5-Aminolevulinic acid combined with ferrous iron ameliorates scrotal heat stress-induced spermatogenic damage through inhibiting MAPK pathway and inducing CD4+Foxp3+ Treg generation by enhancing HO-1 expression

doi:10.21203/rs.3.rs-2486579/v1

Download PDF

Research Article

5-Aminolevulinic acid combined with ferrous iron ameliorates scrotal heat stress-induced spermatogenic damage through inhibiting MAPK pathway and inducing CD4+Foxp3+ Treg generation by enhancing HO-1 expression

https://doi.org/10.21203/rs.3.rs-2486579/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 22 Apr, 2023

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Objective

to explore whether 5-Aminolevulinic acid combined with ferrous iron(5-ALA/Fe²⁺) could protect testicular tissues damage of mice subjected to heat stress (HS) and provide its underlying mechanisms.

Methods

5-ALA/Fe²⁺ was administered intragastrically to mice for 10 days, then exposed to a scrotal heat stress at 43℃ for 20 minutes on third day. Testes were harvested for morphologic and histopathological examination, oxidative stress, apoptosis, heme oxygenase-1 (HO-1) and inflammation detection. The mitogen-activated protein kinases (MAPK) signaling pathway in testis and CD4⁺FoxP3⁺regulatory T(Treg) cells in spleen were also detected.

Results

Compared to control group, the testis weight decreased and histological damage severed in HS group. Besides, HS also increased the oxidative stress, apoptosis and inflammation in testis. However, these indicators were ameliorated after 5-ALA/Fe²⁺ treatment but deteriorated after receiving ZnPPIX. The expression of HO-1 was increased both in HS group and 5-ALA/Fe²⁺ group. The protein expression levels of MAPK proteins were activated by HS and inhibited by 5-ALA/Fe²⁺. The CD4⁺FoxP3⁺ Treg generation was reduced by HS and increased by 5-ALA/Fe²⁺.

Conclusion

In this study, we have demonstrated that 5-ALA/Fe²⁺ ameliorated the spermatogenic damage induced by scrotal heat stress via up-regulating the expression of HO-1 and inhibiting MAPK mediated oxidative stress and apoptosis and inducing CD4⁺Foxp3⁺ Tregs to inhibit the inflammation induced by HS in mice.

scrotal heat stress

5-Aminolevulinic acid

heme oxygenase-1

MAPK

CD4+Foxp3+ Treg

Heat stress, defined as a stress response induced by high environmental temperature, occurs when the normal thermoregulatory mechanism is overwhelmed by hyperthermia[1]. Spermatogenesis is a temperature-dependent process, to ensure the generation of normal sperm, the testis must be kept 2–4°C below core body temperature[2]. Failure to maintain testicular temperature may result in infertility. Male factor infertility is a major reason in at least 50% of all infertile couples[3], which is commonly related to thermogenic factors, including lifestyle and behavioural influences like extended periods of sitting, occupational and environmental factors such as chefs and welders, and pathophysiological causes such as cryptorchidism[4].

Heat stress damages spermatogenic cells through oxidative stress induced cell apoptosis[5]. Oxidative stress is caused by the imbalances between the reactive oxygen species (ROS) generation and elimination. excessive ROS generation can induce lipid peroxidation and overload cellular antioxidant defenses characterized by the consumption of antioxidants such as glutathione (GSH) and superoxide dismutase (SOD)[6].Furthermore, Oxidative stress can trigger cell apoptosis by damaging DNA, proteins and lipids, thereby disrupting normal cell function[7]. It is proven that expression of the Bcl-2 family members and activation of caspases-3 are involved in the cellular apoptosis and play a significant role in HS induced spermatogenic damage[8]. In addition, HS-induced oxidative stress activates the mitogen-activated protein kinases (MAPKs), damages cell DNA, and phosphorylates the p38 mitogen-activated protein kinase, extracellular signal-regulated kinase (ERK) and C-Jun N-terminal kinase (C-JNK)[9]. Therefore, it is of great importance to find a treatment to ameliorate the spermatogenic damage induced by testicular HS.

5-Aminolevulinic acid (5-ALA) is a naturally occurring amino acid commonly found in bacteria, fungi, plants and animals[10]. Produced by the catalytic action of 5-ALA synthase through the condensation of glycine and succinyl-CoA, 5-ALA is a crucial precursor to heme synthesis in animal cells[11]. 5-ALA is commonly utilized as a photosensitizer precursor to detect and kill tumor cells in photodynamic diagnosis and photodynamic therapy[12]. In addition, extensive studies have demonstrated that 5-Aminolevulinic acid combined with ferrous iron(5-ALA/Fe²⁺) exert anti-inflammatory and anti-oxidative effects by up-regulation the expression of heme oxygenase-1 (HO-1)[13–16].

HO-1 is the rate-limiting enzyme in heme metabolism that produces biliverdin, carbon monoxide (CO) and iron (Fe²⁺). Moreover, it has been found that HO-1 play a pivotal role in anti-inflammatory, anti-apoptotic and anti-oxidative actions[17]. In a lipopolysaccharide (LPS)-induced rat liver injury model, HO-1 alleviates oxidative stress and inflammatory responses through down-regulation of MAPK Signaling Pathways[18]. Besides, CD4⁺FoxP3⁺regulatory T(Treg) cells play an indispensable role in maintaining immunological self-tolerance and ameliorate the deleterious effects in inflammatory reaction[19]. A study demonstrated that a lack of HO-1 severely impairs the suppressive function of Treg cells[20]. 5-ALA/Fe²⁺ has been demonstrated to increase the expression of HO-1[21]. Therefore, 5-ALA/Fe²⁺ may exert its anti-inflammatory, anti-apoptotic and anti-oxidative role through the impact of HO-1 on MAPK signaling pathways and CD4⁺FoxP3⁺ Treg cells. However, no research has been done on how 5-ALA/Fe²⁺ affects the body reacts to testicular HS.

As shown in previous studies, 5-ALA/Fe²⁺ has various beneficial effects for animal and human health.[13, 22, 23] Therefore, this study was conducted to explore whether 5-ALA/Fe²⁺ could protect testicular tissues damage of mice subjected to HS and provide its underlying mechanisms.

2.1Animals

Male ICR mice (8–10 weeks and weighing 35 ± 5 g) were purchased from Department of Laboratory Animal Science Fudan University (Shanghai, China). All mice were maintained under standard conditions and fed rodent food and water. All experimental animal processing procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (Ministry of Science and Technology of China, 2006). All animal experiments were approved by the Ethical Committee of recommendations of Department of Laboratory Animal Science Fudan University (NO. 2017 1325 A253).

2.2Reagents

As described previously[15], 5-ALA/HCl (SBI Pharmaceuticals Co., Ltd., Tokyo, Japan) and Fe²⁺(sodium ferrous citrate, Eisai Food & Chemical, Tokyo, Japan) were dissolved in distilled water (DW), and the molar ratio of 5-ALA to Fe²⁺ was 1:0.5. Fe²⁺ was diluted in DW immediately before administration. Light exposure was limited as much as possible. Zinc protoporphyrin (ZnPPIX; AbMole BioScience,, Houston Tx, USA), an HO-1 inhibitor, were diluted in 100 mM NaOH to form stock solution of 50 mM and were kept at -80°C until use. 5-ALA/ Fe²⁺ was administrated orally in 0.3 ml DW, and the volume of 0.3 ml of ZnPPIX was administered intraperitoneally.

2.3Study design

Mice were randomly divided into the following five Groups(n = 6): Control group (saline for 10 days without HS), HS group (saline for 10 days and HS), HS + 5-ALA/Fe²⁺ (30 mg/kg) group, HS + 5-ALA/Fe²⁺ (100 mg/kg) group, and HS + 5-ALA/Fe²⁺ (100 mg/kg) + ZnPPIX (5 mg/kg) group. Mice were administered with 5-ALA/Fe²⁺ by oral administration daily for 10 days, and ZnPPIX was administered simultaneously with 5-ALA/Fe²⁺. On the third day, under intraperitoneal anesthesia with pentobarbital sodium at 50 mg/kg body weight, all animals except control group underwent a single HS by putting the lower third of the body, including the scrotum, tail, and hind legs into a 43℃ water bath for 20 minutes[24]. The animals were then put on a warm mat to keep them warm until they were completely awakened from the anaesthetic. Seven days after HS, all animals were sacrificed and their testis were collected, weighed and stored at − 80℃.

2.4 Body and testis weight

The body weights of all mice were measured before sacrifice. The testicular weight of each animal was also recorded and photographed after the testes were isolated from the surrounding fat.

2.5 Histopathology

After being photographed, the testes were fixed in 4% paraformaldehyde and embedded in paraffin. For the histopathological evaluation, the tissues were sliced into 5 µm thickness and stained with hematoxylin and eosin(H&E).

2.6 Immunohistochemical analysis

Anti-mouse SOD2 primary antibody (1:100; Abcam, Cambridge, UK) was used to assess antioxidant cellular reserves. Briefly, the 5-µm testis sections were blocked with 5% bovine serum albumin for 35 minutes after being dewaxed and rehydrated. The slices were incubated with primary antibdy overnight at 4℃. After being incubated with an HRP-conjugated secondary antibody for 30 min at room temperature, the slides were stained with DAB and counter-stained with hematoxylin. The positive stain displayed brownish-yellow color under light microscopy. Three random visual fields were analyzed per testis section, and the percentage of the positive area was determined using the Image Pro Plus 6.0 software program.

2.7Oxidative stress assay

Frozen testis tissue was homogenized in ice-cold Nacl solution. The homogenate was centrifuged at 5000g for 15 min at 4℃, and the protein concentration of the supernatant was analyzed using a BCA kit (Beyotime, Shanghai, China).Superoxide dismutase (SOD) activity, glutathione (GSH) level and malondialdehyde (MDA) content in mice testes were measured using commercial kits (Jiancheng Biotechnology, Nanjing, China) according to the manufacturers’ instructions.

In brief, SOD in the testis inhibited WST-1 reduction by catalyzing the dismutation of superoxide ions generated from the xanthine/xanthine oxidase system into molecular oxygen and hydrogen peroxide, which could be measured spectrophotometrically at 450 nm. The total SOD activity was determined by measuring the absorbance at 450 nm and expressed as U/mg.By calculating the absorbance (405nm) of the complex generated by the reaction between glutathione and 5, 5-dithiobis-(2-nitrobenzoic), GSH level (expressed as µmol/g) was determined. Utilizing the thiobarbituric acid method, MDA content (expressed as nmol/mg) was determined by detecting the absorbance at 532nm.

2.8 TUNEL assay

To detect the presence of apoptotic cells in the heat-treated testes, the terminal deoxynucleotidyl transferase-mediated nick end-labeling (TUNEL) method was performed following the manufacturer’s protocol (Beyotime, Shanghai, China). TUNEL positive staining images were captured using a light microscope.

2.9 Quantitative real-time PCR

Total RNA was extracted from mouse testes using Eastep Total RNA Extraction Kit (Promega, WI, USA) according to the manufacturer’s protocol. 2µg of total RNA were reverse-transcribed into cDNA using PrimeScript RT Master Mix (Takara Biomedical Technology, Beijing, China). Real-time PCR was conducted in a 25µL reaction using TB Green Premix Ex Taq (Takara) according to the manufacturer’s instructions. The PCR cycling conditions were 95°C for 2 min, and 40 cycles at 95°C for 15 s, and 60°C for 1 min. GAPDH primers were used as an internal standard for other target genes. The primers used for qRT-PCR are listed in Table 1.

Table 1

Primers used for quantitative real-time PCR
Target gene	Primer(5’—3’)
Target gene	Forward	Reverse
GAPDH	CGTGCCGCCTGGAGAAACC	TGGAAGAGTGGGAGTTGCTGTTG
SOD2	GGAGCAAGGTCGCTTACAGA	GTGCTCCCACACGTCAATC
GPx4	TAAGAACGGCTGCGTGGT	GTAGGGGCACACACTTGTAGG
Caspase3	AAAGCCGAAACTCTTCATCAT	GTCCCACTGTCTGTCTCA
Bcl-XL	TGACCACCTAGAGCCTTGGA	TGTTCCCGTAGAGATCCACAA
IL-6	CTCCCAACAGACCTGTCTATAC	CCATTGCACAACTCTTTTCTCA
IFN-γ	CTTGAAAGACAATCAGGCCATC	CTTGGCAATACTCATGAATGCA
IL-2	TGAGCAGGATGGAGAATTACAG	CAGAGGTCCAAGTTCATCTTCT
TGF-β	CCAGATCCTGTCCAAACTAAGG	CTCTTTAGCATAGTAGTCCGCT
HO-1	TCCTTGTACCATATCTACACGG	GAGACGCTTTACATAGTGCTGT

2.10 Western blot analysis

Testicular tissues were homogenized in RIPA Lysis Buffer (Beyotime, China) with 1mM phenylmethanesulfonyl fluoride (PMSF, Beyotime) and centrifugated at 12,000×g for 10 min at 4°C, and the supernatant was collected. The total protein concentrations of the supernatant were measured using a BCA protein assay kit (Beyotime). Equal amounts of proteins (20µg) was separated by the 4–20% sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE) and transferred onto a polyvinylidene difuoride (PVDF) membranes. The membranes were blocked with 5% non-fat milk powder in Tris-buffered saline (TBS) with 0.1% Tween-20 for 2 hours, and then incubated overnight at 4℃ with primary antibodies: β-Actin(1:5000; SAB, China), HO-1 (1:1,000; CST, USA), Bax (1:1,000; CST, USA), Bcl-2 (1:1,000; CST, USA), caspase-3/Clcaspase-3 (1:1,000; CST, USA), ERK (1:1,000; CST, USA), p-ERK (1:1,000; CST, USA), and p38/p-p38 (1:1,000; CST, USA). After incubating with secondary antibodies for 1 hour at room temperature, the bands were visualized by Emitter Coupled Logic (ECL) substrate (Merck, Germany) and band intensities were assessed with Image J software.

2.11 Flow cytometric (FCM) analysis

Mice Spleens were collected when sacrificed, Spleens were homogenized with a 1ml syringe plunger, and passed through a 70 µm nylon-mesh cell strainer. Red blood cells (RBC) were removed using RBC lysis buffer (eBioscience). Isolated splenocytes were stained with FITC Anti-mouse CD4(Tonbo, USA) and APC Anti-mouse Foxp3(Tonbo, USA) and analyzed on a flow cytometer.

2.12 Statistical analysis

Data are presented as means ± SD and were analyzed statistically using one-way ANOVA followed by Tukey’s multiple comparison test. Results were considered statistically significant at P-values < 0.05.

3.1 Effects of 5-ALA/Fe²⁺ on relative testes weight and histopathological alterations in HS-induced mice testes

Mouse body weights were measured before sacrifice and there was no statistical difference in the body weights of the mice in all groups. However, the testes weight of HS group was significantly decreased compared with the control group (p < .01). Treatment with 30mg/kg 5-ALA/Fe²⁺ slightly increased the relative testes weight of HS mice but there was no significance. Interestingly, the relative testes weight of HS mice received 100 mg/kg 5-ALA/Fe²⁺ for 10 days were considerably higher than that of the HS mice(p < .01). However, ZnPPIX, a HO-1 inhibitor, successfully inhibit the treatment effect of 100 mg/kg 5-ALA/Fe²⁺(p < .01). (Fig. 1a,b)

Histologically, in the testes of control mice, the seminiferous tubules were arranged in a compact and orderly manner, dynamic spermatogenesis could be observed and Leydig interstitial cells in the testis were organized and orderly (Fig. 1c). In contrast, the seminiferous epithelium of mice testes in the HS group had obvious vacuolization and atrophy with disordered arrangement, the layer and number of spermatogenic cells were obviously reduced, sperm formation was not recognized, and the interstitial cells were significantly reduced and disarrayed (Fig. 1c). Moreover, administration of 30mg/kg 5-ALA/Fe²⁺ to HS mice induced a quiet slightly improvement in histopathological findings (Fig. 1c). However, all the testicular structure and seminiferous tubules changes observed in the HS group were ameliorated in the mice treated with 100mg/kg 5-ALA/Fe²⁺ (Fig. 1c). However, administration of ZnPPIX reverse the treatment effect of 100mg/kg 5-ALA/Fe²⁺ (Fig. 1c).

Based on morphological and histopathological findings, we determined 100mg/kg 5-ALA/Fe²⁺ as effective concentration of HS treatment and the 30mg/kg 5-ALA/Fe²⁺ treatment group was removed in subsequent experiments.

3.2 Effects of 5-ALA/Fe²⁺ on oxidative stress in HS-induced mice testes

During testicular heat stress, oxidative stress play a critical role in spermatogenic damage, and whether 5-ALA/Fe²⁺ treatment could ameliorate oxidative damage was investigated.

The effects of 5-ALA/Fe²⁺ on the levels of SOD2 expression in the testis tissues were evaluated by immunohistochemistry analysis (Fig. 2a,b) and quantitative real-time PCR (Fig. 2c).Compared with the control group, the expression of SOD2 in the testis tissues of the HS group was significantly decreased (p < .01). However, treatment with 5-ALA/Fe²⁺ significantly attenuated the decrease (p < .01). In contrast, the ZnPPIX treatment negated the increase induced by 5-ALA/Fe²⁺ (p < .01).

The mRNA level of GPx4 in the testes was measured via quantitative real-time PCR (Fig. 2d). In the HS group, the GPx4 mRNA level in the testes was significantly lower than that of the control group (p < .01). After the treatment of 5-ALA/Fe²⁺, the mRNA level of GPx4 in the testis tissues have improved to 0.74-fold that of the control group (1-fold) (p < .01). However, the mRNA level of GPx4 in the testes decreased to 0.41-fold that of the control group in the ZnPPIX group (p < .01).

In addition, SOD activity and GSH content were evidently reduced in the HS group (Fig. 2e,f), these reductions were significantly ameliorated by treatment with 5-ALA/Fe²⁺ and attenuated after ZnPPIX treatment (p < .01). The MDA levels in the testis tissues were detected as a indicator of oxidant stress (Fig. 2g). In the HS group and HS + ALA/Fe²⁺+ZnPP group, the MDA contents were significantly higher than that of the control group (p < .01). However, the MDA levels in the testes were decreased with 5-ALA/Fe²⁺ treatment in compared with the HS group (p < .01).The above findings revealed that 5-ALA/Fe²⁺ treatments could not only up-regulate the expression of GPx4 and increase the SOD activity and GSH levels, but also significantly reduce the MDA content in HS mice testes.

3.3 Effects of 5-ALA/Fe²⁺ on cell apoptosis in HS-induced mice testes

The spermatogenic cells apoptosis induced by HS was assessed by TUNEL staining assay (Fig. 3a). Compared with the control group, HS mice testes showed more brown color staining of the nucleus around the sperm cells and TUNEL positive cell areas in HS testes were obviously increased. Moreover, 5-ALA/Fe²⁺ treatment significantly reduced the number of TUNEL positive cells compared with the HS group. However, the TUNEL positive cell areas augmented when HS mice received not only 5-ALA/Fe²⁺ but also ZnPPIX treatment.

By using western blot analysis, we subsequently investigated the levels of apoptosis-related protein expression in testis tissues. As shown in Fig. 3b&c, the protein level of cleaved caspase-3 was up-regulated by HS exposure and decreased by 5-ALA/Fe²⁺ treatment (p < .01), it is consistent with the protein level changes of Bax, a pro-apoptotic factor (Fig. 3d,f). Treatment with ZnPPIX suppress the inhibitory effect of 5-ALA/Fe²⁺ in pro-apoptotic factors (p < .01). On the other hand, HS exposure reduced the protein level of anti-apoptotic Bcl-2 while supplement with 5-ALA/Fe²⁺ significantly improved the Bcl-2 expression (Fig. 3d,e). However, the improvement induced by 5-ALA/Fe²⁺ treatment was inhibited via ZnPPIX treatment (p < .01).These results clearly proved that 5-ALA/Fe²⁺ treatment inhibited HS-induced apoptosis in testicular tissues.

3.4 Effects of 5-ALA/Fe²⁺ on HO-1 expression and MAPK signaling pathways in HS-induced mice testes

The HO-1 protein level was detected by western blot analysis (Fig. 4a,b). In the HS group, the HO-1 protein level in mice testes was significantly increased compared with that of the control group (p < .01). Interestingly, treatment with 5-ALA/Fe2 + induced more HO-1 expression than HS exposure (p < .01). However, when receiving ZnPPIX treatment, the protein level of HO-1 evidently decreased (p < .01). We also determined the mRNA expression of HO-1by quantitative real-time PCR (Fig. 4c), the results indicated that the changes in the mRNA expression of HO-1 gene were in accordance with the HO-1 protein expression.

In order to illuminate the molecular mechanism underlying the effect of 5-ALA/Fe²⁺ on HS-induced spermatogenic damages in mice, the protein levels of p-ERK/ERK and p-p38/p38 was detected by western blot analysis (Fig. 4d-f). The expressions of ERK and p-38 phosphorylation proteins increased in the HS exposure mice testes compared with the control mice testes (p < .01). In contrast, the expressions of ERK and p-38 phosphorylation proteins increased after ZnPPIX treatment compared with that of 5-ALA/Fe²⁺ treatment group.

These results indicate that HS could over-activated MAPK signaling pathway to induce spermatogenesis disorders and treatment with 5-ALA/Fe²⁺ executed protective effects by inhibiting MAPK signaling pathway.

3.5 Effects of 5-ALA/Fe²⁺ on inflammatory cytokines in HS-induced mice testes

Quantitative real-time PCR was utilized to measure the mRNA expression of inflammatory cytokines in mice testes (Fig. 5). The mRNA levels of IL-6, IFN-γ and IL-2 were increased after HS relative to control mice tissue levels (p < .01). Treatment with 5-ALA/Fe²⁺ significantly decreased the mRNA expression levles of IL-6, IFN-γ and IL-2 (p < .01). The addition of ZnPPIX inhibited the reduction of mRNA levels of IL-6, IFN-γ and IL-2 induced by 5-ALA/Fe²⁺ treatment (p < .01).

3.6 Effects of 5-ALA/Fe ²⁺ on CD4⁺FoxP3⁺ Treg in spleen and TGF-β expression in HS-induced mice testes

The proportion of CD4⁺Foxp3⁺ Treg among lymphocytes in spleen was detected by FCM analysis (Fig. 6a,b). The proportion of CD4⁺Foxp3⁺ Treg was decreased in HS group and increased after 5-ALA/Fe²⁺ treatment (p < .01). When treated with ZnPPIX, the proportion of CD4⁺Foxp3⁺ Treg was reduced compared with the 5-ALA/Fe²⁺ treatment group (p < .01).The mRNA expression of TGF-β in mice testes was determined by quantitative real-time PCR (Fig. 6c). Among the 5-ALA/Fe²⁺ treated mice, there was a significantly higher expression of TGF-β than that of HS group (p < .01). After ZnPPIX treatment, the mRNA expression of TGF-β was reduced to the level of that of HS group.

These findings suggested that 5-ALA/Fe²⁺ treatment induced CD4⁺Foxp3⁺ Treg in mice spleen and increased the expression of TGF-β in mice testes.

In recent years, testicular heat stress has been confirmed to be a major hazard in reducing male fertility, and it is also the most underappreciated pathogenic factor[25]. Hyperthermia in testis increases testicular metabolism without a commensurate increase in blood supply and may cause local hypoxia, damaging testicular tissue[26]. Many other researches have demonstrated that 5-ALA/Fe²⁺ exerted protective effects in acute injury and inflammatory diseases by inhibiting oxidative stress and apoptosis in mouse models[15, 16, 27]. In the present study, we investigated the protective effects of 5-ALA/Fe²⁺ against HS-induced testicular damage in an established mice HS model.

Testicular heat stress causes the vacuolization of seminiferous epithelium, reduction of spermatogenic cells and disappearance of spermatogenesis[28]. In a renal ischemia-reperfusion injury mice model, 5-ALA/Fe²⁺ has been proved it could ameliorate tubular dilation, vacuolization and necrosis[15]. Likewise, in our current work, the testicular histological changes induced by HS was attenuated through 5-ALA/Fe²⁺ treatment.

SOD2 is a detoxifying enzyme found in the mitochondria that catalyzes the conversion of superoxide to hydrogen peroxide. Glutathione peroxidase then converts hydrogen peroxide to water by using glutathione (GSH) as an electron source[29]. SOD2 and other enzymes involved in antioxidant defense play a vital role in protecting cells from ROS. In the current work, we demonstrated that 5-ALA/Fe²⁺ treatment (100 mg/kg) improved the expression of SOD, GPx4, and GSH in mice testes. MDA is one of the products of lipid peroxidation, and its concentration can reflect the degree of cell damage and is one of the biomarkers of oxidative stress[30]. In our present study, MDA production was inhibited by 5-ALA/Fe²⁺ treatment. These results illuminated that 5-ALA/Fe²⁺ could ameliorate the oxidative stress induced by testicular HS.

The first noticing changes in HS testis is the atrophy of testis and loss in testicular weight, which can be ascribed to germ cell apoptosis. As showed in this experiment, the anti-apoptotic impact of 5-ALA/Fe2 + on HS-induced germ cell death was initially confirmed by TUNEL assay. The B-cell lymphoma-2(Bcl-2) family proteins, including the pro-apoptotic protein such as Bax and anti-apoptotic protein such as Bcl-2, mainly regulate mitochondria-mediated endogenous pathways of apoptosis[31]. Moreover, HS could activate caspase cascade reaction through the mitochondrial pathway of apoptosis mechanism and lead to DNA damage and apoptosis[32]. In the current study, we demonstrated that 5-ALA/Fe²⁺ treatment ameliorates the expressions of Bax, Bcl-2 and cleaved caspase-3/caspase-3, indicated that 5-ALA/Fe²⁺ has potential capacity to ameliorate HS-induced testicular apoptosis.

In the testicular seminiferous tubules, Sertoli cells not only provide the necessary microenvironment for the differentiation and development of spermatogenic cells but also form the blood-testis barrier to prevent immunogenic spermatogenic cells from contacting the body and causing immune rejection[33]. Cytokines form a complex cytokine network locally in the testis and regulate the local immune function of the testis[34]. Heat stress disrupts the balance between anti-inflammatory cytokines and pro-inflammatory cytokines, resulting in disturbance of immune homeostasis[35]. IL-6, IL-2 and IFN-γ are important inflammatory factors commonly detected in aseptic inflammation of the testis[36]. In the present work, we measured the expression level of IL-6, IL-2 and IFN-γ in mice testes and the results indicated that inflammatory reaction in the testis was induced by HS and 5-ALA/Fe²⁺ treatment significantly inhibited the inflammatory reaction. However, a study have reported that the expression of IL-6 and TNF-α did not change within 1–14 weeks after a single heat treatment in mouse testis[37]. It might can be explained by the heat susceptibility differences between rat and mouse.

HO-1 is of great importance in anti-oxidative, anti-inflammatory and anti-apoptosis effects of 5-ALA/Fe²⁺. As a antioxidant defence enzymes in the body, HO-1 increases to inhibit the oxidative stress induced by testicular HS, it is accordant with previous study. When receiving 5-ALA/Fe²⁺ treatment, the expression level of HO-1 further increased. Previously studies demonstrated that MAPK signaling pathway have the capacities to change the expression of various oxidative enzymes and participate in apoptosis[38]. We supposed that the MAPK signaling pathway may ameliorate oxidative stress and apoptosis induced by testicular HS. As shown in this study, the phosphorylated protein levels of ERK and p38 were increased in HS mice and reduced by giving 5-ALA/Fe²⁺. Early studies have proven that 5-ALA/Fe²⁺ up-regulate the expression of HO-1 via ERK and p38 MAPK pathways[21]. However, in the current work, we demonstrated that excessive HO-1 expression could inhibit the MAPK signaling pathway.

The apoptosis of spermatogenic cells can release endogenous ligands and induce endogenous inflammatory responses[39]. In addition, the abnormal structure and permeability of the blood-testis barrier may lead to the destruction of the immune-privileged barrier, which in turn induces the autoimmune response[40]. CD4⁺FoxP3⁺ Treg play an immunosuppressive effect in autoimmune diseases[19]. Thus, we investigated the generation of CD4⁺FoxP3⁺ Treg in mice spleen. The results indicated that 5-ALA/Fe²⁺ treatment promoted CD4 + T cells differentiation to CD4⁺FoxP3⁺ Treg and increased the expression of TGF-β in mice testis. It is therefore possible that 5-ALA/ Fe²⁺-induced CD4⁺FoxP3⁺ Treg inhibit the immune response against HS. The administration of HO-1 inhibitor ZnPPIX counteracted all the protective effects mentioned above induced by 5-ALA/ Fe²⁺, which demonstrated that 5-ALA/ Fe²⁺ exerted protective effects by enhancing HO-1 expression. Here, we preliminarily conceive a mechanism of 5-ALA/ Fe²⁺ to alleviate spermatogenesis damage caused by testicular HS (Fig. 7).

In the current work, we have demonstrated that 100mg/kg 5-ALA/Fe²⁺ ameliorated the spermatogenic damage induced by scrotal heat stress via up-regulating the expression of HO-1 and inhibiting MAPK mediated oxidative stress and apoptosis and inducing CD4⁺Foxp3⁺ Tregs to inhibit the inflammation induced by HS in mice. Our findings may provide a new strategy for the treatment of heat induced male infertility and offer new ideas for the application of 5-ALA/Fe²⁺.

Acknowledgments

All the authors are sincerely grateful to their respective universities and institutes for their technical assistance and valuable support in the completion of this research project.

Statements & Declarations

Funding: This research was funded by a grant-in-aid from the national natural science foundation of China (81771683) and the Program to Correct Highly Deficient Areas in Shanghai's Healthcare System-Psychosomatic medicine (Grant No.2019ZB0203).There are no financial conflicts of interest to disclose.

Author contributions: JGH designed the experiments, provided funding for the study and revised the manuscript. PG performed the research, data analysis, and manuscript writing. JMZ and HRC contributed to the analysis and interpretation of data. All authors read and approved the final manuscript for publication.

Competing interests: All authors declare no competing interests.

Ethics approval: All experimental animal processing procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (Ministry of Science and Technology of China, 2006). All animal experiments were approved by the Ethical Committee of recommendations of Department of Laboratory Animal Science Fudan University (NO. 2017 1325 A253). This article does not contain any studies with human participants performed by any of the authors.

Data Availability Statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Morrell, J.M., Heat stress and bull fertility. Theriogenology, 2020. 153: p. 62-67.
Wang, C., et al., Effect of increased scrotal temperature on sperm production in normal men. Fertil Steril, 1997. 68(2): p. 334-9.
Hou, Y., et al., Heat-stress-induced metabolic changes and altered male reproductive function. J Proteome Res, 2015. 14(3): p. 1495-503.
Kumar, N. and A.K. Singh, Trends of male factor infertility, an important cause of infertility: A review of literature. J Hum Reprod Sci, 2015. 8(4): p. 191-6.
Xu, H., et al., Xanthine oxidase-mediated oxidative stress promotes cancer cell-specific apoptosis. Free Radic Biol Med, 2019. 139: p. 70-79.
Lushchak, V.I., Free radicals, reactive oxygen species, oxidative stress and its classification. Chem Biol Interact, 2014. 224: p. 164-75.
Slimen, I.B., et al., Reactive oxygen species, heat stress and oxidative-induced mitochondrial damage. A review. Int J Hyperthermia, 2014. 30(7): p. 513-23.
Crompton, M., et al., Mitochondrial intermembrane junctional complexes and their involvement in cell death. Biochimie, 2002. 84(2-3): p. 143-52.
Yao, C.L. and G.N. Somero, The impact of acute temperature stress on hemocytes of invasive and native mussels (Mytilus galloprovincialis and Mytilus californianus): DNA damage, membrane integrity, apoptosis and signaling pathways. J Exp Biol, 2012. 215(Pt 24): p. 4267-77.
Kang, Z., et al., Recent advances in microbial production of δ-aminolevulinic acid and vitamin B12. Biotechnol Adv, 2012. 30(6): p. 1533-42.
Ishizuka, M., et al., Novel development of 5-aminolevurinic acid (ALA) in cancer diagnoses and therapy. Int Immunopharmacol, 2011. 11(3): p. 358-65.
Chouikrat, R., et al., Non polymeric nanoparticles for photodynamic therapy applications: recent developments. Curr Med Chem, 2012. 19(6): p. 781-92.
Fujino, M., et al., 5-Aminolevulinic acid regulates the inflammatory response and alloimmune reaction. Int Immunopharmacol, 2016. 37: p. 71-78.
Shimura, M., et al., Effects of 5-aminolevulinic acid and sodium ferrous citrate on fibroblasts from individuals with mitochondrial diseases. Sci Rep, 2019. 9(1): p. 10549.
Hou, J., et al., 5-Aminolevulinic acid combined with ferrous iron induces carbon monoxide generation in mouse kidneys and protects from renal ischemia-reperfusion injury. Am J Physiol Renal Physiol, 2013. 305(8): p. F1149-57.
Hou, J., et al., 5-Aminolevulinic acid with ferrous iron induces permanent cardiac allograft acceptance in mice via induction of regulatory cells. J Heart Lung Transplant, 2015. 34(2): p. 254-63.
Camara, N.O. and M.P. Soares, Heme oxygenase-1 (HO-1), a protective gene that prevents chronic graft dysfunction. Free Radic Biol Med, 2005. 38(4): p. 426-35.
Tang, J., et al., Upregulation of HO-1 with Haemin Alleviates LPS-Stimulated Pro-inflammatory Responses Through Downregulation of p38 Signalling Pathways in Rat Liver. Scand J Immunol, 2015. 82(5): p. 443-51.
Baecher-Allan, C. and D.A. Hafler, Human regulatory T cells and their role in autoimmune disease. Immunol Rev, 2006. 212: p. 203-16.
Zelenay, S., et al., Heme oxygenase-1 is not required for mouse regulatory T cell development and function. Int Immunol, 2007. 19(1): p. 11-8.
Nishio, Y., et al., 5-Aminolevulinic acid combined with ferrous iron enhances the expression of heme oxygenase-1. Int Immunopharmacol, 2014. 19(2): p. 300-7.
Kuno, T., et al., 5-Aminolevulinic acid has the potential to prevent bladder dysfunction in cyclophosphamide-induced hemorrhagic cystitis. Int J Urol, 2022. 29(8): p. 897-904.
Ahrens, L.C., et al., Effect of 5-Aminolevulinic Acid and Sodium Fluorescein on the Extent of Resection in High-Grade Gliomas and Brain Metastasis. Cancers (Basel), 2022. 14(3).
Lin, C., et al., Curcumin dose-dependently improves spermatogenic disorders induced by scrotal heat stress in mice. Food Funct, 2015. 6(12): p. 3770-7.
Bedford, J.M., Human spermatozoa and temperature: the elephant in the room. Biol Reprod, 2015. 93(4): p. 97.
Reyes, J.G., et al., The hypoxic testicle: physiology and pathophysiology. Oxid Med Cell Longev, 2012. 2012: p. 929285.
Zhao, M., et al., 5-aminolevulinic acid combined with sodium ferrous citrate ameliorates H2O2-induced cardiomyocyte hypertrophy via activation of the MAPK/Nrf2/HO-1 pathway. Am J Physiol Cell Physiol, 2015. 308(8): p. C665-72.
Setchell, B.P., The Parkes Lecture. Heat and the testis. J Reprod Fertil, 1998. 114(2): p. 179-94.
Minig, V., et al., Identification of DDB2 protein as a transcriptional regulator of constitutive SOD2 gene expression in human breast cancer cells. J Biol Chem, 2009. 284(21): p. 14165-76.
Tangvarasittichai, S., Oxidative stress, insulin resistance, dyslipidemia and type 2 diabetes mellitus. World J Diabetes, 2015. 6(3): p. 456-80.
Chipuk, J.E., et al., The BCL-2 family reunion. Mol Cell, 2010. 37(3): p. 299-310.
Said, T.M., et al., Role of caspases in male infertility. Hum Reprod Update, 2004. 10(1): p. 39-51.
Gerber, J., J. Heinrich, and R. Brehm, Blood-testis barrier and Sertoli cell function: lessons from SCCx43KO mice. Reproduction, 2016. 151(2): p. R15-27.
França, L.R., et al., The Sertoli cell: one hundred fifty years of beauty and plasticity. Andrology, 2016. 4(2): p. 189-212.
Wan, X., et al., Dietary enzymatically treated Artemisia annua L. improves meat quality, antioxidant capacity and energy status of breast muscle in heat-stressed broilers. J Sci Food Agric, 2018. 98(10): p. 3715-3721.
Kumar, S.S., K. Manna, and A. Das, Tender coconut water attenuates heat stress-induced testicular damage through modulation of the NF-κB and Nrf2 pathways. Food Funct, 2018. 9(10): p. 5463-5479.
Aldahhan, R.A., et al., Acute heat-treatment disrupts inhibin-related protein production and gene expression in the adult rat testis. Mol Cell Endocrinol, 2019. 498: p. 110546.
Ki, Y.W., et al., JNK and p38 MAPK regulate oxidative stress and the inflammatory response in chlorpyrifos-induced apoptosis. Toxicol Lett, 2013. 218(3): p. 235-45.
Riccioli, A., et al., Sertoli cells initiate testicular innate immune responses through TLR activation. J Immunol, 2006. 177(10): p. 7122-30.
Cheng, C.Y. and D.D. Mruk, The blood-testis barrier and its implications for male contraception. Pharmacol Rev, 2012. 64(1): p. 16-64.

Download PDF

Journal Publication

published 22 Apr, 2023

Read the published version in Molecular Biology Reports →

Editorial decision: Minor Revisions Needed
15 Mar, 2023
Reviewers agreed at journal
06 Feb, 2023
Reviewers invited by journal
06 Feb, 2023
Editor assigned by journal
01 Feb, 2023
First submitted to journal
30 Jan, 2023

You are reading this latest preprint version

5-Aminolevulinic acid combined with ferrous iron ameliorates scrotal heat stress-induced spermatogenic damage through inhibiting MAPK pathway and inducing CD4+Foxp3+ Treg generation by enhancing HO-1 expression

Status:

Journal Publication

Version 1

Abstract

Objective

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

2.1Animals

2.2Reagents

2.3Study design

2.4 Body and testis weight

2.5 Histopathology

2.6 Immunohistochemical analysis

2.7Oxidative stress assay

2.8 TUNEL assay

2.9 Quantitative real-time PCR

2.10 Western blot analysis

2.11 Flow cytometric (FCM) analysis

2.12 Statistical analysis

Results

3.1 Effects of 5-ALA/Fe²⁺ on relative testes weight and histopathological alterations in HS-induced mice testes

3.2 Effects of 5-ALA/Fe²⁺ on oxidative stress in HS-induced mice testes

3.3 Effects of 5-ALA/Fe²⁺ on cell apoptosis in HS-induced mice testes

3.4 Effects of 5-ALA/Fe²⁺ on HO-1 expression and MAPK signaling pathways in HS-induced mice testes

3.5 Effects of 5-ALA/Fe²⁺ on inflammatory cytokines in HS-induced mice testes

Discussion

Conclusion

Declarations

References

Status:

Journal Publication

Version 1

5-Aminolevulinic acid combined with ferrous iron ameliorates scrotal heat stress-induced spermatogenic damage through inhibiting MAPK pathway and inducing CD4+Foxp3+ Treg generation by enhancing HO-1 expression

Status:

Journal Publication

Version 1

Abstract

Objective

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

2.1Animals

2.2Reagents

2.3Study design

2.4 Body and testis weight

2.5 Histopathology

2.6 Immunohistochemical analysis

2.7Oxidative stress assay

2.8 TUNEL assay

2.9 Quantitative real-time PCR

2.10 Western blot analysis

2.11 Flow cytometric (FCM) analysis

2.12 Statistical analysis

Results

3.1 Effects of 5-ALA/Fe2+ on relative testes weight and histopathological alterations in HS-induced mice testes

3.2 Effects of 5-ALA/Fe2+ on oxidative stress in HS-induced mice testes

3.3 Effects of 5-ALA/Fe2+ on cell apoptosis in HS-induced mice testes

3.4 Effects of 5-ALA/Fe2+ on HO-1 expression and MAPK signaling pathways in HS-induced mice testes

3.5 Effects of 5-ALA/Fe2+ on inflammatory cytokines in HS-induced mice testes

Discussion

Conclusion

Declarations

References

Status:

Journal Publication

Version 1

3.1 Effects of 5-ALA/Fe²⁺ on relative testes weight and histopathological alterations in HS-induced mice testes

3.2 Effects of 5-ALA/Fe²⁺ on oxidative stress in HS-induced mice testes

3.3 Effects of 5-ALA/Fe²⁺ on cell apoptosis in HS-induced mice testes

3.4 Effects of 5-ALA/Fe²⁺ on HO-1 expression and MAPK signaling pathways in HS-induced mice testes

3.5 Effects of 5-ALA/Fe²⁺ on inflammatory cytokines in HS-induced mice testes