Aprepitant inhibits the development and metastasis of gallbladder cancer via ROS and MAPK activation

doi:10.21203/rs.3.rs-2498202/v1

Download PDF

Research Article

Aprepitant inhibits the development and metastasis of gallbladder cancer via ROS and MAPK activation

https://doi.org/10.21203/rs.3.rs-2498202/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 May, 2023

Read the published version in BMC Cancer →

You are reading this latest preprint version

Background: Aprepitant, as a neurokinin-1 receptor (NK-1R) antagonist, originally applied for curing chemotherapy-induced nausea and vomiting, has been reported to have significant antitumor effect on several malignant tumors. However, the effect of aprepitant on gallbladder cancer (GBC) is not clear yet. This study aimed to investigate the anti-tumor activity of aprepitant on GBC and the potential mechanisms.

Methods: The NK-1R expression of gallbladder cancer cells were examined by immunofluorescence. MTT assay, wound healing and transwell migration assay were applied to detect the effect of aprepitant on cell proliferation, migration and invasion. Flow cytometry was used to detect the apoptosis rate. The effects of aprepitant on the expressions of cytokine were examined by real-time quantitative PCR and MAPK activation were detected via immunofluorescence and western blotting. Besides, xenograft model was established to investigate the effect of aprepitant in vivo.

Results: Our results indicated that NK‐1R was markedly expressed in gallbladder cancer cells and aprepitant effectively inhibited the proliferation, migration and invasion. Furthermore, the apoptosis, ROS and inflammation response were significantly boosted by aprepitant in GBC. Aprepitant induced NF‐κB p65 nuclear translocationin and increased the expressions of p-P65, p-Akt, p-JNK, p-ERK and p-P38, as well as the mRNA levels of inflammatory cytokines IL-1β, IL-6 and TNF-α. Consistently, aprepitant suppressed the growth of GBC in xenograft mice model.

Conclusion: Our study demonstrated that aprepitant could inhibit the development of gallbladder cancer via inducing ROS and MAPK activation, which suggested that aprepitant may become a promising therapeutic drug against GBC.

aprepitant

NK‐1R

ROS

NF-κB

MAPK

gallbladder cancer

Gallbladder cancer (GBC) is the most common primary malignant tumor of the biliary tract, which originates from the mucosal epithelium of the gallbladder and cystic duct[1, 2]. Due to its characteristics of high heterogeneity, insidious onset, and easy metastasis, most patients are in advanced stage at initial diagnosis[3]. The 5-year survival rate of patients with GBC is less than 5% and the overall prognosis is extremely poor[4]. Surgical resection remains the only treatment with curative intent for GBC[5]. However, only 10–30% of GBC patients are suitable for surgery, and the recurrence rate is high[6]. Furthermore, radiotherapy and chemotherapy do not show distinct advantages in GBC, while generally have defects including low sensitivity, poor efficacy and serious side effects[4, 7]. Therefore, it is of great significance to develop new therapeutic strategies for patients with GBC.

Neurokinin-1 receptor (NK-1R), a tachykinin receptor, combines specifically with substance P (SP), which belongs to the tachykinin family[8]. SP/NK-1R system is widely distributed in various tissues, involved in many physiological and disease processes like pain, inflammation and immune response[9–11]. Recent studies demonstrate that SP/NK-1R is highly expressed in numerous cancer types and plays a prominent role in the tumor formation and progression[12–15]. Increasing experimental evidence suggests that SP/NK-1R signaling pathway could participate in tumor proliferation, invasion, metastasis and angiogenesis[16–19]. We have reported that the activation of SP/NK-1R can promote the tumorigenesis of GBC[20]. Consequently, SP/NK-1R may be a novel target for the treatment of gallbladder cancer.

As a highly selective non-peptide NK-1R antagonist, aprepitant is a clinical drug approved by the Food and Drug Association (FDA) for the treatment of chemotherapy-induced nausea and vomiting (CINV)[21]. In recent years, aprepitant exerts an anti-neoplastic effect in a range of human malignancies[22–24]. For example, in human osteosarcoma, blockage of NK-1R using aprepitant can reverse the proliferation in vitro and in vivo[25]. Meanwhile, there is no evidence to show the significant toxic side effects of aprepitant even at high doses[26, 27].

However, the effect of aprepitant on GBC remains unclear. Previously, our team has reported that NK-1R is highly expressed in human gallbladder cancer and the activation of NK‐1R by SP could promote the tumorigenesis via the Akt/NF‐κB axis[20]. Based on the above evidence, it is interesting to investigate the role of aprepitant in gallbladder cancer. In this study, we aimed to confirm the anticancer effects of aprepitant both in vitro and in mouse xenograft, which provided evidence that aprepitant may become a potential therapeutic drug for GBC.

1.Cell culture

Human gallbladder cancer cell lines GBC‐SD and NOZ cells were purchased from cell banks of Chinese Academy of Sciences (Shanghai, China). GBC‐SD and NOZ cells were cultured in RPMI 1640 medium (Gibco, United States), added with 10% fetal bovine serum (FBS) (Gibco, United States) and 1% penicillin/streptomycin(Thermo, United States). All cell lines were incubated at 37°C in a humidified atmosphere with 5% CO₂ according to the manufacturer's instruction.

2.Drugs

A stock solution of aprepitant (MedChemExpress, United States) at the concentration of 100 mM, was attained through dissolving the compound in sterile dimethyl sulfoxide (DMSO) (Sigma-Aldrich, United States). Then it was diluted to different concentrations (6.25-100 μM), so that the final concentration of DMSO in the culture medium did not exceed 0.1% in all the treatments.

3.Cell Viability Assay

Colorimetric MTT assay was used for examining cell proliferation and cytotoxicity. GBC‐SD and NOZ cells were seeded in 96-well plates (5×10³ cells/well) and incubated for 24 h. Aprepitant with different concentrations were added to each well, and cells were incubated for the desired time. Then MTT solution (20 μL) was added to each well and incubated for 4 h at 37°C. Next, the medium was removed and DMSO (150 μL/well) was added to solubilize the formazan crystals for additional 15 min. The absorbances were read on a microplate reader (Bio-Rad Laboratories, United States) at 490 nm. Each result was corrected by values from a control study.

4. Wound healing assay

Cells were seeded on 6-well plates and incubated until they reached a density of about 90-95%. A scratch wound was made by a sterile 10 μL pipette tip in the central area of each well. Subsequently, cells were washed twice with PBS and then cultured with aprepitant at the desired concentration. The wounded gaps were photographed by microscope at 0, 12, 24 and 36 h.

5. Cell migration and invasion assays

Transwell migration assay and Matrigel invasion assay were performed using 24‐well transwell chambers. Cells were seeded to the upper chamber in serum-free medium, and the lower chamber was filled with 600 μL of culture media containing aprepitant and 10% FBS. After incubated at 37 °C for indicated time, cells were fixed with ice‐cold methanol for 20 min, and then stained with 0.1% crystal violet for 20 min. After washing and removing the nonmigrant cells from the upper face of the transwell membrane, cell images were captured in the fields of each filter under microscope. The only difference between migration and invasion assay was whether the upper surface of transwell film was precoated with Matrigel matrix (BD, United States).

6.Cell apoptosis

The effects of aprepitant on cell apoptosis were analyzed with the Annexin V-FITC kit (Vazyme, China) according to the manufacturer’s instructions. GBC‐SD and NOZ cells were seeded in 6-well plates and incubated overnight. After treated with the required aprepitant concentration for dedicated time, the cells were harvested through trypsinization and re-suspended in 1× binding buffer at a concentration of 1×10⁶ cells/ml. Then cells (1 × 10⁵) were incubated with 5 μL of Annexin V-FITC and 5 μL of propidium iodide (PI) for 15 min at room temperature in the dark, followed by addition of another 400 μL of 1× binding buffer. Finally, samples were assessed by flow cytometry (FACScan; BD Biosciences, United States) within 1 h.

7. ROS detection

The level of reactive oxygen species (ROS) production was examined by the cellular ROS detection kit (Beyotime, China) following manufacturer’s protocol. GBC‐SD and NOZ cells were incubated with 10 μM DCFH-DA for 20 minutes at 37°C in dark. After washed with serum-free medium, the cells were treated with/without aprepitant for 20 minutes. The production of intracellular ROS under different treatments was observed under fluorescence microscope (Olympus, Japan).

8. Immunofluorescence

Cells were seeded on a glass slide and fixed in 4% paraformaldehyde. After washed twice with PBS, these slides were then permeabilized using a 0.5% Triton X‐100 solution (BioFroxx, Germany), and subsequently blocked with 5% BSA. Next, the primary antibody, rabbit-anti NK-1R (Sigma-Aldrich, United States) or mouse-anti NFκBp65 (Cell Signaling Technology) were incubated overnight at 4℃. Then these slides were washed with PBS and then incubated with flour 594-conjugated goat anti-rabbit IgG or flour 488-conjugated goat anti-mouse IgG (Keygen Biotech, China). Nuclei were stained with DAPI (Beyotime, China). Images were photographed by fluorescence microscope (Olympus, Japan).

9.RNA extraction and quantitative real‐time PCR

Total RNA was extracted from cells with TRIzol reagent and reversely transcribed using a reverse transcription kit (Thermo Fisher Scientific, United States) following the manufacturer's direction. The subsequent real‐time PCR was carried out with the SYBR^® Green qPCR Kit (Vazyme, China). The expression of mRNAs was calculated using the comparative cycle threshold (ΔΔCT) method and normalized to β-actin to obtain the relative mRNA level of each target. The sequences of primers are listed in Table 1.

Table 1. The primer sequences used for real-time PCR.

Target Gene	Primer sequence (5′-3′)
IL-1β	F: AGGCTGCTCTGGGATTC R: GCCACAACAACTGACGC
IL-6	F: AGACAGCCACTCACCTCTTCAG R: TTCTGCCAGTGCCTCTTTGCTG
TNF-α	F: CTCTTCTGCCTGCTGCACTTTG R: ATGGGCTACAGGCTTGTCACTC
MMP-2	F: ACCTGGATGCCGTCGTGGAC R: TGTGGCAGCACCAGGGCAGC
MMP-9	F: CTATTTCTGCCAGGACCGCTTC R: CACCTGGTTCAACTCACTCCG
β-actin	F: GGGACCTGACTGACTACCTC R: TCATACTCCTGCTTGCTGAT

10.Western blotting

Total proteins were isolated from the cell lines or mice xenograft. Protein lysates were separated on SDS PAGE gels and then transferred to polyvinylidene difluoride (PVDF) membrane (Millipore, United States). The membrane was incubated in 3% bovine serum albumin (BSA) or 5% nonfat milk for 1 hour at room temperature and then blotted with specific primary antibody at 4˚C overnight. After incubation in the horseradish peroxidase (HRP)‐labeled secondary antibody for 1h at room temperature, the membrane was visualized by an enhanced chemiluminescence kit and images were obtained using chemiluminescence western blot detection system (Bio-Rad Laboratories, United States). The intensity of the western blot bands was measured with Quantity One software (Bio-Rad, United States). GAPDH (Abcam, UK) was used as the control. Western blot antibodies p-P65, p-Akt, p-JNK, p-ERK and p-P38 were purchased from Cell Signaling Technology. HRP-conjugated anti-rabbit and anti-mouse secondary antibody were purchased from Abclonal (Wuhan, China).

11. In vivo xenograft study

The animal study was approved by the Ethics Committee of Nanjing Medical University (protocol code IACUC-2106005). All experimental procedures were performed in accordance with the guidelines for laboratory animal care and the study is reported in accordance with ARRIVE guidelines. Adult male BALB/c nude mice (aged 6–8 weeks, weighing 18 to 22 g) were purchased from the Qinglongshan Animal Center of Nanjing (Nanjing, China) and maintained under standard laboratory conditions. GBC‐SD cells (1.0 × 10⁶ cells per mouse) were subcutaneously injected into 12 nude mice. After ten days of tumor inoculation, mice were randomly divided into control group and aprepitant-treated group (6 mice per group). The control group received phosphate-buffered saline (PBS) and the aprepitant-treated group was injected intraperitoneally with aprepitant (10 mg/kg) every other day. Mice body weight and tumor volume were recorded every 3 days. Tumor volume was calculated by the formula: volume= length × width² × 0.52. After 21 days of treatment, all mice were sacrificed and the tumors were excised and weighed. All mice were executed using the cervical dislocation method. Then the tumors were frozen in liquid nitrogen for molecular analyses.

12. Statistical analysis

GraphPad Prism was used to conduct all statistical analyses. Data are indicated as means ± SEM. Statistical analysis was performed using the unpaired Students t-test or one‐way ANOVA. The criterion for significance was P<0.05 for all comparisons.

1. Aprepitant inhibits the proliferation of gallbladder cancer in vitro

We performed immunofluorescence to identify the expression of NK-1R in the human gallbladder cancer cell lines (GBC-SD and NOZ). As illustrated in Figure 1A, the NK-1R was obviously expressed in GBC-SD and NOZ cells was examined. In order to assess the effect of aprepitant on GBC proliferation, GBC‐SD and NOZ cells were exposed to aprepitant at 6.25, 12.5, 25, 50, and 100 µM, respectively, and MTT assay was used to detect cell growth. Aprepitant markedly inhibited the cell proliferation in the Figure 1B,C, which indicated that aprepitant has potential antiproliferative effects. As represented in IC50 calculation following 24h of treatment, the IC50 value for GBC‐SD and NOZ cells were 11.76 and 15.32 µM respectively.

2. Aprepitant restrains the migration and invasion of gallbladder cancer in vitro

Cell migration contributes to tumor invasion and metastasis, thereby accelerating tumor progression and reducing patient survival[28]. Thus, we carried out wounding healing assay to investigate the effect of aprepitant on gallbladder cancer cell invasion in vitro. As the images of wound width showed in Figure 2A,B, treatment with aprepitant for 0, 12, 24, and 36h gradually reduced the extent of wound closure, compared with the control group, in GBC‐SD and NOZ cells. Meanwhile, transwell migration and matrigel invasion assays were conducted. The results in Figure 2C,D showed that compared with the control group, fewer gallbladder cancer cells treated with aprepitant could traverse the membrane. The results suggested that aprepitant was able to efficiently inhibit cell migration and invasion.

The matrix metalloproteinases (MMPs), especially MMP-2 and MMP-9, can degrade extracellular matrix components, which are closely related to the tumor migration and metastasis[29]. For further investigation, we detected the mRNA expression levels of MMP-2 and MMP-9 in GBC‐SD cells treated with aprepitant. As shown in Figure 2E, aprepitant significantly decreased the expression levels of MMP-2 and MMP-9. Consistent with the previous results, a similar effect was observed in NOZ cells (Figure 2F).

3. Aprepitant induces the apoptosis of gallbladder cancer in vitro

We intended to investigate whether apoptosis participates in the cytotoxic effect of aprepitant on gallbladder cancer cells. GBC‐SD and NOZ cells were cultivated with aprepitant in increasing concentrations and stained with Annexin-V/propidium iodide (PI) at 12, 24 and 36h, so as to evaluate apoptosis by flow cytometry. Consistent with the above antiproliferative effect, we observed that aprepitant significantly augmented the apoptosis rate of GBC cells with the prolongation of drug treatment time and the increase of concentration (Figure 3A). And the similar effect was observed in NOZ cells (Figure 3B).

4. Aprepitant promotes the inflammation of gallbladder cancer in vitro

It is widely known that a large number of inflammatory cytokines might be released along with tumor cell death[30, 31]. Therefore, we investigated whether the cytotoxic effect of aprepitant on gallbladder cancer cells was accompanied by an increase in inflammatory factors. As important components of inflammatory factors, IL‐6, IL‐1β and TNF‐α were measured by qRT-PCR. The results showed that aprepitant significantly increased the mRNA levels of these cytokines in GBC‐SD and NOZ cells (Figure 4A,B). Notably, NF-κB is the key regulator of inflammatory cytokines[32], so we tested the effect of aprepitant on NF‐κB. The immunofluorescence results indicated that NF‐κB p65 nuclear translocation was markedly induced by aprepitant in gallbladder cancer cells (Figure 4C,D). Furthermore, the higher expression of phosphorylated NF-κB p65 induced by aprepitant was confirmed at the protein level (Figure 4E,F).

In tumors, activation of MAPK signaling has positive effect on activity of NF-κB, and its promotion effect always associated with Akt [33, 34]. To clarify the mechanisms underlying aprepitant-induced activation of NF-κB, we assessed the effects of aprepitant on the phosphorylation of MAPK and Akt in GBC-SD and NOZ cell lines. Western blotting revealed that higher levels of p-Akt, p-JNK, p-ERK and p-P38 in GBC‐SD and NOZ cells with aprepitant(Figure 4E,F). In addition, mounting evidence proved that inflammation is closely linked with ROS production. Accordingly, it was observed that after treatment with aprepitant, intracellular reactive oxygen species (ROS) remarkably accumulated in a dose-dependent manner (Figure 4G). These findings suggested that aprepitant boosted the inflammation of gallbladder cancer in vitro.

5. Aprepitant inhibits GBC xenograft growth

Having confirmed a pronounced antitumor effect in vitro, we further verified the effect of aprepitant in vivo by the xenograft nude mice model derived from the GBC‐SD cells. Aprepitant was injected intraperitoneally every other day in the treatment group, while the control group were injected with PBS. No meaningful difference was found in weight change between drug treatment and control groups (Figure 5A), and none of the treated mice showed serious side effects. Compared to the control group, the tumor of the aprepitant group had obviously slower growth (Figure 5B) with smaller tumor volume and lighter tumor weight (Figure 5C,D).

As depicted in Figure 5E, our western blotting results presented a remarkable increase of p-P65, p-Akt, p-JNK, p-ERK and p-P38 in the aprepitant group. Moreover, we also examined the mRNA expression of IL‐1β, IL‐6, TNF‐α, MMP2 and MMP9. In accordance with the above results, aprepitant augmented the expression of these inflammatory factors and decreased the expression of MMP2 and MMP9 in transcriptional levels (Figure 5F). In general, aprepitant exhibited a robust inhibitory effect on the tumorigenicity of GBC in vivo.

In the current study, our results revealed that aprepitant exerts an inhibitory effect on the growth and development of gallbladder cancer in vitro and in vivo for the first time. We showed that NK-1R is markedly expressed in the GBC-SD and NOZ cells. In line with previous findings about other cancer, aprepitant efficiently inhibited gallbladder cancer cell proliferation in a concentration- and time-dependent manner. Besides, treatment with aprepitant could suppress the migration and invasion of gallbladder cancer cells. The blockage of NK-1R by aprepitant obviously induced the cell apoptosis and inflammation, along with ROS production. Furthermore, we proved that aprepitant inhibits the tumorigenicity of GBC via constructing the xenograft nude mice model. Thus, aprepitant could contribute to the growth inhibition of GBC and may provide an innovative strategy for the gallbladder cancer treatment. Model of the mechanism by which aprepitant inhibited GBC growth is depicted in Fig. 6.

As a highly aggressive malignancy of the biliary tract, GBC is often found at an advanced stage and patients have low survival rate and poor clinical prognosis[4]. Considering that surgical resection is only available for the minority of people, many studies have explored from traditional chemotherapy, radiotherapy, then to immunotherapy for gallbladder cancer. However, the survival benefit of present therapeutic strategy is still very limited, so it is urgent to seek for new treatments[6, 7]. Molecular targeted therapy has the characteristics of strong specificity and little side effects, which helps to change the treatment status of gallbladder cancer[35, 36].

The latest investigations have discovered that the NK-1R is associated with the evolution and progression of tumor. The NK-1R that belongs to the family of G protein-coupled receptors (GPCRs), exerts different biological activities mainly through binding to SP. The activation of NK-1R by SP can cause a series of changes in downstream pathways, which are involved in neurotransmission, inflammation, pain, anxiety and depression, among others[8, 9]. In recent decades, SP/NK-1R system has been discovered to be aberrantly activated in various malignant tumors. For instance, it has been demonstrated that NK-1R expresses highly in melanoma, leukemia, gastric cancer, and breast cancer[13, 17, 19, 37]. In addition, previous studies identified SP as a mitogen to activate NK-1R and thus participate in tumor cell proliferation[38]. For this reason, blocking SP/NK‑1R system with NK-1R antagonists is expected to become a new therapeutic strategy against cancer.

Aprepitant is a selectively high-affinity and non-peptide NK-1R antagonist, which is the first antagonist approved by the FDA to cure chemotherapy-induced nausea and vomiting[21]. Except for the original function, aprepitant have recently been explored for new efficiency that it could inhibit multiple cancers development. M. Munoz et al. showed that aprepitant has broad-spectrum antitumor actions: antiproliferative, antimetastatic and anti-angiogenic effects[22]. To the best of our knowledge, no one has described the effect of aprepitant on gallbladder cancer. Hence, the purpose of our experiments is to investigate whether the clinical drug aprepitant has an inhibitory effect on the gallbladder cancer.

Similar to previous findings, our study showed that treatment with aprepitant resulted in the decrease of viability in the gallbladder cancer cells. With the increase of aprepitant treatment time and concentration, the proliferation of GBC-SD and NOZ cells was obviously inhibited. Based on this, we also calculated that the IC50 values of aprepitant on GBC‐SD and NOZ cells, which were 11.76 and 15.32 µM respectively.

Tumor metastasis involves a series of complicated processes, including cell migration, invasion, adhesion and so on[28]. SP/NK-1R was also suggested to be an important modulator of different cells motility, which takes part in tumor progression and metastasis[39]. It is reported that activating NK-1R by SP could significantly enhance the migration and invasion ability of gastric cancer cell line MKN45[17]. Considering the high aggressiveness of gallbladder cancer, we tested the influence of aprepitant on gallbladder cancer cell migration and invasion. The results of the wounding-healing assay showed that aprepitant hindered cell migration and the scratch wound healing. Consistently, we proved that cell invasion could be inhibited in vitro by aprepitant via transwell assays with or without matrigel. MMPs, a group of matrix-degrading enzymes, contribute to cancer cells infiltrating into surrounding areas[29]. L. Mou et al. substantiated that the activation of NK-1R distinctly promoted the motility and migration of human glioma cells by up-regulating MMP-2 and MMP14[40]. Similarly, our qRT-PCR results indicated that the expression levels of MMP-2 and MMP-9 were reduced through blocking NK-1R by aprepitant.

Earlier research described that the anticancer effect of aprepitant depends partly on inducing apoptosis, which seems to be a common mechanism of aprepitant-induced cell death in diverse tumor backgrounds[23, 24, 41]. Apoptosis is a programmed death process initiated by endogenous or exogenous signals, and causing apoptosis can effectively inhibit the occurrence and development of tumors. As pointed out by D. Bashash, the cytotoxic effect of aprepitant on acute leukemia cells was mediated through apoptotic[42]. We verified that aprepitant evidently triggered gallbladder cancer cells apoptosis via Annexin-V/PI dual staining method and flow cytometric analysis. With the extending exposure to aprepitant, the cell apoptosis ratio was increased.

When further exploring the underlying impact of aprepitant on gallbladder cancer cells, we discovered that a series of inflammatory reactions occurred after blocking SP/NK-1R system. After cultured with aprepitant for different time, gallbladder cancer cells generated more inflammatory cytokines including IL-6, IL‐1β and TNF‐α. It is well established that NF-κB functions as is an important regulator of inflammation[32]. Both immunofluorescence and western blotting results suggested that aprepitant promoted the nuclear translocation and phosphorylation activation of NF‐κB in GBC‐SD and NOZ cells. There is mounting evidence that MAPK and Akt signaling pathways are tightly involved in the regulation of NF‐κB transcription activity[31]. Based on the above understanding, our western blotting analysis illustrated that aprepitant increased the protein levels of p-Akt, p-JNK, p-ERK and p-P38 at different time points. Collectively, aprepitant may boost inflammatory responses through activating MAPK and Akt signaling pathways in gallbladder cancer cells. It is common knowledge that ROS elevation plays a prominent part in NF-κB activation and inflammation response[43]. Besides, cell death is partly due to the breakdown of redox state, which is generally balanced by ROS production and scavenging[44]. Given this, our data revealed that compared with the untreated control, aprepitant eminently augmented ROS generation in GBC‐SD and NOZ cells.

Meanwhile, we elucidated the anti-cancer effect of aprepitant on gallbladder cancer in vivo through constructing the xenografted nude mice. The group injected with aprepitant presented distinct reduction in tumor weight and volume. Our findings are consistent with those of others, such as Berger M, who also observed aprepitant had a striking therapeutic effect on HuH6 xenografted nude mice[45]. Significantly, during the experimental period, there was no obvious difference in mice weight change between two groups of mice, which supported the idea that aprepitant had few side effects in vivo. The pharmacologic safety and tolerance of aprepitant has been verified through substantial experiments[15, 46, 47]. The dosage of aprepitant used in antiemetics and antidepressants will not cause serious side effects. Besides, aprepitant is reported to relieve pain[48], which affords greater survival benefitis to GBC patients.

However, the results of our research are relatively limited and further investigations are needed to explore detailed anti-cancer mechanisms of aprepitant. It also remains additional clinical trials to validate the therapeutic potential of aprepitant in GBC.

In conclusion, we discovered that the clinical drug aprepitant could exert antineoplastic effect on gallbladder cancer by specifically blocking NK1-R both in vitro and in vivo. Our presenting data indicated that aprepitant effectively inhibited the proliferation, migration and invasion of GBC cells, as well as facilitated apoptosis, inflammation and ROS production. These encouraging findings provide evidence that aprepitant might function as a novel and promising anti-cancer agent against GBC.

Ethics approval and consent to participate

The animal study was reviewed and approved by the Ethics Committee of Nanjing Medical University (protocol code IACUC-2106005). All experimental procedures were performed in accordance with the guidelines for laboratory animal care. And the study is reported in accordance with ARRIVE guidelines.

Consent for publication

Not applicable.

Availability of data and materials

The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.

Competing interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

This work was supported by the National Natural Science Foundation of China (grant number 82171222).

Authors' contributions

XC: Investigation, Methodology, Writing - original draft. YY: Funding acquisition, Investigation, Methodology, Writing - original draft. WZ: Investigation, Methodology. YW: Investigation, Methodology. XW: Investigation. XG: Investigation. FW: Investigation. LM: Project administration, Writing - review & editing. XD: Project administration, Funding acquisition, Writing - review & editing. All authors approved the final manuscript.

Acknowledgements

Not applicable.

Kanthan R, Senger JL, Ahmed S, Kanthan SC: Gallbladder Cancer in the 21st Century. J Oncol 2015, 2015:967472.doi:10.1155/2015/967472.
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F: Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 2021, 71(3):209-249.doi:10.3322/caac.21660.
Misra S, Chaturvedi A, Misra NC, Sharma ID: Carcinoma of the gallbladder. Lancet Oncol 2003, 4(3):167-176.doi:10.1016/s1470-2045(03)01021-0.
Rakic M, Patrlj L, Kopljar M, Klicek R, Kolovrat M, Loncar B, Busic Z: Gallbladder cancer. Hepatobiliary Surg Nutr 2014, 3(5):221-226.doi:10.3978/j.issn.2304-3881.2014.09.03.
Gunasekaran G, Bekki Y, Lourdusamy V, Schwartz M: Surgical Treatments of Hepatobiliary Cancers. Hepatology 2021, 73 Suppl 1:128-136.doi:10.1002/hep.31325.
Garg PK, Pandey D, Sharma J: The surgical management of gallbladder cancer. Expert Rev Gastroenterol Hepatol 2015, 9(2):155-166.doi:10.1586/17474124.2014.943188.
Hundal R, Shaffer EA: Gallbladder cancer: epidemiology and outcome. Clin Epidemiol 2014, 6:99-109.doi:10.2147/CLEP.S37357.
Garcia-Recio S, Gascon P: Biological and Pharmacological Aspects of the NK1-Receptor. Biomed Res Int 2015, 2015:495704.doi:10.1155/2015/495704.
Muñoz M, Coveñas R: Involvement of substance P and the NK-1 receptor in human pathology. Amino acids 2014, 46(7):1727-1750.doi:10.1007/s00726-014-1736-9.
Zieglgansberger W: Substance P and pain chronicity. Cell Tissue Res 2019, 375(1):227-241.doi:10.1007/s00441-018-2922-y.
Tuluc F, Lai JP, Kilpatrick LE, Evans DL, Douglas SD: Neurokinin 1 receptor isoforms and the control of innate immunity. Trends Immunol 2009, 30(6):271-276.doi:10.1016/j.it.2009.03.006.
Friess H, Zhu Z, Liard V, Shi X, Shrikhande SV, Wang L, Lieb K, Korc M, Palma C, Zimmermann A et al: Neurokinin-1 receptor expression and its potential effects on tumor growth in human pancreatic cancer. Lab Invest 2003, 83(5):731-742.doi:10.1097/01.lab.0000067499.57309.f6.
Munoz M, Rosso M, Robles-Frias MJ, Salinas-Martin MV, Rosso R, Gonzalez-Ortega A, Covenas R: The NK-1 receptor is expressed in human melanoma and is involved in the antitumor action of the NK-1 receptor antagonist aprepitant on melanoma cell lines. Lab Invest 2010, 90(8):1259-1269.doi:10.1038/labinvest.2010.92.
Dong J, Feng F, Xu G, Zhang H, Hong L, Yang J: Elevated SP/NK-1R in esophageal carcinoma promotes esophageal carcinoma cell proliferation and migration. Gene 2015, 560(2):205-210.doi:10.1016/j.gene.2015.02.002.
Munoz M, Rosso M, Covenas R: Neurokinin-1 Receptor Antagonists against Hepatoblastoma. Cancers (Basel) 2019, 11(9).doi:10.3390/cancers11091258.
Wang F, Liu S, Liu J, Feng F, Guo Y, Zhang W, Zheng G, Wang Q, Cai L, Guo M et al: SP promotes cell proliferation in esophageal squamous cell carcinoma through the NK1R/Hes1 axis. Biochem Biophys Res Commun 2019, 514(4):1210-1216.doi:10.1016/j.bbrc.2019.05.092.
Feng F, Yang J, Tong L, Yuan S, Tian Y, Hong L, Wang W, Zhang H: Substance P immunoreactive nerve fibres are related to gastric cancer differentiation status and could promote proliferation and migration of gastric cancer cells. Cell Biol Int 2011, 35(6):623-629.doi:10.1042/CBI20100229.
Mehboob R, Tanvir I, Warraich RA, Perveen S, Yasmeen S, Ahmad FJ: Role of neurotransmitter Substance P in progression of oral squamous cell carcinoma. Pathol Res Pract 2015, 211(3):203-207.doi:10.1016/j.prp.2014.09.016.
Castro TA, Cohen MC, Rameshwar P: The expression of neurokinin-1 and preprotachykinin-1 in breast cancer cells depends on the relative degree of invasive and metastatic potential. Clin Exp Metastasis 2005, 22(8):621-628.doi:10.1007/s10585-006-9001-6.
Deng XT, Tang SM, Wu PY, Li QP, Ge XX, Xu BM, Wang HS, Miao L: SP/NK-1R promotes gallbladder cancer cell proliferation and migration. J Cell Mol Med 2019, 23(12):7961-7973.doi:10.1111/jcmm.14230.
Aapro M, Carides A, Rapoport BL, Schmoll HJ, Zhang L, Warr D: Aprepitant and fosaprepitant: a 10-year review of efficacy and safety. Oncologist 2015, 20(4):450-458.doi:10.1634/theoncologist.2014-0229.
Munoz M, Covenas R: The Neurokinin-1 Receptor Antagonist Aprepitant: An Intelligent Bullet against Cancer? Cancers (Basel) 2020, 12(9).doi:10.3390/cancers12092682.
Javid H, Afshari AR, Zahedi Avval F, Asadi J, Hashemy SI: Aprepitant Promotes Caspase-Dependent Apoptotic Cell Death and G2/M Arrest through PI3K/Akt/NF-kappaB Axis in Cancer Stem-Like Esophageal Squamous Cell Carcinoma Spheres. Biomed Res Int 2021, 2021:8808214.doi:10.1155/2021/8808214.
Wu H, Cheng X, Huang F, Shao G, Meng Y, Wang L, Wang T, Jia X, Yang T, Wang X et al: Aprepitant Sensitizes Acute Myeloid Leukemia Cells to the Cytotoxic Effects of Cytosine Arabinoside in vitro and in vivo. Drug Des Devel Ther 2020, 14:2413-2422.doi:10.2147/DDDT.S244648.
Munoz M, Berger M, Rosso M, Gonzalez-Ortega A, Carranza A, Covenas R: Antitumor activity of neurokinin-1 receptor antagonists in MG-63 human osteosarcoma xenografts. Int J Oncol 2014, 44(1):137-146.doi:10.3892/ijo.2013.2164.
Kramer MS, Cutler N, Feighner J, Shrivastava R, Carman J, Sramek JJ, Reines SA, Liu G, Snavely D, Wyatt-Knowles E et al: Distinct mechanism for antidepressant activity by blockade of central substance P receptors. Science 1998, 281(5383):1640-1645.doi:10.1126/science.281.5383.1640.
Munoz M, Rosso M: The NK-1 receptor antagonist aprepitant as a broad spectrum antitumor drug. Invest New Drugs 2010, 28(2):187-193.doi:10.1007/s10637-009-9218-8.
Stuelten CH, Parent CA, Montell DJ: Cell motility in cancer invasion and metastasis: insights from simple model organisms. Nat Rev Cancer 2018, 18(5):296-312.doi:10.1038/nrc.2018.15.
Kessenbrock K, Plaks V, Werb Z: Matrix metalloproteinases: regulators of the tumor microenvironment. Cell 2010, 141(1):52-67.doi:10.1016/j.cell.2010.03.015.
Malireddi RKS, Karki R, Sundaram B, Kancharana B, Lee S, Samir P, Kanneganti TD: Inflammatory Cell Death, PANoptosis, Mediated by Cytokines in Diverse Cancer Lineages Inhibits Tumor Growth. Immunohorizons 2021, 5(7):568-580.doi:10.4049/immunohorizons.2100059.
Zhao H, Wu L, Yan G, Chen Y, Zhou M, Wu Y, Li Y: Inflammation and tumor progression: signaling pathways and targeted intervention. Signal Transduct Target Ther 2021, 6(1):263.doi:10.1038/s41392-021-00658-5.
Ben-Neriah Y, Karin M: Inflammation meets cancer, with NF-kappaB as the matchmaker. Nat Immunol 2011, 12(8):715-723.doi:10.1038/ni.2060.
Wu Q, Wu W, Fu B, Shi L, Wang X, Kuca K: JNK signaling in cancer cell survival. Med Res Rev 2019, 39(6):2082-2104.doi:10.1002/med.21574.
Ji C, Guo H, Zhang P, Kuang W, Fan Y, Wu L: AnnexinA5 promote glioma cell invasion and migration via the PI3K/Akt/NF-kappaB signaling pathway. J Neurooncol 2018, 138(3):469-478.doi:10.1007/s11060-018-2818-4.
Malenica I, Donadon M, Lleo A: Molecular and Immunological Characterization of Biliary Tract Cancers: A Paradigm Shift Towards a Personalized Medicine. Cancers (Basel) 2020, 12(8).doi:10.3390/cancers12082190.
Tariq NU, McNamara MG, Valle JW: Biliary tract cancers: current knowledge, clinical candidates and future challenges. Cancer Manag Res 2019, 11:2623-2642.doi:10.2147/CMAR.S157092.
Molinos-Quintana A, Trujillo-Hacha P, Piruat JI, Bejarano-Garcia JA, Garcia-Guerrero E, Perez-Simon JA, Munoz M: Human acute myeloid leukemia cells express Neurokinin-1 receptor, which is involved in the antileukemic effect of Neurokinin-1 receptor antagonists. Invest New Drugs 2019, 37(1):17-26.doi:10.1007/s10637-018-0607-8.
Ma J, Yuan S, Cheng J, Kang S, Zhao W, Zhang J: Substance P Promotes the Progression of Endometrial Adenocarcinoma. Int J Gynecol Cancer 2016, 26(5):845-850.doi:10.1097/IGC.0000000000000683.
Mohammadi F, Javid H, Afshari AR, Mashkani B, Hashemy SI: Substance P accelerates the progression of human esophageal squamous cell carcinoma via MMP-2, MMP-9, VEGF-A, and VEGFR1 overexpression. Mol Biol Rep 2020, 47(6):4263-4272.doi:10.1007/s11033-020-05532-1.
Mou L, Kang Y, Zhou Y, Zeng Q, Song H, Wang R: Neurokinin-1 receptor directly mediates glioma cell migration by up-regulation of matrix metalloproteinase-2 (MMP-2) and membrane type 1-matrix metalloproteinase (MT1-MMP). J Biol Chem 2013, 288(1):306-318.doi:10.1074/jbc.M112.389783.
Kolorz J, Demir S, Gottschlich A, Beirith I, Ilmer M, Luthy D, Walz C, Dorostkar MM, Magg T, Hauck F et al: The Neurokinin-1 Receptor Is a Target in Pediatric Rhabdoid Tumors. Curr Oncol 2021, 29(1):94-110.doi:10.3390/curroncol29010008.
Bashash D, Safaroghli-Azar A, Bayati S, Razani E, Pourbagheri-Sigaroodi A, Gharehbaghian A, Momeny M, Sanjadi M, Rezaie-Tavirani M, Ghaffari SH: Neurokinin-1 receptor (NK1R) inhibition sensitizes APL cells to anti-tumor effect of arsenic trioxide via restriction of NF-kappaB axis: Shedding new light on resistance to Aprepitant. Int J Biochem Cell Biol 2018, 103:105-114.doi:10.1016/j.biocel.2018.08.010.
Morgan MJ, Liu ZG: Crosstalk of reactive oxygen species and NF-kappaB signaling. Cell Res 2011, 21(1):103-115.doi:10.1038/cr.2010.178.
Wang Y, Qi H, Liu Y, Duan C, Liu X, Xia T, Chen D, Piao HL, Liu HX: The double-edged roles of ROS in cancer prevention and therapy. Theranostics 2021, 11(10):4839-4857.doi:10.7150/thno.56747.
Berger M, Neth O, Ilmer M, Garnier A, Salinas-Martin MV, de Agustin Asencio JC, von Schweinitz D, Kappler R, Munoz M: Hepatoblastoma cells express truncated neurokinin-1 receptor and can be growth inhibited by aprepitant in vitro and in vivo. J Hepatol 2014, 60(5):985-994.doi:10.1016/j.jhep.2013.12.024.
Munoz M, Parrilla J, Rosso M, Covenas R: Antipruritic vs. Antitumour Action of Aprepitant: A Question of Dose. Acta Derm Venereol 2019, 99(6):620-621.doi:10.2340/00015555-3148.
Muñoz M, Coveñas R: Safety of neurokinin-1 receptor antagonists. Expert opinion on drug safety 2013, 12(5):673-685.doi:10.1517/14740338.2013.804059.
Yang Y, Zhou W, Xu X, Ge X, Wang F, Zhang GQ, Miao L, Deng X: Aprepitant Inhibits JNK and p38/MAPK to Attenuate Inflammation and Suppresses Inflammatory Pain. Front Pharmacol 2021, 12:811584.doi:10.3389/fphar.2021.811584.

No competing interests reported.

WB.pdf

Download PDF

Journal Publication

published 23 May, 2023

Read the published version in BMC Cancer →

Editorial decision: Major revision
20 Apr, 2023
Reviews received at journal
12 Mar, 2023
Reviewers agreed at journal
23 Feb, 2023
Reviewers invited by journal
01 Feb, 2023
Editor assigned by journal
01 Feb, 2023
Editor invited by journal
01 Feb, 2023
Submission checks completed at journal
01 Feb, 2023
First submitted to journal
20 Jan, 2023

You are reading this latest preprint version

Aprepitant inhibits the development and metastasis of gallbladder cancer via ROS and MAPK activation

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1