymes related to lignin synthesis in rice stalks, to screen the optimal dosage of biochar and to investigate the mechanism of biochar in regulating the lodging-resistant ability of rice stalks. SN265 and Akihikari, two rice varieties with evident differences in lodging resistance, were selected and treated with biochar at five dosages: 0,5,10,20,40t/hm². With increase of the dosage of biochar, The expression levels of COMT, 4CL3, CCR20 and PAL genes related to lignin synthesis were the highest under B3 treatment. The silicon concentration in the two varieties under B3, B4 and B5 treatments was notably higher than that under B1 treatment. The numbers of large and small vascular bundles were the largest in SN265 under B3 treatment and in Akihikari under B2 treatment. Moreover, the two varieties exhibited the highest lignin concentration, the smallest lodging index and the strongest lodging resistance under B3 treatment. A certain amount of biochar can regulate the corresponding enzyme activity by increasing the expression level of lignin synthesis-related genes, and evidently increase the lignin concentration in stalks. The application of rice hull charcoal is able to dramatically raise the silicon concentration in stalks, thus improving the lodging resistance of stalks. The two approaches can synergistically improve the internode traits and breaking strength and strengthen the lodging resistance of stalks. In this study, 5–10 t/hm² is the appropriate dosage in treatment.

Rice

Biochar

lignin biosynthesis

lodging resistance

Gene expression

Lodging is one of the important limiting factors affecting the improvement of crop yield, and also seriously affects the quality of crops and the degree of mechanized harvesting; Compared with other upland crops, the consequences of rice lodging are relatively more serious. Due to the pursuit of high crop yield, the application of excessive nitrogen fertilizer in agricultural management makes the risk of rice lodging higher and higher. At the same time, with the improvement of living standards, people's demand for high-quality rice is increasing, but most high-quality rice varieties are more prone to lodging. Therefore, it is very important to improve rice lodging resistance through more cultivation methods.

Biochar normally means a solid carbon-rich product of the thermal decomposition of biomass in the absence of oxygen ^[1]. The physical and chemical properties of biochar and its influences on soil, crops and the environment were widely researched by scientists all over the world, and it has been proved that biochar exerts crucial effects in improving soil structure and physical and chemical properties, modifying the microbial community in soil, increasing crop yield and quality, effectively preventing air pollution and reducing carbon dioxide emissions ^[2–9]. However, the research on the influences of biochar on rice mostly focuses on yield, soil and greenhouse gases, while the effect of biochar on the lodging resistance of plant stems and its mechanism have rarely been reported. There is a large amount of silicon in the residues of rice stalks after harvest (Heather A et al., 2007). However, the concentrations of Si, P, Ca and Mg in biochar are higher than those in raw materials, and the concentrations of N and S may be lower than those in raw materials due to the volatilization of ammonia and hydrogen sulfide at higher pyrolysis temperature (Li SM et al., 2018; Tag AT et al., 2016). In comparison with its own raw materials, available silicon also enriches in crop residue biochar, with the concentration similar to its total concentration (Wang M et al., 2018). The dissolved silicon concentration in biochar was studied for 28 days, and it was found that the dissolved silicon concentration in biochar is higher than that in raw materials under the pyrolysis temperature of 350–700°C (Xiao X et al., 2014). In the straw biochar produced at a high temperature of 350–550°C, the available silicon concentration in soil in a certain range is positively related to the dosage of straw biochar applied (Liu XY et al., 2014). In contrast to slag silicate with heavy metal pollution in traditional silicon fertilizer and high-cost natural silicate minerals, biochar in crops with high silicon accumulation (rice, sugar cane, etc.) is a renewable and sustainable substitute for silicon fertilizer and a long-term environment-friendly way for crops to absorb silicon (Li ZC et al., 2019).

Generally, silicon is associated with the stiffness of stalks, which can increase the bending resistance or lodging resistance of rice stalks by strengthening their stiffness, thus reducing the yield loss and increasing the harvest cost. A study of Doraira D et al. (2020) demonstrated that the concentrations of lignin and cellulose in stalks and the lodging resistance show remarkable positive correlations with silicon accumulation, and the application of silicon elevates the concentration of lignin in plants, thus increasing lodging resistance. Besides, stalk strength and cell wall lignification affect the resistance ability of plants to any external force (such as wind). Compared with the cellulose concentration, the lignin concentration is more crucial for improving the mechanical support and tensile strength of stalks (Jones L et al., 2001). Phenylalanine ammonia lyase (PAL), 4-coumarate: CoA ligase (4CL), cinnamyl alcohol dehydrogenase (CAD), caffeic acid 3-O-methyltransferase (COMT), cinnamyl coenzyme A reductase (CCR) and other enzymes exert crucial effects in lignin biosynthesis, and the corresponding gene expression levels also change to some extent (Boudet AM et al., 2003; Liu ST et al., 2018; Irshad A et al., 2020).

Compared with other treatments, biochar returning to the field is a sustainable and friendly agricultural method, which has certain benefits to the environment and soil improvement. In this experiment, different amounts of biochar were used to explore how biochar could improve the lodging resistance of rice and its mechanism. The results of this experiment will provide a theoretical basis for the cultivation technology of rice based on biochar to resist adversity, and broaden the cultivation methods to improve the lodging resistance of crops. At the same time, it is of great significance to improve the level of rice mechanization and rice quality, and to rationally utilize biochar.

1.1 Materials

The conventional japonica rice variety Shennong 265 (SN265) and Japanese japonica rice variety Akihikari were selected as the research objects and underwent pot experiments with rice hull charcoal in Shenyang, Liaoning Province from 2018 to 2020 at five dosages, namely, 0 t/hm² (B1), 5 t/hm² (B2), 10 t/hm² (B3), 20 t/hm² (B4) and 40 t/hm² (B5). The bulk density of soil in this region was 1.34 g/cm³, and the soil quality was calculated according to the 15 cm soil layer. If B3 biochar was applied, the mass ratio in the soil would be 5‰. Soil and biochar amount were set as follows: 0 g biochar + 15 kg soil per pot at Control (B1), 75 g biochar + 14.93 kg soil at B2, 150 g biochar + 14.85 kg soil per pot at B3, 225 g biochar + 14.78 kg soil per pot at B4 and 300 g biochar + 14.70 kg soil per pot at B5. After sieving, the water content in soil tested was measured, and the amount of biochar under each treatment was calculated. Then biochar was fully mixed with soil, weighed after conversion according to the dry soil weight, and loaded in pots. The soil and biochar in each pot (diameter ⋅ height = 30 cm ⋅ 30 cm) were thoroughly mixed. On April 15th, 2 plug germination accelerating seedlings were sowed per hole on a dry bed in greenhouse. When there were about 3.5 leaves, seedlings with the same growth tendency were selected for equal distance transplanting. These seedlings were planted in 10 pots at each treatment of each variety, with 3 holes in each pot and 1 seedling in each hole. Later, 1.6 g/barrel of nitrogen fertilizers (calculated based on 225 kg/hm² pure nitrogen, applied by three separate times according to the ratio of base fertilizer: tiller fertilizer: spike fertilizer = 5:4:1), 1.06 g/barrel of diammonium phosphate (once), and 1.06 g/barrel of potassium sulfate (base fertilizer: spike fertilizer = 1:1) were applied, Each pot has the same moisture management, using alternate wetting and drying irrigation(Deivaseeno Doraira, 2020). The biochar used was rice hull charcoal with a particle size of 1.5-2.0 mm, which was produced and supplied by Liaoning Golden Future Agricultural Development Co., Ltd. Physical and chemical properties of potted soil and rice hull charcoal are shown in the following Table 1. At 10 days after heading, the samples were taken from the same parts with uniform growth in each treatment, and stored in an ultra-low temperature freezer at -80°C for measuring enzyme activity and gene expressions.

1.2 Determination of the lodging index

At 30 days after full heading, 3 holes of rice were selected for each treatment, and 15 representative tillers with the same growth tendency were picked up by subsampling for the separate measurement of the plant height, height of gravity, ear length, ear weight and ear stalk angle of rice. Subsequently, the bending-resistant strength of each internode was measured using a stalk strength tester (Model: YYD-1). The stalk internode distance, ear length, dry varieties, the bending-resistant strength between the third and fourth nodes (N3, N4) below the neck of the ear, and the length and fresh weight from the base of each internode to the tip of the ear were measured. The bending moment and lodging index between N3 and N4 in each treatment were calculated using the method of Dorairaj and Ismail (2017) :

Bending moment = length from internode base to ear tip (cm) × fresh weight of the part from internode base to ear tip (g)

Lodging index = bending moment/bending-resistant force × 100%

1.3 Determination of the anatomical structure of stalks

In the heading and flowering period, a tag was hung in a single ear of rice with uniform growth, with a total of 5 ears hung with tags in each treatment. Three single stalks selected in each plot were sampled at the middle of N4 by 0.5-l cm, fixed by FAA for 24 h and desilicated by 15% hydrofluoric acid for 25 d. Next, the samples were sliced by paraffin section method, and embedded using KD-BM biological tissue embedding machine (Zhejiang Jinhua Kedi Instrumental Equipment Co., Ltd.) in the early stage. Later, a KD2508 rotary slicer was employed to cut a 12 µm-thick transection paraffin-embedded band and photographed under a ZeissXS microscope. Finally, the numbers and areas of large and small vascular bundles (including xylem and phloem areas) were calculated using AxioVison software. Stalk thickness = (longest diameter + shortest diameter)/2.

1.4 Determination of substance concentration in stalks

In the mature period, three rice plants were selected for each treatment. Following de-enzyme at 105°C, the rice plants were dried at 80°C to constant weight. After the dry weight was measured, they were ground with a JP-SOOC-8 high-speed pulverizer and screened using an 80-mesh sieve for later use. Subsequently, the concentrations of cellulose and lignin in plant stalks were determined by VanSoest's washing fiber analysis method (VanSoest et al., 1991) as per the operation manual of Fibertec™ M6 1020/1021 cellulose analyzer (FOSS), and the silicon concentration in plant stalks was detected by means of the molybdenum blue method (Hua HX et al., 2013).

1.5 Lignin synthesis-related enzyme activity and transcriptional gene expressions

The related enzyme activities were determined by the kit (Shanghai Enzyme-linked Biotechnology Co., Ltd.). With this kit, the levels of COMT, 4CL3, PAL and CCR20 in the plant samples were detected by double antibody sandwich method, the optical density (OD) value at the wavelength of 450 nm was measured using a microplate reader, and the activity and concentration of plant enzymes in the samples were examined based on standard curves. TRIzol assay was employed to extract the total ribonucleic acids (RNA) from seeds in a refrigerator at -80°C, DNaseⅠ was added to eliminate genomic deoxyribonucleic acid (DNA) pollution, and complementary DNAs (cDNAs) were synthesized using a reverse transcription (RT) kit (NOVA, Jiangsu Yugong Biolabs Co., Ltd.). After that, quantitative RT-polymerase chain reaction (qRT-PCR) primers (Table 2) were designed using Premier 5.0 software on the basis of the gene RNA sequence published on National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov), and primer specificity should be guaranteed through BLAST comparison on NCBI website. With cDNAs as templates and Actin1 as an internal reference gene, qRT-PCR was carried out with reference to the instructions of Taq SYBR® Green qPCR kit, and it was conducted 3 times for each sample. Ultimately, the relative expression of target genes was calculated according to the 2^−ΔΔCt method (Rajeevan MS et al., 2001), and Statistical Product and Service Solutions (SPSS) 17.0 software was adopted for data analysis.

1.6 Data analysis

Microsoft Excel 2007 and SPSS software were adopted for processing and analysis of data measured. Differences among treatments with different dosages of biochar were compared using one-way analysis of variance and Duncan's test. Averages were taken by the least significant difference test at P < 0.05. The data listed in the table are two-year averages.

2.1 Impacts of biochar on the morphological features of rice stalks

As shown in Table 3, as the dosage of biochar rose, the plant height, height of gravity, fresh weight of a single stalk, ear weight and ear length of SN265 and Akihikari all showed a trend of first rising and then descending, while the ear stalk angle showed a downward trend (that is, the ear was relatively straighter). It was found that the plant height and the height of gravity of SN265 peaked under B3 treatment, which were remarkably larger than those under B1 treatment, whereas those of Akihikari reached the maximum under B4 treatment, which were also markedly larger than those under B1 treatment. In addition, the fresh weight of a single stalk of SN265 peaked under B4 treatment, with no significant differences among all treatments, but it was evidently larger under B2, B3, B4 and B5 treatments than that under B1 treatment. Besides, the fresh weight of a single stalk of Akihikari peaked under B3 treatment, which was remarkably larger than that under B1 treatment. The results confirmed that for the two rice varieties, the application of biochar improved the stalk angle of ears and made ears relatively straight. Moreover, the ear weight of SN265 was notably larger under B2 and B5 treatments than that under B1 treatment, and that of Akihikari was markedly larger under B4 and B5 treatments than that under B1 treatment. In addition, the ear length of SN265 reached the maximum under B3 treatment and evidently longer than that under B1 treatment. Nevertheless, no significant differences were detected in the ear length of Akihikari among different treatments.

As displayed in Table 4, the internode distance of N3 in SN265 and Akihikari rose up with the increase of the dosage of biochar, which was markedly longer than that under B1 treatment. The internode distance of N4 in SN265 exhibited an uptrend and then a downtrend as the dosage of biochar was increased. It reached the peak under B3 treatment and was dramatically longer under B2, B3, B4 and B5 treatments than that under B1 treatment. Besides, Akihikari had longer internode distance of N4 under B2, B3, B4 and B5 treatments than that under B1 treatment, and it was 10.07% longer under B2 treatment than that under B1 treatment. Moreover, the outer diameter of N3 in SN265 treated with biochar was longer than that in SN265 treated with B1, and it was significantly longer under B5 treatment than that under B1 treatment. Meanwhile, the outer diameter of N3 in Akihikari and that of N4 in SN265 treated with biochar tended to become larger, but there were no significant differences among treatments with different doses of biochar. The outer diameter of N4 in Akihikari peaked under B2 treatment and remarkably higher than that under B1 treatment. Moreover, the dry weight per unit length exhibited an upward trend and a downward trend with the increase of the application dosage of biochar, and that in Akihikari N4 under B3 treatment was dramatically higher than that under B1 treatment, but it was not markedly different in comparison with other treatments with different doses of biochar.

2.2 Effect of biochar on the lodging index of rice stalks

It was displayed in Table 5 that SN265 and Akihikari were able to enhance the bending-resistant strength of stalks after biochar application, and the bending-resistant strength of SN265 N3 was the highest under B3 treatment, which was notably higher than that under treatments with other dosages of biochar. Besides, the bending-resistant strength of SN265 N4 under biochar treatments was obviously higher than that under B1 treatment and peaked under B3 treatment, which was 30.97% stronger than that under B1 treatment. The bending-resistant strength of N3 in Akihikari showed first increase and then decrease trends as the dosage of biochar was increased, and reached the maximum under B2 treatment, while that under B2 and B3 treatments were dramatically stronger than that under treatments with other dosages of biochar. In addition, the bending-resistant strength of N4 in Akihikari peaked under B2 treatment, which was prominently stronger than that under treatments with other dosages of biochar. As the dosage of biochar was raised, the bending moments of N3 and N4 in both SN265 and Akihikari displayed an uptrend and then a downtrend. Furthermore, the lodging indexes of N3 and N4 in SN265 were the lowest under B3 treatment, which did not widely differ from those under B2 treatment, but were evidently lower than those under B1, B4 and B5 treatments. The lodging index of N3 in Akihikari was the lowest under B2 treatment, which did not significantly differ from that under B3 treatment, but prominently lower than that under B1, B4 and B5 treatments. Besides, N4 in Akihikari had the lowest lodging index under B2 treatment, which was notably lower than that under treatments with other dosages of biochar.

2.3 Effect of biochar on the anatomical structure of rice stalks

As shown in Fig. 1 and Table 6, the numbers and areas of large and small vascular bundles in both SN265 and Akihikari all tended to rise first and then drop with the increase of the biochar dosage. SN265 had the largest numbers and areas of large and small vascular bundles under B3 treatment, of which the number of large vascular bundles, the number of small vascular bundles and the area of small vascular bundles were evidently larger than those under B1 treatment by 12.63%, 9.78% and 25.93%, respectively. The numbers of large and small vascular bundles in Akihikari peaked under B2 treatment, which were significantly larger than those under B1 treatment by 10.98% and 7.90%, respectively. The area of large vascular bundles was the largest under B4 treatment, which was markedly larger than that under B1, B2 and B5 treatments, while the area of small vascular bundles in Akihikari was the largest under B4 treatment, with no significant differences among treatments with different dosages of biochar.

2.4 Influence of biochar on the chemical composition of rice stalks

It was revealed by Fig. 2 that with the increase of the dosage of biochar, the lignin and cellulose concentrations in SN265 and Akihikari exhibited upward trends, followed by downward trends, and the lignin concentration was the highest under B3 treatment. Besides, the lignin concentration in SN265 under B3 and B4 treatments was markedly higher than that under treatments with other dosages of biochar. However, no significant differences in the lignin concentration appeared in Akihikari under B2, B3 and B4 treatments, but it was prominently higher than that under B1 treatment. Moreover, the concentration of cellulose peaked under B3 treatment in SN265 and under B2 treatment in Akihikari, which was evidently higher than that under treatments with other dosages of biochar.

As illustrated in Fig. 3, as the dosage of biochar was increased, the silicon concentration in rice stalks gradually rose and finally stabilized. There were no significant differences in the silicon concentration between SN265 and Akihikari under B3, B4 and B5 treatments, but it was markedly higher than that under B1 treatment in both varieties.

2.5 Effects of biochar on the activity and expression of enzymes related to lignin synthesis in rice stalks

As shown in Fig. 4, the activities of COMT, 4CL3 and PAL in SN265 rose first and then dropped with the increase of the dosage of biochar. They were the strongest under B3 treatment, which were stronger than those under treatments with other dosages of biochar. Besides, the activities of COMT, 4CL3 and PAL under B2 and B3 treatments were dramatically stronger than those under B1 treatment. The activity of CCR20 in SN265 peaked under B2 treatment, which was evidently higher than that under treatments with other dosages of biochar. The activities of COMT, CCR20, 4CL3 and PAL in Akihikari gradually declined with the increase of the biochar dosage, and peaked under B2 treatment, which were remarkably higher than those under treatments with other dosages of biochar. In Akihikari, the activities of COMT, 4CL3 and PAL under B2 and B3 treatments were notably stronger than those under B1 treatment, while the activity of CCR20 under biochar treatments was obviously stronger than that under B1 treatment.

It was discovered in Fig. 5 that the gene expression levels of COMT, CCR20, 4CL3 and PAL in SN265 were elevated first and then decreased as the dosage of biochar was increased, and reached the peak under B3 treatment, which were significantly higher than those under treatments with other dosages of biochar. Additionally, the gene expression levels in SN265 under B2, B3 and B4 treatments were remarkably higher than those under B1 treatment. Furthermore, Akihikari exhibited gradually decreased gene expression levels of COMT, CCR20, 4CL3 and PAL with the increase of the dosage of biochar, and the levels peaked under B2 treatment, which were markedly higher than those under treatments with other dosages of biochar. Besides, the gene expression levels in Akihikari under B2 and B3 treatments were obviously higher than those under B1 treatment.

Biochar can increase the amount of total nitrogen in soil, enhance soil fertility, and increase the absorption of nitrogen by rice, fertilizer utilization and crop biological yield (Wang YF et al., 2014; Huang M et al., 2014; Wang YF et al., 2017). As the dosage of rice hull charcoal is increased, the plant height and the height of gravity of rice rise first and then drop, mainly because the addition of rice hull charcoal increases the utilization of nitrogen fertilizer and promotes plant growth. Nevertheless, applying excessive biochar will increase pH and lead to serious imbalance of C/N ratio, which may inhibit the growth of roots and plants, thus affecting the plant height. Under the high dosage of rice hull charcoal, plants have more available silicon, which can increase the accumulation of silicon in stalks and facilitate the lodging resistance of stalks. Lignin, the main structural compound in the cell wall of vascular plants, shows associations with the growth and development of plants, and also strengthens the strength and stiffness of plants (Ma QH et al., 2009). A strong consensus has been reached in the published literature that the increase of the lignin concentration can be used as the main index to evaluate the lodging resistance of crops (Peng D et al., 2014; Chen XG et al., 2011). In this study, the silicon concentration in the two varieties under B3 treatment rose remarkably in comparison with that under B1 treatment, and the numbers of large and small vascular bundles, lignin and cellulose concentrations in SN265 and Akihikari were at the highest levels under B3 and B2 treatments, respectively, which were notably increased compared with those under treatments with other dosages of biochar. Moreover, the stalk thickness and the dry weight per unit length were slightly raised, which enhanced the mechanical strength, bending-resistant strength and lodging resistance of rice. It was also confirmed that rice hull charcoal was able to increase the biological yield by improving the fertilizer utilization, and to reduce the risk of stalk lodging resistance decline due to plant rise through increasing the concentrations of silicon and lignin in stalks.

It has been considered that the genetic modification of the plant cell wall is a promising approach to improving agricultural traits of plants (Xie GS & Peng LC, 2011). Genotypes and environmental factors exert great effects in the lignification process, which determines the synthesis kinetics and accumulation of lignin in the cell wall. PAL is crucial for the lignin biosynthesis (Boudet AM et al., 2007) and lodging resistance (Wang C et al., 2014). Similarly, a study of Lidija B et al. (2018) demonstrated that the gene expressions of PAL, CCR and CAD are raised, lignin synthesis is enhanced, and lodging resistance of stalks is determined by the increase of lignin formation. A study of Liu ST et al. (2018) proved that the gene overexpressions of PAL, COMT, 4CL3, CAD2, CAD7 and CCR20 enhance the activities of enzymes related to lignin synthesis in the cell wall, thus increasing the concentration of lignin and obviously thickening the stalk wall and cell wall. PAL, 4CL and CAD play indispensable roles in lignin biosynthesis (Boudet AM et al., 2003). It has also been shown that the concentration of lignin and the activity of enzymes related to lignin display remarkable associations with the lodging resistance of stalks (Wang C et al., 2014; Hu D et al., 2017). In the present study, it was discovered that different concentrations of rice hull charcoal had certain effects on the gene expressions of PAL, COMT, 4CL3 and CCR20. The gene expressions of the four enzymes peaked in Akihikari under B2 treatment, when the corresponding enzyme activities were also the strongest. In contrast to Akihikari, SN265 had the highest gene expressions of the above four enzymes and the strongest enzyme activities under B3 treatment.

Biochar is able to strengthen the lodging resistance of stalks through raising the concentration of silicon in stalks and regulating the lignin metabolism of rice. It dramatically increases the relative gene expressions of COMT, CCR20, 4CL3 and PAL, so as to improve the corresponding enzyme activities, increase the numbers of large and small vascular bundles and the lignin concentration in stalks, and enhance the lodging resistance of stalks. In the present study, the application of 5–10 t/hm² biochar was the most beneficial to enhancing the lodging resistance of rice stalks. Therefore, it is recommended to apply 5 t/hm² biochar for reducing costs and improving benefits.

The broad popularization of the application of biochar significantly contributes to the realization of "peak carbon dioxide emissions and carbon neutrality" in global climate governance. In addition, the particularity of production materials provides a new idea for the application of biochar. Biochar provides a theoretical basis for the cultivation technology of rice resistance to adversity, and broadens the cultivation methods to improve the lodging resistance of crops.

1) Ethics approval and consent to participate - The japonica rice varieties used in the experiment, Shennong 265 (SN265) and Akihikari, were purchased normally at the seed store without any problems, all the methods involving the plant and its material complied with relevant institutional, national, and international guidelines and legislation.

2) Consent for publication - The manuscript does not contain information or images that could lead to identification of a study participant.

3) Availability of data and materials - The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.

4) Competing interests - The authors declare there are no conflicts of interest.

5) Funding - This work was supported by the earmarked fund for Project of Liaoning Provincial Doctoral Research Start-up Fund in 2022(2022-BS-050), and China Agriculture Research System (CARS-01-55), Liaoning Academy of Agricultural Sciences Collaborative Innovation Plan 2022 "Revelation and Commanding" project(2022XTCX0501), Liaoning green agricultural development evaluation and optimum path(2022JH4/10100050), Liaoning province's green low carbon development level measure, implementation mechanism and ascension path(L21CJY016)."

6) Authors' contributions - D. K. Gong conducted all experiments and data processing and article writing; G. X. Yu, conducted some experiments and fnancial support for experiments. All authors reviewed the manuscript.

7) Acknowledgements - Throughout the writing of this dissertation I have received a great deal of support and assistance. I would first like to thank my supervisor,Zhengjin Xu,whose expertise was invaluable in formulating the research questions and methodology. I would particularly like to acknowledge my teammate, Guangxin Yu and Wenjing Zheng, for their wonderful collaboration and financial support.

Boudet A M, Kajita S, Grima-Pettenati J, Goffner D. Lignins and lignocellulosics: A better control of synthesis for new and improved uses. Trends in Plant Science, 2003, 8, 576–581.
Boudet, A.-M., 2007. Evolution and current status of research in phenolic compounds. Phytochemistry 68, 2722–2735.
Boudet, A.M., Kajita, S., Grima-Pettenati, J., Goffner, D.Lignins and lignocellulosics: a better control of synthesis for new and improved uses. Trends Plant Sci. 8: 576–581, 2003.
Chen X G, Shi C Y, Yin Y P, Wang Z L, Shi Y H, Peng D L, Ni Y L, Cai T. Relationship between lignin metabolism and lodging resistance in wheat. Acta Agronomica Sinica, 2011, 37, 1616–1622.
Chen, W.F., Meng, J., Han, X.R., Lan,Y., Zhang, W.M. Past, present, and future of biochar.Biochar, 2019, 1,75–87.
Da Dong, Min Yang, Cheng Wang, Hailong Wang, Yi Li, Jiafa Luo, Weixiang Wu.Responses of methane emissions and rice yield to applications of biochar and straw in a paddy field. Journal of Soils and Sediments. 2013, 13, 8, 1450–1460.
Deivaseeno Doraira, Mohd Razi Ismail, Uma Rani Sinniah, Kar Ban Tan, Silicon mediated improvement in agronomic traits, physiological parameters and fber content in Oryza sativa. Acta Physiologiae Plantarum, 2020, 42:38.
Diankai Gong, Ximing Xu, Li’an Wu, Guijin Dai, Wenjing Zheng & Zhengjin Xu. Effect of biochar on rice starch properties and starch-related gene expression and enzyme activities. Scientific Reports. 2020, 10, 16917.
Dorairaj D, Ismail MR. Distribution of silicifed microstructures, regulation of cinnamyl alcohol dehydrogenase and lodging resistance in silicon and paclobutrazol mediated oryza sativa. Front Physiol, 2017, 8:491.
Hamoud Y A, Shaghaleh H, Sheteiwy M, Guo X P, Elshaikh N A, Khan N U, Oumarou A, Rahim S F. Impact of alternative wetting and soil drying and soil clay content on the morphological and physiological traits of rice roots and their relationships to yield and nutrient use-efficiency. Agricultural Water Management, 2019, 223, 105706.
Heather A. Currie, Carole C. Perry. Silica in plants: biological, biochemical and chemical studies. Annals of Boanyt., 2007,100, 7:1383–1389.
Herath, H. M. S. K., Camps-Arbestain, M. & Hedley, M. Efect of biochar on soil physical properties in two contrasting soils: An Alfsol and an Andisol. Geoderma, 2013, 209, 188–197.
Hu, D., Liu, X. B., She, H. Z., Gao, Z., Ruan, R. W., Wu, D. Q., Yi, Z. L. The lignin synthesis related genes and lodging resistance of Fagopyrum esculentum. Biologia Plantarum, 2017, 6: 138–146.
Hua, H. X., Yu, H. G., Liu, D. J. Determination of Silicon Concentration in the Plants by Colorimetric Molybdenum Blue Method. Modern Agricultural Science and Technology. 2013, 24:173–174.
Huang, D. L. et al. Te efects of rice straw biochar on indigenous microbial community and enzymes activity in heavy metalcontaminated sediment. Chemosphere, 2017, 174, 545–553.
Huang, M., Yang, L., Qin, H., Jiang, L. & Zou, Y. Fertilizer nitrogen uptake by rice increased by biochar application. Biol. Fertil. Soils, 2014, 50, 997–1000.
Hussain, M. et al. Biochar for crop production: potential benefts and risks. Journal of Soils and Sediments, 2017, 17, 685–716.
Irshad Ahmad, Meng Xiang-ping, Muhammad Kamran, et al. Effects of uniconazole with or without micronutrient on the lignin biosynthesis, lodging resistance, and winter wheat production in semiarid regions. Journal of Integrative Agriculture. 2020, 19(1): 62–77.
Jones L, Ennos AR, Turner SR. Cloning and characterization of irregular xylem4 (irx4): a severely lignin-defcient mutant of Arabidopsis. Plant J, 2001, 26: 205–216.
Li, S.M., Barreto, V., Li, R.W., Chen, G., Hsieh, Y.P. Nitrogen retention of biochar derived from different feedstocks at variable pyrolysis temperatures. J. Anal. Appl. Pyrolysis, 2018, 133, 136–146.
Lidija, B., Ivan, A., Alojzije, L.,Hrvoje, L., Vera, C., Dunja, L. L. Lignin synthesis and accumulation in barley cultivars diffffering in their resistance to lodging. Plant Physiology and Biochemistry, 2018, 133, 142–148.
Liu Y X, Lu H H,Yang S M,et al. Impacts of biochar addition on rice yield and soil properties in a cold waterlogged paddy for two crop seasons.Field Crops Research, 2016, 191:161–167.
Liu, X.Y., Li, L.Q., Bian, R.J., Chen, D., Qu, J.J., Kibue, W.G., Pan, G.X., Zhang, X.H., Zheng, J.W., Zheng, J.F, Effect of biochar amendment on soil-silicon availability and rice uptake. J. Plant Nutr. Soil Sci. 2014, 177, 91–96.
Ma, Q.H., 2009. The expression of caffffeic acid 3-O-methyltransferase in two wheat genotypes diffffering in lodging resistance. J. Exp. Bot. 60, 2763–2771.
Peng D, Chen X, Yin Y, Lu K, Yang W, Tang Y, Wang Z. Lodging resistance of winter wheat (Triticum aestivum L.): Lignin accumulation and its related enzymes activities due to the application of paclobutrazol or gibberellin acid. Field Crops Research, 2014, 157, 1–7.
Rajeevan, M.S; Ranamukhaarachchi, D.G.; Vernon, S.D.; Unger, E.R. Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods (San Diego, Calif.), 2001, 25,4,443–451.
Sitong Liu , Yuwei Huang , Hai Xu, Minghui Zhao, Quan Xu and Fengcheng Li. Genetic enhancement of lodging resistance in rice due to the key cell wall polymer lignin, which affects stem characteristics. Breeding Science, 2018, 68: 508–515 .
Song, D. L. et al. Responses of soil nutrients and microbial activities to additions of maize straw biochar and chemical fertilization in a calcareous soil. European Journal of Soil Biology, 2018, 84, 1–10.
Tag, A.T., Duman, G., Ucar, S., Yanik, J. Effects of feedstock type and pyrolysis temperature on potential applications of biochar. J. Anal. Appl. Pyrolysis, 2016, 120, 200–206.
Van Soest, J B Robertson, B A Lewis. 1991. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. Journal of Dairy Research. 74 (10): 3583–3597.
Wang, C., Ruan, R.W., Yuan, X.H., Hu, D., Yang, H., Li, Y., Yi, Z.L.: Relationship between lignin metabolism and lodging resistance of culm in buckwheat. - J. agr. Sci. 6: 29–36, 2014.
Wang, C., Ruan, R.W., Yuan, X.H., Hu, D., Yang, H., Lin, T.T., He, P.L., Li, Y., Yi, Z.L.: Relationship of anatomical structure and lignin metabolism with lodging resistance of culm in buckwheat. Acta agron. sin. 2014, 40: 1846–1856.
Wang, M., Wang, J.J., Wang, X.D. Effect of KOH-enhanced biochar on increasing soil plant-available silicon. Geoderma, 2018, 321, 22–31.
Wang, Y. F., Liu, Y. X., Lu, H. H. & Yang, S. M. Efect of washing biochar and chemical fertilizers on rice yield and nutrient uptake. Journal of Plant Nutrition and Fertitizer, 2015, 21, 1049–1055 .
Wang, Y. F., Liu, Y. X., Lu, H. H. & Yang, S. M. Efect of washing biochar and chemical fertilizers on rice yield and nutrient uptake. Journal of Plant Nutrition and Fertitizer, 2015, 21, 1049–1055.
Xiao, X., Chen, B.L., Zhu, L.Z. Transformation, morphology, and dissolution of silicon and carbon in rice straw-derived biochars under different pyrolytic temperatures. Environ. Sci. Technol. 2014, 48, 3411–3419.
Xie,G.S. and L.C.Peng. Genetic engineering of energy crops: a strategy for biofuel production in China. J. Integr. Plant Biol. 2011, 53: 143–150.
Zichuan Li a , Zhaoliang Song a, Bhupinder Pal Singh. The impact of crop residue biochars on silicon and nutrient cycles in croplands. Science of the Total Environment, 2019, 659, 673–680.

Table 1

Physical and chemical properties of soil and biochar
	pH	Total N%	Total P%	Total K%	Available silicon (mg/kg)	Exchangeable calcium (mg/g)	Exchangeable magnesium (mg/g)	Organic matter (g/kg)
Soil	6.7	0.144	0.064	1.64	165.5	5.3	0.67	19.5
Biochar	9.3	0.953	0.11	1.69	220.2	10.55	2.87	-

Table 2

Target gene and sequence of qRT-PCR primers
Gene name	Forward primer(5′-3′)	Reverse primer(5′-3′)
Actin1	GAACTGGTATGGTCAAGGCTG	ACACGGAGCTCGTTGTAGAAG
COMT	GAAGGTGGTGGTGGTGGAGT	GCGTTGGCGTAGATGTAGGTG
CCR20	CACCTCCTCGTCTTCGAGTC	GGAGCTTCTGGTTCGACATC
4CL3	CTGAGGCGACCAAGAACAC	CGGTGATTTCTGAGCCTTCTG
PAL	AGGTCAACTCCGTGAACGAC	AGGTCAGCCCGTTGTTGTAG

Table 3

Effects of different biochar application rates on rice morphology-related traits
Cultivar	Treatment	Plant height (cm)	Height of gravity (cm)	Fresh weight of a single stalk (g)	Ear weight (g)	Ear stalk angle (°)	Ear length (cm)
SN265	B1	109.95b	54.68c	16.59b	4.00b	20.44a	18.50b
	B2	118.00a	58.98b	18.54a	4.58ab	12.83bc	19.08ab
	B3	120.77a	60.98a	18.67a	4.74a	16.83ab	19.61a
	B4	120.32a	60.95a	19.39a	4.90a	16.26ab	19.43ab
	B5	118.28a	60.69ab	18.89a	5.13a	9.48c	19.52ab
Akihikari	B1	116.17b	56.84c	12.17b	3.41a	95.35a	22.45a
	B2	119.37ab	57.03c	12.42ab	3.42a	90.12ab	22.64a
	B3	121.55a	58.06bc	13.17a	3.44a	90.80ab	22.91a
	B4	122.60a	59.89a	12.39ab	3.32a	87.33b	22.74a
	B5	121.64a	59.11ab	12.62ab	3.44a	86.44b	22.20a
Different letters in the same row within the same rice means the significant differences in P < 0.05.

Table 4

Effects of different biochar application rates on rice stalk-related traits
Cultivar	Treatment	N3			N4
Cultivar	Treatment	Section length (cm)	Diameter (mm)	Dry weight per unit length (g/cm)	Section length (cm)	Diameter (mm)	Dry weight per unit length (g/cm)
SN265	B1	18.08c	4.48b	0.0160a	13.24b	4.96a	0.0203a
	B2	19.43b	4.65ab	0.0168a	15.06a	5.16a	0.0208a
	B3	19.63b	4.66ab	0.0160a	15.59a	5.17a	0.0210a
	B4	20.09a	4.71ab	0.0153a	14.99a	5.12a	0.0205a
	B5	20.11a	4.82a	0.0145a	14.94a	5.20a	0.0182a
Akihikari	B1	17.02c	3.87a	0.0078a	10.03b	4.50b	0.0120b
	B2	18.70b	4.00a	0.0093a	11.04a	4.71a	0.0137ab
	B3	18.61b	3.95a	0.0088a	10.06b	4.59ab	0.0147a
	B4	20.00b	3.92a	0.0082a	10.89ab	4.65ab	0.0125b
	B5	21.55a	3.99a	0.0088a	11.33a	4.55ab	0.0122b
Different letters in the same row within the same rice means the significant differences in P < 0.05.

Table 5

Effects of different biochar application rates on rice stalk lodging index and related mechanical indexes
Cultivar	Treatment	N3			N4
Cultivar	Treatment	Bending force (g)	Bending moment	Lodging index	Bending force (g)	Bending moment	Lodging index
SN265	B1	0.78c	723.62b	92.87a	1.13b	1131.52b	100.66a
	B2	1.08b	817.53ab	76.27bc	1.40a	1245.41ab	89.16b
	B3	1.23a	862.21a	70.45c	1.48a	1265.19ab	85.03b
	B4	1.00b	896.33a	92.46a	1.35a	1350.79a	100.66a
	B5	1.07b	891.77a	84.57ab	1.38a	1323.38a	96.00a
Akihikari	B1	0.72b	897.54a	128.56ab	1.10d	1180.38b	109.92ab
	B2	0.86a	909.60a	110.67c	1.37a	1263.72a	94.84c
	B3	0.81a	947.39a	119.21bc	1.26b	1302.51a	105.41b
	B4	0.73b	933.28a	128.63ab	1.15cd	1311.59a	114.80a
	B5	0.68b	911.05a	134.71a	1.23bc	1296.82a	106.34b
Different letters in the same row within the same rice means the significant differences in P < 0.05.

Table 6

Effects of different biochar application rates on rice stalk structure
Cultivar	Treatment	Large vascular bundles	small vascular bundles	Area large vascular bundle (mm²)	Area small vascular bundle (mm²)
SN265	B1	31.67c	30.67b	0.0147ab	0.0054b
	B2	33.67b	31.00b	0.0155ab	0.0054b
	B3	35.67a	33.67a	0.0173a	0.0068a
	B4	32.67bc	31.00b	0.0149ab	0.0061ab
	B5	31.67c	31.33b	0.0131b	0.0051b
Akihikari	B1	27.33bc	25.33b	0.0092b	0.0026a
	B2	30.33a	27.33a	0.0094b	0.0027a
	B3	29.67a	27.00ab	0.0102ab	0.0024a
	B4	28.00b	26.00ab	0.0109a	0.0028a
	B5	26.67c	26.00ab	0.0095b	0.0024a
Different letters in the same row within the same rice means the significant differences in P < 0.05.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Moderate Biochar Application and Increases in Lignin and Silicon Concentrations in Stalks Synergistically Enhance Lodging Resistance of Rice

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results And Analysis

Conclusion And Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1