A Novel Tetra-Primer ARMS-PCR for genotyping of the OPRM 1 gene rs1779791 variant associated with opioid use disorders

doi:10.21203/rs.3.rs-2507288/v1

Download PDF

Short Report

A Novel Tetra-Primer ARMS-PCR for genotyping of the OPRM 1 gene rs1779791 variant associated with opioid use disorders

https://doi.org/10.21203/rs.3.rs-2507288/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 14 Nov, 2023

Read the published version in BMC Research Notes →

You are reading this latest preprint version

Objectives: SNV is a single nucleotide change that can occur at any point in the genome. It is regarded as a frequent genetic variant that can result in genetic diseases. Discovering genetic variants in individuals is one of the most essential jobs of genetic research. Researchers genotype SNVs using TaqMan technology, DNA microarray, MALDI-TOF mass spectrometry, and automated sequencing which is expensive and time-consuming. The OPRM1 gene rs1799971 (A118G) has been identified for its association with Opioid use disorder (OUD). The present study focused in developing a single step identification test using Tetra-Primer Amplification Refractory Mutation System-PCR (T-ARMS-PCR) in order to detect the presence of SNV OPRM1 rs1799971 (A118G). The present research was performed to optimize the protocol for the designed four primers and validate using a total of 52 buccal samples from volunteers who are currently under rehabilitation for the drug abuse disorder.

Results: The novel assay was successfully designed, tested, and validated using 52 DNA samples. The products of the T-ARMS PCR for rs1799971 contained 395bp as the control band, 186bp as G allele (variant) and 257bp as A allele (wild type) were observed in the gel image. The genotype frequencies for the OPRM1 gene rs1799971 (A118G) were 44% (22/52) of homozygous variant type (GG), 28.9% (15/52) of homozygous wild type (AA) and 28.9% (15/22) of heterozygous (AG). The minor allele (G) frequency was 56.7% and major allele (A) frequency was 43.3%.

Opioid use disorder

OPRM1

T-ARMS PCR

rs1799971

Drug addiction is a complex disorder influenced by a variety of factors, including genetics. There is a 40 to 60% genetic contribution to the development of drug addiction (1–3). Drug-related phenotypes are common, complex, and highly heritable traits. On the basis of twin and family studies, estimates of OUD risk heritability range from 23 to 54%. (4, 5). In recent years, candidate gene (CGAS) and genome-wide association studies (GWAS) have identified a vast number of single nucleotide polymorphisms (SNVs) associated with drug use, abuse, or dependence, most of which are related to opioid (6). However, few genes associated with addiction risk or protection have been validated, and the genetic architecture of drug addiction remains obscure.

Most opioids, such as morphine and morphine derivatives, exert their analgesic effects through the human µ-opioid receptor (MOR). Additionally, endogenous opioid peptides such as enkephalins, endorphins, and dynorphins exert a broad range of physiological and behavioral effects via the MOR, including effects on pain perception, mood, motor control, and autonomic functions. At least in part, it is believed that genetic variation in the functionality or density of the µ-opioid receptor contributes to the substantial phenotypic differences in opioid response. MOR is encoded by the OPRM1 gene. At present, the most prevalent SNV of the OPRM1 gene is rs1799971 which is an A118G substitution. The rs1799971(G) allele in exon 1 of the mu opioid receptor OPRM1 gene causes asparagine (Asn) to be replaced by aspartic acid at residue 40. (Asp). This SNV has also been linked to differences in dopaminergic sensitivity during acute alcohol withdrawal and altered β-endorphin receptor binding capacity (7).

To date, OPRM1 gene variants have been identified via PCR amplification of the appropriate gene fragment followed by automated DNA sequencing or PCR-RFLP (Polymerase chain reaction-restriction fragment length polymorphism) (8, 9). RFLP procedure is time-consuming and, as a result, is unsuitable for rapid patient screening. Using Tetra-ARMS-PCR, we developed a rapid and reliable method for detecting the SNP at position rs1799971 of the human MOR gene. This technique has been previously utilized successfully for the detection of other SNVs in the human genome.

The study was conducted at the Biomedical Science Laboratory, KIU, Sri Lanka. It was an experimental study, where a novel assay was designed for the OPRM1 gene rs1799971 (G) variant and validated through a cohort of drug addicts who are residing at rehabilitation centers.

Clinical sample collection and DNA Extraction

Buccal swab samples were obtained from volunteers at selected rehabilitation centers in Sri Lanka. The participants were instructed to wash their mouths with clean water before the sample collection procedure. The buccal cells were collected using a swab. The swab was be rubbed against the inside of the mouth several times on both sides. The swab was sealed in a separate container and kept on ice until transported to the laboratory.

From the buccal swab, DNA was extracted using the QIAamp DNA Mini kit (Qiagen, Germany). The extracted DNA specimens was stored at -20⁰C until genotyped.

Designing Primers

The primers for the OPRM1 gene rs1799971 (G) variant were newly designed using web-based tools, Primer1 http://primer1.soton.ac.uk/primer1.html which is especially designed to create T-ARMS PCR primers (10) and NCBI Primer design tool http://www.ncbi.nlm.nih.gov/tools/primer-blast/. OPRM1 gene rs1799971 (G) gene sequence was obtained from the NCBI (NCBI Reference Sequence: NC_000006.12). The 1000 bases with the SNV in the center from 5′ to 3′ direction of the DNA sequence was obtained from Serial Cloner and inserted to Primer1 software. The standard parameters to create T-ARMS primers were considered such as Tm, %GC, length and complementarity and product sizes (11). The melting temperature of each primer was considered to select the final set of primers. NCBI primer blast was used to check the specificity of the primers and the primer details are illustrated in Table 1.

Table 1

Tetra-primer ARMS-PCR primers for the detection of OPRM1 gene rs1799971 variant
Primers	Sequence (5’ to 3’)	Length (bp)	Product Size (bp)	Tm (^oC) primer blast result	Tm (^oC)
OPRM1 rs1799971
Forward inner primer (G allele)	GGGTCAACTTGTCCCACTTAGATGTCG	26	Control: 395 (G): 186 (A): 257	68	66.2
Reverse inner primer (A allele)	ACCGCATGGGTCGGACAGTTT	20		68	66.6
Forward outer primer (5' − 3')	GTAAGAAACAGCAGGAGCTGTGGCAG	25		68	65.7
Reverse outer primer (5' − 3')	CATGACCAGGAAGTTTCCGAAGAGC	24		68	65.0

ARMS-PCR for genotyping of the OPRM 1 gene rs1799971

The Thermal Cycler (Bio Rad) was used to conduct gradient PCR for the targeted variant OPRM 1 gene rs1779791. The primer annealing temperatures mentioned in the primer vials by the manufacturer were considered for the annealing temperature gradient in the first attempt at PCR optimization. Following a series of optimization attempts, the final optimized cyclic conditions for this variant consisted of an initial denaturation of 3 min at 94°C (initial denaturation), followed by 30 PCR cycles of 1 min at 94°C (denaturation), 30 s at 58°C (annealing temperature), 1 min at 72°C and the final extension of 5 min at 72°C. The optimized PCR master mixture contained 2 µl of the DNA extracted by the QIAamp DNA Mini kit, 5.0 µL of 5 × Green Go-Taq Flexi Buffer, 1.5 µL of MgCl₂ (25 mM), 1.0 µL dNTP mixture (2.5 mM), 1.5 µL of 25µM of two outer primers, 1.0 µL of 25µM of two inner primers, 0.2 µL of 5U/UL Taq polymerase and 10.3 µl of dH₂O.

Gel Electrophoresis

The resultant PCR product of 10 µL were analyzed by 2% agarose gel electrophoresis, in TBE 1X buffer, containing ethidium bromide at 100 V for 45 minutes and visualized under an UV illuminator.

Validation of Genotyping

Sensitivity and specificity of the T-ARMS PCR was tested using 52 DNA samples from the volunteers using the developed protocol.

Data Analysis

The genotype frequencies were calculated using data from the gel images (allele counts). They were recorded, and genotype frequencies for homozygous wild type (AA), heterozygous variant (AG), and homozygous variant (GG) genotypes, as well as allele frequencies for A (wild type) and G (variant) alleles, were calculated and tested for Hardy Weinberg equilibrium using an online calculator (available at: https://wpcalc.com/en/equilibrium-hardy-weinberg/).

Table 2

Genotype and allele frequency of OPRM1 gene rs1799971 variant
Samples (n = 52)	Genotype frequency			Allele frequency
Samples (n = 52)	AA	AG	GG	A (major allele)	G (minor allele)
Opioid addict volunteers	15 (28.9%)	15 (28.9%)	22 (44%)	0.4327 (43.3%)	0.5673 (56.7%)

An SNV is a single nucleotide alteration that can occur at a specific genome position. It is considered as a common genetic variation that can occur among genetic related disorders (12). Given the importance of genetic variation in human disease, particularly substance use disorders like OUD, one of the most important tasks of genetic research is to uncover genetic variants in individuals. Since the completion of Human Genome project, the single nucleotide variants are on the limelight as genetic markers. SNVs are widely studied in different aspects of disorders. Researchers genotype the SNVs with high-through put techniques such as the TaqMan technology, DNA microarray, MALDI-TOF mass spectrometry, and sequencing (13–16). However, these techniques are expensive when they are replicated among a large population. The most commonly used approach for SNV genotyping is polymerase chain reaction (PCR) (17). There are several modified PCR techniques available, traditionally the polymerase chain reaction (PCR) followed by RFLP technique was used to study the SNVs related to OUD (9, 18). However, due to the cost and time consumption of these techniques, there are various techniques that are validated. One such method, Tetra-primer amplification refractory mutation system–PCR (T-ARMS PCR), a simple and cost-effective SNV genotyping approach only involving single PCR followed by gel electrophoresis was used to genotype the most common SNV related to OUD. The technique was used to genotype the most common variant of the OUD, OPRM1 gene rs1799971 variant. Extensive research has been conducted to investigate the potential significance of the OPRM1 gene to individual susceptibility to addiction. The most common single-nucleotide nucleotide (SNV) discovered in OPRM1 translated areas is A118G, which is located in exon I and causes Asn40Asp amino acid substitution (19).

To determine the genotype, the tetra-primer ARMS-PCR employs four primers in a single PCR. Two non-allele-specific primers amplify the area containing the SNV at the start of the reaction. So, they're called outer primers. The outer primers fragment serves as a template for the two allele-specific primers (inner primers) that will produce the allele-specific fragments. The two allele specific fragments can be identified in an agarose gel by placing the outer primers at different ranges from the variant nucleotide (20, 21). However, the optimization procedure can be time-consuming and laborious (22). One of the common limitations faced with the T-ARMS procedure is the specificity and the sensitivity to detect the bands in terms of ideal concentrations of MgCl₂, four primers, dNTPs and annealing temperature (22). The protocol development was divided into three stages. The first stage was carrying out the initial trial of T-ARMS PCR using the literature to identify the bands. Then with the results of the initial protocol, the optimization procedure of MgCl₂ was carried out. Different concentrations were used and ideally the 1.5 µL of 25mM was used for the protocol. Next, the optimization of the primers was carried out. One of the important steps was balancing the concentrations of four primers and optimizing it. The outer primers react strongly to small changes of concentrations, and it was crucial for the inner primers to bind specifically aside from forming non-specific bands. One of the major difficulties identified was forming of the non-specific bands at the bottom of the gel. To overcome this issue, PCR touchdown and several concentrations of four primers were used (23). Finally, a lower volume of inner primers and higher volumes of outer primers with same concentration visualized a clear and specific band. A higher volume of outer primers inhibited the non-specific band formation. The final concentration for rs1799971 detection was shown in the Table 1.

The crucial step was to identify the optimum annealing temperature. Different gradients were carried out for the annealing temperature. The gradient reaction was repeated till the heterozygous, homozygous controls were visible. It was observed that the gradient range was within 56^oC to 66^oC for all the three bands. However, at 58^oC the bands were having an intense visualization and hence the optimal annealing temperature was chosen as 58^oC.

The final protocol was balanced with 58^oC temperature, outer primers wee stabilized, and intensity of the inner primer amplicons were balanced. Further, the non-specific band formation was limited due to the annealing temperature being different from the T_m of the four primers. In addition to this, the gel concentration was optimized for the visualization of the amplicons and 2% gel was ideally used. The products of the T-ARMS PCR for rs1799971 contained 395bp as the control band, 186bp as G allele (variant) and 257bp as A allele (wild type). A significant difference of bands between the two alleles shows the visualization of the bands in the gel clearly (23). Figure 1 shows the expected gel patterns for the protocol and the Fig. 2 shows the actual image of the genotype results of the three combinations.

In the attempt of validating the novel protocol, the final protocol was applied to random 52 DNA samples of volunteers from rehabilitation centers, Sri Lanka. All the volunteers in the sample cohort that was genotypes were males with a history of using opioids. The expected gel band patterns were observed in the gel image results of the samples. The genotype and the allele frequencies of the samples are shown in the Table 2. Out of the 52 samples genotyped, there were 44% of homozygous variant type (GG), 28.9% of homozygous wild type (AA) and 28.9% of heterozygous (AG). The predominant genotype was GG (44%) and the minor allele frequency was 56.7% as shown in the Table 2. Additional file 2: Figure S1 to S4 shows the expected gel band patterns for the 52 samples.

The OPRM1 gene rs1799971 variant has been studied in various population and the present study is an addition to the South Asian population genotyping data. The genotyping results were comparable to the studies conducted in South Asian region as well as a study conducted in Sri Lanka by Dissabandara et al., (24). The study concluded a 44% of volunteers with homozygous OPRM1 gene rs1799971 variant, thus in line with the previous study.

Several methods for genotyping single-nucleotide variants (SNVs) are available as a result of the rapid development of molecular techniques. Nonetheless, the search for simple, robust, and less expensive techniques continues.

The objective of the study was to develop a tetra-primer Amplification Refractory Mutation System-Polymerase Chain Reaction-based technique for genotyping the rs1799971 SNV in OPRM1 genes so that these protocols could be used to establish an association between the studied mutations and the trait, assuming phenotypic data is available. Any associated SNV could be used to expedite identification of an individual's susceptibility to opioids and design a personalized therapy. Tetra ARMS-PCR is a cost effective, efficient, and reproducible technique that could be utilized to genotype the drug addicts based on the mutation.

SNV – Single Nucleotide Variant

DNA – Deoxyribonucleic acid

MALDI-TOF - Matrix-assisted laser desorption/ionization-time of flight

OUD – Opioid Use Disorder

T-ARMS PCR - tetra-primer amplification refractory mutation system-polymerase chain

PCR - Polymerase chain reaction

CGAS - candidate gene association studies

GWAS - genome-wide association studies

MOR - µ-opioid receptor

PCR-RFLP - Polymerase chain reaction-restriction fragment length polymorphism

TBE - Tris/Borate/EDTA buffer

UV – Ultraviolet

Tm – Melting Temperature

MgCl2 – Magnesium Chloride

dNTPs - deoxynucleotide triphosphates

Acknowledgements

The authors extend their sincere gratitude for all the participants who volunteered for the clinical sample collection.

Funding

This research was funded by the World Bank (HEI DOR (R2) No. 06) using the aid of the Accelerating Higher Education Expansion and Development (AHEAD) Operation of the Ministry of Higher Education.

Availability of data and materials

All the datasets used and or analyzed during the current study are available from the corresponding author on reasonable request at [email protected]

Ethics approval and consent to participate

The informed written consent was obtained from the volunteers prior to the sample collection. The buccal swab samples were collected from Rehabilitation Centers of Sri Lanka with the approval of the NDDCB, Sri Lanka and the ERC of KIU, Sri Lanka. The ethical approval for the study was obtained from the Ethics Review Committee of KIU (ERC/KIU/20/39). All the methods were carried out in accordance with relevant guidelines and regulations in the declaration and the confidentiality was assured.

Competing interests

The authors declare no competing interests.

Consent for publication

Not applicable.

Authors' contributions

PJW was the principal investigator of the study and took the leading role from conception, design, and data collection process to the final analysis and preparation of the manuscript. NDKR contributed for the designing the protocol, supervising, writing, and editing the manuscript. NN participated in the design of the study and manuscript editing. ARJ, DMHN, NN and SSNF contributed to writing the manuscript. All authors read and approved the final manuscript.

Authors’ information

Not applicable

Author details

Not applicable

Kendler KS, Myers J, Prescott CA. Specificity of Genetic and Environmental Risk Factors for Symptoms of Cannabis, Cocaine, Alcohol, Caffeine, and Nicotine Dependence. Arch Gen Psychiatry [Internet]. 2007 Nov 1 [cited 2022 Jun 25];64(11):1313–20. Available from: https://jamanetwork.com/journals/jamapsychiatry/fullarticle/482486
Tsuang MT, Lyons MJ, Meyer JM, Doyle T, Eisen SA, Goldberg J et al. Co-occurrence of Abuse of Different Drugs in Men: The Role of Drug-Specific and Shared Vulnerabilities. Arch Gen Psychiatry [Internet]. 1998 Nov 1 [cited 2022 Jun 25];55(11):967–72. Available from: https://jamanetwork.com/journals/jamapsychiatry/fullarticle/204442
Ducci F, Goldman D. The Genetic Basis of Addictive Disorders. Psychiatr Clin North Am [Internet]. 2012 Jun [cited 2022 Jun 25];35(2):495. Available from: /pmc/articles/PMC3506170/
Kendler KS, Karkowski LM, Neale MC, Prescott CA. Illicit psychoactive substance use, heavy use, abuse, and dependence in a US population-based sample of male twins. Arch Gen Psychiatry [Internet]. 2000 [cited 2022 Jun 26];57(3):261–9. Available from: https://pubmed.ncbi.nlm.nih.gov/10711912/
Tsuang MT, Lyons MJ, Meyer JM, Doyle T, Eisen SA, Goldberg J et al. Co-occurrence of abuse of different drugs in men: the role of drug-specific and shared vulnerabilities. Arch Gen Psychiatry [Internet]. 1998 [cited 2022 Jun 26];55(11):967–72. Available from: https://pubmed.ncbi.nlm.nih.gov/9819064/
Crist RC, Reiner BC, Berrettini WH. A Review of Opioid Addiction Genetics. Curr Opin Psychol [Internet]. 2019 Jun 1 [cited 2022 Jun 25];27:31. Available from: /pmc/articles/PMC6368898/
Reed B, Butelman ER, Yuferov V, Randesi M, Kreek MJ. Genetics of Opiate Addiction. Curr Psychiatry Rep. 2014 Nov 1;16(11).
Kroslak T, Laforge KS, Gianotti RJ, Ho A, Nielsen DA, Kreek MJ. The single nucleotide polymorphism A118G alters functional properties of the human mu opioid receptor. J Neurochem [Internet]. 2007 Oct 1 [cited 2022 Jun 26];103(1):77–87. Available from: https://onlinelibrary.wiley.com/doi/full/10.1111/j.1471-4159.2007.04738.x
Deb I, Chakraborty J, Gangopadhyay PK, Choudhury SR, Das S. Single-nucleotide polymorphism (A118G) in exon 1 of OPRM1 gene causes alteration in downstream signaling by mu-opioid receptor and may contribute to the genetic risk for addiction. J Neurochem [Internet]. 2010 Jan [cited 2022 Jul 12];112(2):486–96. Available from: https://pubmed.ncbi.nlm.nih.gov/19891732/
Collins A, Ke X. Primer1: Primer Design Web Service for Tetra-Primer ARMS-PCR. Opem Bioinforma J. 2012;6:55–8.
Ye S, Dhillon S, Ke X, Collins AR, Day INM. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res [Internet]. 2001 Sep 9 [cited 2022 Dec 5];29(17):e88. Available from: /pmc/articles/PMC55900/
Zou H, Wu LX, Tan L, Shang FF, Zhou HH. Significance of Single-Nucleotide Variants in Long Intergenic Non-protein Coding RNAs.Front Cell Dev Biol [Internet]. 2020 May 25 [cited 2022 Dec 26];8. Available from: /pmc/articles/PMC7261909/
Wei-Peng Wang K-YN. Approaches for SNP genotyping. Yi Chuan [Internet]. 2006 Jan [cited 2022 Dec 28];28(1):117–26. Available from: https://pubmed.ncbi.nlm.nih.gov/16469727/
Ding C, Jin S. High-throughput methods for SNP genotyping. Methods Mol Biol. 2009;578:245–54.
Shen R, Fan JB, Campbell D, Chang W, Chen J, Doucet D et al. High-throughput SNP genotyping on universal bead arrays. Mutat Res [Internet]. 2005 Jun 3 [cited 2022 Dec 28];573(1–2):70–82. Available from: https://pubmed.ncbi.nlm.nih.gov/15829238/
Griffin TJ, Smith LM. Single-nucleotide polymorphism analysis by MALDI-TOF mass spectrometry. Trends Biotechnol [Internet]. 2000 Feb 1 [cited 2022 Dec 28];18(2):77–84. Available from: https://pubmed.ncbi.nlm.nih.gov/10652512/
Matsuda K. PCR-Based Detection Methods for Single-Nucleotide Polymorphism or Mutation: Real-Time PCR and Its Substantial Contribution Toward Technological Refinement. Adv Clin Chem [Internet]. 2017 [cited 2022 Dec 28];80:45–72. Available from: https://pubmed.ncbi.nlm.nih.gov/28431642/
Dissabandara LO, Loxton NJ, Ho AM, Wu HM, Dodd PR, Daglish M et al. Direct, Indirect and Epistatic Associations of Reward System Genes with Heroin Dependence. Ashdin Publ J Drug Alcohol Res. 2021;10(2021).
Hurd YL, O’Brien CP. Molecular genetics and new medication strategies for opioid addiction. Am J Psychiatry. 2018 Oct 1;175(10):935–42.
Rubio M, Caranta C, Palloix A. Functional markers for selection of potyvirus resistance alleles at the pvr2-eIF4E locus in pepper using tetra-primer ARMS-PCR. Genome [Internet]. 2008 Sep [cited 2022 Dec 28];51(9):767–71. Available from: https://pubmed.ncbi.nlm.nih.gov/18772955/
Ye S, Dhillon S, Ke X, Collins AR, Day INM. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res [Internet]. 2001 Sep 1 [cited 2022 Dec 28];29(17):88–88. Available from: https://pubmed.ncbi.nlm.nih.gov/11522844/
Ranadeva NDK, Sirisena ND, Wetthasinghe TK, Noordeen N, Dissanayake VHW. Design and implementation of a novel pharmacogenetic assay for the identification of the CYP2D6*10 genetic variant. BMC Res Notes [Internet]. 2022;15(1):1–5. Available from: https://doi.org/10.1186/s13104-022-05993-6
Medrano RFV, De Oliveira CA. Guidelines for the tetra-primer ARMS-PCR technique development. Mol Biotechnol. 2014;56(7):599–608.
Dissabandara LO, Loxton NJ, Ho AMC, Wu HM, Dodd PR, Daglish M, et al. Direct, indirect and epistatic associations of reward system genes with heroin dependence. J Drug Alcohol Res. 2021;10:1–12.

No competing interests reported.

Additionalfile1.docx
Additional file 1: Figure S1, S2, S3 and S4. Gel band patterns of samples for OPRM1 rs1777971 variant.
Additionalfile2.docx
Additional file 2: Table S1. Genotyping results of the 52 volunteer patients.

Download PDF

Journal Publication

published 14 Nov, 2023

Read the published version in BMC Research Notes →

Editorial decision: Major revision
30 Jan, 2023
Editor assigned by journal
30 Jan, 2023
Submission checks completed at journal
27 Jan, 2023
First submitted to journal
23 Jan, 2023

You are reading this latest preprint version

A Novel Tetra-Primer ARMS-PCR for genotyping of the OPRM 1 gene rs1779791 variant associated with opioid use disorders

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Clinical sample collection and DNA Extraction

Designing Primers

ARMS-PCR for genotyping of the OPRM 1 gene rs1799971

Gel Electrophoresis

Validation of Genotyping

Data Analysis

Results And Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1