Determining the Earliest Growth Stage to Detect the Presence of Endophytes in Tall Fescue and Perennial Ryegrass Seedlings Using Molecular Markers

doi:10.21203/rs.3.rs-2497028/v1

Download PDF

Method Article

Determining the Earliest Growth Stage to Detect the Presence of Endophytes in Tall Fescue and Perennial Ryegrass Seedlings Using Molecular Markers

https://doi.org/10.21203/rs.3.rs-2497028/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Tall fescue and perennial ryegrass are important cool-season forage and amenity grasses. Both types of grass have a mutualistic association with an endophytic fungus. Novel endophytes, non-toxic to livestock, have been bred in association with elite cultivars of the two species. It is critically important for producers to ensure that their seeds have an adequate level of endophyte-infection. There are different ways to test for endophyte presence and toxicity. Immunoblot tests have been commonly used but molecular markers have been developed that can be used as well. The goal of this research was to identify the earliest growth stage endophyte presence in tall fescue and perennial ryegrass can be successfully detected following seed germination using molecular markers as compared to immunoblot tests. We also sought to test an in-house primer, lolF, against a housekeeping gene marker, tef1exon, for endophyte detection.

Results

We found that molecular marker detection is limited at 14 DAG as there are not enough mycelia in the leaf tissue for DNA extraction and PCR to be carried out. Molecular markers can be reliably used at 28 DAG and later, whereas immunoblot testing can be done as early as 14 DAG. We find that at the time points when they can be reliably tested, molecular markers are comparable to the immunoblot assay in identifying endophyte presence. We also found that lolF is equal in endophyte detection to tef1exon in tall fescue but is not effective in perennial ryegrass.

Conclusions

Immunoblot assays identify endophyte presence at the earliest time point. Molecular markers can be reliably used at 28 days post germination and later. These findings provide researchers and producers with useful information that help them decide when and how to test their populations for endophytes.

Endophyte

Tall Fescue

Immunoblot Assay

Molecular Markers

Forages are pivotal building blocks for livestock operations as they provide the fundamental nutrition that grazing animals require. Among forage species, cool-season grasses are widespread globally. These grasses are grazed directly on pastures or stored as hay, silage, and balayage.

Tall fescue is widely grown in the United States and Europe for forage production and is planted on over 37 million acres of grazing land in the United States (Rogers & Locke, 2013 (1)). Tall fescue has a symbiotic relationship with an endophytic fungus (Epichloe coenophiala, E. sp. FaTG-2, E. sp. FaTG-3, & E. sp. FaTG-4) (Young et al., 2014 (2)). The endophyte confers many benefits to the grass such as biotic and abiotic stress tolerance; however, it can also be toxic to mammals. The different resistances and toxicities are due to alkaloids that the endophyte produces. Most cool season grass inhabiting endophytes can produce four classes of alkaloids: ergot alkaloids, indole diterpenes, lolines and peramines, each of which are associated with conferring different resistances to the host (Young et al., 2014 (2)). Fescue toxicosis is a serious health issue that affects livestock feeding on endophyte-infected tall fescue that is thought to be caused by ergot alkaloids. Fescue toxicosis causes between $500 million to $1 billion in losses annually for the US beef industry (Browning, 2003 (3)).

Perennial ryegrass (Lolium perenne) is another cool-season forage grass, highly utilized in New Zealand and Australia ("Ryegrass," 2022 (4)). Perennial ryegrass is commonly associated with the endophyte Epichloe festucae var. lolli, although other endophyte species have been found to be associated with it as well (Moon et al., 2004 (5)). The perennial ryegrass endophyte has similar alkaloid makeup to that of tall fescue endophytes. Perennial ryegrass is known for causing a neurologic disorder in sheep called “ryegrass staggers” believed to be caused by the toxic compound lolitrem B. Lolitrem B is an indole-diterpene alkaloid and is more associated with perennial ryegrass than tall fescue (Philippe, 2016 (6)).

Commercial tall fescue cultivars have been developed by screening endophytes for ergot alkaloids and then testing non-toxic strain compatibility with an elite cultivar. These non-toxic endophytes are often referred to as ‘novel’. An example of this is Jesup MaxQ tall fescue. Jesup is an endophyte-free cultivar of tall fescue that was found to be compatible with a non-toxic endophyte AR542 originating from the Mediterranean region (Bouton et al., 2002 (7)). Similar processes have been conducted with perennial ryegrass and E. festucae var. Lolli where they screen for endophytes that do not produce ergot alkaloids or lolitrem B. The non-toxic endophyte AR1 is the most utilized novel endophyte for perennial ryegrass breeding (Bluett et al., 2005 (8)).

It is very important for forage producers to know the endophyte infection status and level of their population. Producers who use novel endophyte-infected tall fescue need to ensure that their seed is at least 70% infected (Komatsu & Yanagawa (9) Pirelli et al., 2016 (10)). Maintaining the infection level and preservation of the endophyte in tall fescue or perennial ryegrass seed are difficult. Endophytes in tall fescue and perennial ryegrass are vertically transmitted. The endophyte migrates up through the host grass stem to the seed head where it colonizes the seed (Gagic et al., 2018 (11)). Epichloe coenophiala and E. festucae var. lolli are asexual and do not have an opportunity to infect a new plant unlike some other horizontally transmitted Epichloe species such as E. typhina (Bacon et al., 1977 (12)). High-seed infection relies on a high frequency of infected plants in a base population. Preservation of the fungus is also challenging as the endophyte loses viability when the seed is not stored properly. Testing is a necessity for forage breeders and producers in a variety of scenarios. Given the asexual nature of the endophyte, once established, a host grass-endophyte relationship can be quite stable (Hill, 1994 (13)). Progeny testing is still vital, however, due to the extent to which other variables may affect vertical transmission. Even in a stable population, environmental factors can decrease transmission. Early endophyte testing becomes even more important for breeders looking at experimental endophyte-host combinations. Endophytes are highly host-specific and often have incompatibility issues when introduced into new genetic backgrounds of the same host species. Early testing will allow breeders to quickly identify combinations that are incompatible and discard them. It will also allow seed producers to quickly address issues with transmission prior to seed distribution to growers.

There are a few different ways to determine endophyte presence within a plant including enzyme-linked immunosorbent assays (ELISA), microscopy, and High-Performance Liquid Chromatography (Ahmad et al., 2019 (14)). ELISA assays used to be more common for endophyte detection but require technical skills and laboratory equipment (Hiatt et al., 1999 (15)). A monoclonal antibody-based immunoblot assay was developed in the late 1990s as an alternative to polyclonal antibody-based assay and ELISA testing.

Immunoblot assays are a commonly used way to identify endophyte presence in cool-season grasses (Ahmad et al., 2019 (14)).

Molecular markers that target different genes in the endophyte have also been developed via targeted sequencing. Markers can be used to identify the alkaloid makeup of the endophyte as well as endophyte presence. Gene clusters have been identified for ergot alkaloids, such as lolines and indole diterpenes. Each cluster contains 11 genes and peramine only has one gene associated. Tef1exon is a marker for the gene translation elongation factor 1-ɑ (tefA) a housekeeping gene that functions to transport aminoacyl tRNA to ribosomes. It is commonly used in fungi for identification and is considered a good presence/absence marker for endophyte detection in grasses (Song & Nan, 2015 (16); Wang et al., 2022 (17)).

Lolines are abundant in E. coenophiala and E. FaTG-2 (Takach & Young, 2014 (18)) and are desirable alkaloids in that deter insects while not negatively impacting grazing livestock. LolF is one of the 11 genes that can be found in the LOL locus (Pan et al., 2014 (19)). LolF is found early in the loline biosynthesis pathway, prior to the production of 1-acetamidopyrrolizidine. LolF has a predicted function of encoding for FAD-binding monooxygenases and is thought to be necessary for pyrrolizidine production ("Q5MNI7: LOLF1_EPIUN," 2022 (20); Schardl et al., 2007 (21); Spiering et al., 2005 (22)). Markers from different parts of the loline biosynthesis pathway have been developed and utilized to genotype endophyte alkaloid content (Takach & Young, 2014 (18)).

With this study, we aim to identify the earliest stage endophyte presence in tall fescue and perennial ryegrass can be effectively detected following germination using two methods: molecular markers and immunoblot assays. This allows us to compare the efficacy of each method. Providing this information will allow producers to make the most informed choice in choosing an endophyte detection method.

LolF as a presence/absence marker:

One goal of this study was to determine if the in-house primer sequence for lolF would work well as a presence/absence marker in our tall fescue commercial cultivars (Fig. 2). While some variation did occur, the tall fescue cultivars showed no significant differences in bands present between the two marker types and variations did not show a trend for one marker working better than the other. However, this only holds true for the tall fescue cultivars. LolF did not show any bands for any of the Remington time points.

Earliest Stage of Detection- Molecular Maker vs. Immunoblot:

We see that there were significant differences between the percent endophytes detected by any of the detection methods, time points, or cultivars when comparing the immunoblot data to the tef1exon marker data as well as significant interactions (Table 1). Post hoc analysis shows us that the immunoblot assay and tef1exon marker are comparable as detection methods at 28 DAG or later, while day 14 is significantly different from either time point. For the perennial ryegrass cultivar, Remington NE, the molecular marker tef1exon detected a significantly lower percentage of endophytes than the immunoblot test (P= 4.31e-05, F_1,12=38.945) (fig. 4).

Table 1. Results of ANOVA conducted in R

	Df	Sum Sq	Mean Sq	F-value	Pr(> F)
Detection	1	9852	9852	136.317	< 2e-16 ***
Cultivar	5	84666	16933	234.300	< 2e-16 ***
Time	2	18444	9222	127.602	< 2e-16 ***
Detection: Cultivar	5	15321	3064	42.399	< 2e-16 ***
Detection: Time	2	5652	2826	39.104	3.18e-12 ***
Cultivar: Time	10	15142	1514	20.952	< 2e-16 ***
Detection: Cultivar: Time	10	3955	396	5.473	5.33e-06 ***
Residuals	72	5204	72

When considering the immunoblot data over the time points, we notice that all cultivars maintain a similar level of endophyte infection detected except for the cultivar BarOptima (Fig. 5). BarOptima shows a lower percent detected at 14 DAG. This may indicate that the endophyte takes longer to proliferate in the BarOptima host to reach detectable levels. When we examine the endophyte percentage detected by immunoblot, we see that it does vary significantly by cultivar (P = < 2e-16, F_5,66= 164.5), but not by time point. This indicates that each cultivar has a different level of infection, but, apart from BarOptima, the infection rate maintains over time (Fig. 5A).

The main goal of this work was to compare immunoblot assays to molecular markers testing for endophyte infection levels in tall fescue and perennial ryegrass at different time points. We found that immunoblot testing is more efficient at the early seedling stage with higher detection rates, but that markers work well after about four weeks following seed germination. Marker detection rates peak at 42 days post germination, except for Remington with marker Tef1exon. Both options have other advantages and disadvantages. Immunoblot assays are easy to use and can successfully conduct the test. The kits can be used as soon as there is enough tiller tissue growth to be placed on the nitrocellulose membrane 14 DAG.

Which method of testing for endophytes in tall fescue is best is an individual decision made by the producer based on their specific goals. Molecular markers are used extensively for where there are lab equipment and reagents are readily available. Reagent and equipment availability could render use of molecular markers a better choice in research settings. There is no specialized equipment needed to conduct the immunoblot procedure. Hence the immunoblot assay may be a better option for routine screening of samples. Both markers and immunoblot testing are highly reliable detection methods with their own benefits and downsides.

Perennial ryegrass may be more accurately tested with immunoblot assays than with tef1exon. This information is somewhat surprising as tef1exon targets a housekeeping gene that is present in both asexual and sexual Epichloe species and has been used for identification and phylogenetics in perennial ryegrass (Hettiarachchige et al., 2015 (23)). van Zijll de Jong et al. (2008 van Zijll de Jong, Smith (24), conducted a study to test the effectiveness of different SSR markers specific to E. lolli in Tolosa perennial ryegrass and found that the markers were comparable to the immunoblot assay. If one wants to use markers for endophyte detection in perennial ryegrass, screening different primers than the LolF and tef1 exon are warranted.

A sub-goal of this research project was to analyze one of several in-house designed primers, lolF for use as a presence/absence marker in tall fescue and perennial ryegrass. We found that lolF could be used reliably in testing for the presence of endophytes in tall fescue commercial cultivars. Lolines are present in most E. coenophiala strains tested making it a viable option for a presence marker (Young et al., 2014 (2)). However, when testing for a strain with an unknown alkaloid composition, it would be better to use a housekeeping marker or many alkaloid markers in multiplex. The primer lolF could not be used in Remington NE1 perennial ryegrass. This is likely due to the Remington NE1 endophyte lacking loline alkaloids, as usually is the case for Perennial Ryegrass-associated endophytes. Perennial ryegrass artificially infected with a loline-producing endophyte, such as E. coenophiala, will produce lolines, but Epichloe festucae var. lolli does not typically produce loline alkaloids (Easton et al., 2006 (25); Kemp et al., 2007 (26); Rowan & Latch, 1994 (27)). While we validated that lolF works well in cultivars that have endophytes with loline alkaloids, the safest option for presence/absence identification in an endophyte/host of unknown alkaloid makeup would be to use a housekeeping marker such as tef1exon.

The central goal of this study was to determine the earliest growth stage in which molecular markers could be reliably used to detect the presence or absence of endophytes in commercial varieties of E + tall fescue and one variety of E + perennial ryegrass in comparison to immunoblot testing. We found that 28 DAG was the time point where there is enough tissue on which to conduct DNA extraction and PCR. Immunoblot testing can be carried out as soon as there is sufficient psuedostem to leave a readable imprint on the nitrocellulose membrane This study found that the immunoblot procedure could detect endophyte within 14 DAG. We found that in tall fescue the molecular markers detected a comparable percentage of endophytes detected as the immunoblot assays. It is important to note, however, that early detection does not necessarily portend the true viable infection rate of endophytes in tall fescue. BarOptima and Jesu with endophyte AR542 required additional days for seedling development to truly assess the endophyte viability in those cultivars. Both the immunoblot and molecular marker methods did not detect endophyte in the E- populations of either tall fescue or perennial ryegrass. Molecular markers were not as efficient as the immunoblot procedure when detecting the novel endophyte NE1 in the Remington cultivar. The maximum detection levels for markers and immunoblot assays occurred on day 42 after germination for most of the cultivars used in this study which suggests this is the necessary age for seedling plants to be tested in routine and regulatory settings. We also validated that our in-house marker that targets the loline alkaloid gene lolF works well as a presence marker in commercial tall fescue cultivars. This study provides forage producers and researchers with useful information they can use to make decisions about when and how to test their populations for endophyte infection.

Plant material

Jesup E-, Jesup 542 (MaxQ), BarOptima Plus, and Texoma 584 (MaxQII) tall fescue commercial cultivars were planted in germination bags in the lab. Jesup E- is endophyte-free while the rest of the cultivars are infected with different novel endophytes. Perennial ryegrass cultivars Albion (E-) and Remington NE1 (novel E+) were also planted in the same way. Fifty seedlings in three replicates were sampled 14, 28, and 42 days after germination (DAG). All 50 samples were immediately tested using the immunoblot assay. The rest of the sampled tissue was freeze dried and stored in a -80° C freezer for later DNA extraction and PCR.

Endophyte Testing:

‘Phyto screen greenhouse grow-out tiller endophyte detection’ kits from Agrinostics Ltd. (Watkinsville, Ga; Cat # ENDO797-2) were used for immunoblot testing at the time of sample collection. Seedling psuedostems were dissected from the seed and a 2-mm cross-section of the psuedostem base excised and placed cut side down on a nitrocellulose membrane for the immunoblot assay (fig. 2). Excised psuedostem pieces from the 14-day old plants were crushed onto the membrane to express plant sap from the tissue. Psuedostem tissue from the remaining sampling dates were incubated overnight at 5^oC while setting on the nitrocellulose membrane which was saturated with an extraction buffer contained in the immunoblot test kit. The remaining psuedostem tissue was immediately frozen, freeze-dried, and stored in the -80° C freezer for later use. The immunoblot assay was carried out per the kit instructions. The freeze-dried samples were ground in 2010 GenoGrinder and DNA extracted using a 2% CTAB method modified from Doyle and Doyle 1987 (28). After the DNA was diluted to 5000 ng/µL, two markers were used to test for the endophyte presence. A housekeeping gene marker Tef1exon was used first as a control and then a newly designed primer lolF was used. Tef1exon has been used extensively in literature as a presence marker for fungi including endophytes (Song & Nan, 2015 (16); Wang et al., 2022 (17)). The primer lolF targets the lolF gene in the endophyte (table 2). The primer lolF was designed using the sequence accession KC990447.1 (Epichloe canadensis isolate E4815 LolF (lolF) and LolC (lolC) genes, complete coding sequence) published in GenBank (29)(table 2). Endophyte presence data from the immunoblot assay and the marker data were compared as were the results from both markers. PCR reagent mix was for a 20 µL total reaction: 2 µL Taq standard reaction buffer, 1.2 µL MgCl2, 0.4 µL dNTPs, 0.5 µL Reverse primer (10 mM), 0.5 µL Forward primer (10mM), 0.08 µL Taq polymerase and14.32 µL water. End-point PCR was carried out in a Bio Rad C1000 thermal cycler under the following conditions: 95°C for 15 minutes, 65°C for 30 seconds, decrease 1°C per cycle, 72°C for 2 minutes, go to step 2 for 9 additional cycles, 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 2 minutes, go to step 6 for an additional 24 cycles, and finally, 72°C for 7 minutes. Results were run on a 2% agarose electrophoresis gel with ethidium bromide for 45 minutes at 100 V and 400 W. The gels were visualized in a BioRad Gel Doc EZ Image UV light reader (fig. 6).

Table 2. Primer sequences used for PCR.

Gene	Forward	Primer sequence (5’3’)	Reverse	Primer sequence (5’3’)
tefAa	Tef1-exon1d-1	GGGTAAGGACGAAAAGACTCA	Tef1-exon 6u-1	CGGCAGCGATAATCAGGATAG
lolF	lolF-F	CCATCGGACCAGGCATCTTC	lolF-R	GATTCCGCGGTCCCATCTAC

Data analysis:

Lol F marker analysis:

Both the standard presence/absence markers tef1exon and the new marker lolF were used as primers for PCR for all samples tested. The number of bands for each replication at each time point, cultivar, and replication was recorded. The data was analyzed in R Studio and excel (Microsoft, 2018 (30); RStudio, 2022 (31)). First, a linear model was created for the data being analyzed. The residuals were visualized as a histogram to ensure normalcy before proceeding. If the histograms appeared non-normal, so a Shapiro-Wilkes test was carried out to further investigate the normalcy of the model. Then a one-way ANOVA was done to statistically compare the tef1exon marker results and the lolF marker results. The replications were combined to create a bar graph to visually compare the results of each marker as well.

Data analysis:

Lol F marker analysis:

Earliest stage detection analysis:

The percent of endophytes detected were analyzed by detection method (marker or immunoblot), time point, and cultivar. Percentages were used, as different sample sizes were used for marker testing and for immunoblot testing. A mixed model ANOVA was used in RStudio was used to compare the results of the immunoblot assay and marker testing with replication and time point being considered random variables and cultivar and detection method beign considered fixed variables. Further analysis was carried out post-hoc by estimated marginal means. Bar graphs were created in excel to visualize the data. This was done for tall fescue cultivars as a group and the perennial ryegrass cultivar as a group as well as both grass species together.

Endophyte free (E-), Endophyte infected (E+), days after germination (DAG), enzyme-linked immunosorbent assays (ELISA)

Additional Information:

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests

Funding

The University of Georgia Cultivar Research and Development Fund.

Authors' contributions

Study Concept and Design: N.H., A.M., K.L. Acquisition of Data: K.L., N.H., C.C. Analysis and Interpretation of the Data: K.L., N.H Drafting of the Manuscript: K.L. Critical Revision of the Manuscript for Important Intellectual Content: N.H., A.M. All authors read and approved the final manuscript.

Authors' information

Corresponding Author: Kendall Lee email: [email protected]

Rogers JK, Locke JM. Tall Fescue: History, Application, Establishment and Management2013; (NF-FO-13-03). Available from: https://www.noble.org/globalassets/docs/ag/pubs/pasture/nf-fo-13-03.pdf.
Young CA, Charlton ND, Takach JE, Swoboda GA, Trammell MA, Huhman DV, et al. Characterization of Epichloe coenophiala within the US: are all tall fescue endophytes created equal? Frontiers in Chemistry. 2014;2.
Browning R, editor Tall Fescue Endophyte Toxicosis in Beef Cattle : Clinical Mode of Action and Potential Mitigation through Cattle Genetics2003.
Ryegrass DairyNZ2022 [Available from: https://www.dairynz.co.nz/feed/pasture/pasture-renewal/select-pasture-species/ryegrass/.
Moon CD, Craven KD, Leuchtmann A, Clement SL, Schardl CL. Prevalence of interspecific hybrids amongst asexual fungal endophytes of grasses. Molecular Ecology. 2004;13(6):1455-67.
Philippe G. Lolitrem B and Indole Diterpene Alkaloids Produced by Endophytic Fungi of the Genus Epichloë and Their Toxic Effects in Livestock. Toxins. 2016;8(2):47.
Bouton JH, Latch GCM, Hill NS, Hoveland CS, McCann MA, Watson RH, et al. Reinfection of tall fescue cultivars with non-ergot alkaloid-producing endophytes. Agronomy Journal. 2002;94(3):567-74.
Bluett SJ, Thom ER, Clark DA, Macdonald KA, Minneé EMK. Effects of perennial ryegrass infected with either AR1 or wild endophyte on dairy production in the Waikato. New Zealand Journal of Agricultural Research. 2005;48(2):197-212.
Komatsu S, Yanagawa Y. Cell wall proteomics of crops. Frontiers in Plant Science. 2013;4.
Pirelli GJ, Anderson NP, Craig AM, Young CA. Endophyte Toxins in Grass and Other Feed Sources: Oregon State University; 2016 [Available from: https://catalog.extension.oregonstate.edu/sites/catalog/files/project/pdf/em9156.pdf.
Gagic M, Faville MJ, Zhang W, Forester NT, Rolston MP, Johnson RD, et al. Seed Transmission of Epichloë Endophytes in Lolium perenne Is Heavily Influenced by Host Genetics. Frontiers in Plant Science. 2018;9(1580).
Bacon CW, Porter JK, Robbins JD, Luttrell ES. Epichloe typhina from toxic tall fescue grasses. Appl Environ Microbiol. 1977;34(5):576-81.
Hill NS. Ecological Relationships of Balansiae-Infected Graminoids. In: Bacon CW, White J, editors. Biotechnology of Endophytic Fungi of Grasses1994. p. 59-73.
Ahmad RZ, Ameen F, Khalid R, Alghuthaymi MA, Alsalmi R, Li C. A Brief History of Endophyte Detection Techniques in Grasses. Sustainable Agriculture Research [Internet]. 2019 2019; 08(3):[66-72 pp.]. Available from: https://ageconsearch.umn.edu/record/301903/files/Paper%207.pdf.
Hiatt EE, III, Hill NS, Bouton JH, Stuedemann JA. Tall Fescue Endophyte Detection: Commerical Immunoblot Test Kit Compared with Microscopic Analysis. USDA-ARS. 1999.
Song H, Nan Z. Origin, Divergence, and Phylogeny of Asexual Epichloë Endophyte in Elymus Species from Western China. PLOS ONE. 2015;10(5):e0127096.
Wang T, Chen T, White JF, Li C. Identification of Three Epichloë Endophytes from Hordeum bogdanii Wilensky in China. Journal of Fungi. 2022;8(9):928.
Takach JE, Young CA. Alkaloid Genotype Diversity of Tall Fescue Endophytes. Crop Science. 2014;54(2):667-78.
Pan F, Hou K, Gao F, Hu B, Chen Q, Wu W. Peimisine and peiminine production by endophytic fungus Fusarium sp. isolated from Fritillaria unibracteata var. wabensis. Phytomedicine. 2014;21(8-9):1104-9.
Q5MNI7: LOLF1_EPIUN [Internet]. 2022. Available from: https://www.uniprot.org/uniprotkb/Q5MNI7/entry.
Schardl CL, Grossman RB, Nagabhyru P, Faulkner JR, Mallik UP. Loline alkaloids: Currencies of mutualism. Phytochemistry. 2007;68(7):980-96.
Spiering MJ, Moon CD, Wilkinson HH, Schardl CL. Gene Clusters for Insecticidal Loline Alkaloids in the Grass-Endophytic Fungus Neotyphodium uncinatum. Genetics. 2005;169(3):1403-14.
Hettiarachchige IK, Ekanayake PN, Mann RC, Guthridge KM, Sawbridge TI, Spangenberg GC, et al. Phylogenomics of asexual Epichloë fungal endophytes forming associations with perennial ryegrass. BMC Evolutionary Biology. 2015;15(1):72.
van Zijll de Jong E, Smith KF, Spangenberg GC, Forster JW. Molecular Genetic Marker-Based Analysis of the Grass-Endophyte Symbiosis. Neotyphodium in Cool‐Season Grasses2005. p. 123-38.
Easton HS, Lyons TB, Mace WJ, Simpson WR, De Bonth ACM, Cooper B, et al., editors. Differential expression of loline alkaloids in perennial ryegrass infected with endophyte isolated from tall fescue. International Symposium on Fungal Endophytes of Grasses; 2006; New Zealand: AgResearch
Kemp H, Bourke C, Wheatley W. Endophytes of perennial ryegrass and tall fescue www.dpi.nsw.gov.au: NSW DPI; 2007 [Available from: https://www.dpi.nsw.gov.au/__data/assets/pdf_file/0006/109995/endophytes-of-perennial-ryegrass-and-tall-fescue.pdf.
Rowan DD, Latch GC. Utilization of Endophyte-Infected Perennial Ryegrass for Increased Insect Resistance. In: Bacon CW, White J, editors. Biotechnology of Endophytic Fungi of Grasses: CRC Press; 1994. p. 169-78.
Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. 1987.
Schardl CL, Young CA, Hesse U, Amyotte SG, Andreeva K, Calie PJ, et al. Plant-Symbiotic Fungi as Chemical Engineers: Multi-Genome Analysis of the Clavicipitaceae Reveals Dynamics of Alkaloid Loci. PLOS Genetics. 2013;9(2):e1003323.
Microsoft. Microsoft Excel. 2019 (16.0) ed2018.
RStudio. RStudio: Integrated Development Environment for R. 2022.7.2.576 ed. Boston, MA: RStudio; 2022.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Determining the Earliest Growth Stage to Detect the Presence of Endophytes in Tall Fescue and Perennial Ryegrass Seedlings Using Molecular Markers

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Background

Results

LolF as a presence/absence marker:

Earliest Stage of Detection- Molecular Maker vs. Immunoblot:

Discussion

Conclusion

Materials And Methods

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1