Generation of three-dimensional skeletal muscle tissue as  cultured meat from stable pig epiblast stem cells

doi:10.21203/rs.3.rs-2507597/v1

Download PDF

Article

Generation of three-dimensional skeletal muscle tissue as cultured meat from stable pig epiblast stem cells

https://doi.org/10.21203/rs.3.rs-2507597/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 09 Dec, 2023

Read the published version in Nature Communications →

Version 1

posted

You are reading this latest preprint version

Cultured meat (CM) production has emerged as a breakthrough technology for the global food industry, with the potential to reduce challenges associated with environmental sustainability, global public health, animal welfare, and competition for food between humans and animals. The muscle stem cell lines currently used for CM production cannot be passaged in vitro for extended periods of time. Here, we successfully developed a directional differentiation system of porcine pregastrulation epiblast stem cells (pgEpiSCs) with stable cellular features and achieved serum-free myogenic differentiation of the pgEpiSCs. The pgEpiSCs-derived skeletal muscle progenitor cells and skeletal muscle fibers show typical muscle cell characteristics and display skeletal muscle transcriptional features during myogenic differentiation. Importantly, we further established a three-dimensional differentiation system for shaping cultured tissue by screening plant-based edible scaffolds of non-animal origin, followed by the generation of pgEpiSCs-derived CM. These advances provide a novel technical approach for the development of CM.

Biological sciences/Biotechnology/Stem-cell biotechnology

Biological sciences/Stem cells/Embryonic stem cells

In recent years, global food consumption has increased due not only to the expanding worldwide population but also a shift in eating patterns^{1, 2}, including increased demand for foods of animal origin (e.g., meat), putting additional strain on the livestock industry.³ These increases have had negative impacts on livestock⁴, food security⁵, animal welfare⁶, climate change^{1, 7–9}, environmental sustainability^10–12, public health^{13, 14}, and competition between human and animal rations^{1, 15}. Moreover, livestock breeding is unable to meet the rising demand for meat protein⁴. As a consequence, it is essential to develop new food technologies and alternate ways to address the aforementioned concerns¹⁵. Cultured meat (CM) not only promotes environmental aims¹⁶ but also has the potential to produce "clean meat"^{17, 18}.

CM, a disruptive future food technology that efficiently blends clean production and sustainable food creation^{19, 20}, uses stem cell technology to produce edible meat tissue through cell differentiation in vitro^{20, 21}. The pace of innovation in CM development has accelerated with the continuous development of cross-disciplinary approaches, but it still faces major technical challenges^{19, 22–24}, including a lack of initiating cell lines and sufficient technologies for serum-free culture, scaffolding materials, large-scale suspension and expansion culture. One of the cornerstones of the production of CM is a high-quality initiating cell line. Currently accessible cell lines include mesenchymal stem cells and muscle stem cells (MuSCs), which can be amplified only a limited number of times before losing their capacity to differentiate²⁵. Unlike these cells, stable pluripotent stem cells (PSCs) derived from epiblasts may self-renew indefinitely and differentiate into any type of somatic cell, providing a new avenue for the development of CM²⁶. The establishment of stable PSCs from livestock species has been a challenge in the field for the last 40 years¹⁹. However, the generation of stable porcine pgEpiSCs provides a new opportunity²⁷. In addition, it is essential to achieve the serum-free differentiation²⁸ of livestock PSCs in edible scaffolds to achieve three-dimensional differentiation and provide a theoretical basis and system reference for later cell large-scale expansion and tissue shaping culture.

In this study, we further validated the stability of the pgEpiSCs obtained in our previous work²⁷. We also successfully established a myogenic differentiation system with a complete, transgene-free and serum-free process and verified differentiation accuracy at the transcriptome and metabolome levels, ultimately achieving the first development of CM derived from pgEpiSCs on an edible 3D scaffold.

pgEpiSCs are ideal initiating cells for the development of CM

We previously established a cell line (pgEpiSCs)²⁷ that not only can be sustained in long-term culture to achieve consistent clonal proliferation but also retains genome stability, both of which are considered ideal features of initiating cells for the development of CM.

To evaluate the pluripotency maintenance and differentiation potential of high-passage pgEpiSCs, we performed long-term cell culture in vitro and embryoid body (EB) differentiation assays and found that pgEpiSCs showed distinct and smooth colony boundaries and alkaline phosphatase (AP) activity (Supplementary Fig. 1A, B) and expressed major pluripotency protein markers (Fig. 1A) after 200 passages. We further confirmed the genomic stability of the pgEpiSCs at high passages by using an alkaline comet and karyotype assay because the capacity of PSCs to preserve their genetic integrity is critical to their ability to self-renew indefinitely. The results indicated that normal karyotypes and no significant accumulation of DNA damage occurred in the pgEpiSCs at low or high passages during the long-term passaging process (Supplementary Fig. 1D, G, I), while damaged DNA formed a comet tail in the H₂O₂-treated cells (Fig. 1B & Supplementary Fig. 1C). We also isolated porcine MuSCs (pMuSCs) from porcine muscle and investigated their characteristics during culturing in vitro. These results (Supplementary Fig. 2) showed a lower differentiation ability of pMuSCs at P13, indicating that pMuSCs lost their muscle stem cell features and differentiation potential during long-term culture in vitro, consistent with a previous report²⁹. However, pgEpiSCs at different passages could form EBs and differentiate randomly (Supplementary Fig. 1E, F), accompanied by downregulation of core pluripotency-related genes and upregulation of genes associated with differentiation into all three major lineages (Supplementary Fig. 1H), producing ectoderm, mesoderm, and endoderm tissue cells (Fig. 1C). These results suggest that the differentiation potential of pgEpiSCs is unaffected by increasing passage numbers.

Next, we performed RNA-seq using pgEpiSCs at passage 30 (P30) and at P200 to more comprehensively assess the properties of the cells. Unsupervised hierarchical clustering and correlation analysis revealed that pgEpiSCs at different passages could be clustered together (Supplementary Fig. 3A) and separated from porcine embryonic fibroblasts (PEFs) by principal component analysis (PCA) (Fig. 1D & Supplementary Fig. 3B). Additionally, the expression patterns of differentially expressed genes in pgEpiSCs were entirely different from those in PEFs (Fig. 1E), and pluripotency-related genes such as OTX2, SOX2, NANOG, LIN28 and OCT4 were highly expressed in pgEpiSCs at both low and high passage numbers (Supplementary Fig. 3C-E). Gene Ontology (GO) analysis revealed the enrichment of terms including associated with "ion transport" (Supplementary Fig. 3G, H), which are relevant to the function of PSCss. More significantly, our results indicated that neither cancer-related hallmark genes nor splicing factors were expressed in pgEpiSCs (Fig. 1F & Supplementary Fig. 3F), implying that no cancer cell-related characteristics^{30, 31} were present in high-passage pgEpiSCs and that the ability to maintain long-term stable passage is associated with pluripotency gene expression. Overall, these findings suggest that pgEpiSCs are ideal initiating cells for the development of CM due to their excellent long-term stable proliferation in vitro, differentiation potential, and maintenance of a stable genome.

A serum-free approach for myogenic differentiation from pgEpiSCs

Since pgEpiSCs have limitless self-renewal capacity and multi-differentiation potential, we hypothesized that pgEpiSCs could be differentiated into muscle cells (MCs) by activating or inhibiting specific signalling pathways to establish a serum- and transgene-free myogenic differentiation method. To initiate differentiation, we first applied the human or mouse differentiation system, in which the serum is replaced with insulin-transferrin-selenium (ITS). However, we found that the cells differentiated in this way were unable to adhere under feeder-free conditions (Supplementary Fig. 4A). Next, we adjusted the early differentiation system with modifications to the basal pgEpiSC culture medium and found that B27 is important for initiating differentiation. We observed that the differentiating cells in the B27 group not only adhered better but also exhibited greater random differentiation potential (Supplementary Fig. 4B); therefore, we selected this medium for continued differentiation (Fig. 2A).

To further differentiate the cells towards paraxial mesoderm (MES), we designed small molecule combinations based on previous reports on MES-related signalling pathways^32–35, such as the WNT, BMP and TGF-β pathways. The results indicated that activation of WNT and inhibition of TGF-β is the best combination for initial induction of mesodermal cells³² in which MES-related markers (such as T, PDGFRα, and MSGN1) were highly expressed (Fig. 2C & Supplementary Fig. 4D-F), although the use of different molecule combinations did not affect the cell morphology (Supplementary Fig. 4C). We further confirmed pluripotency exit by AP staining and MES induction by immunostaining for T (Supplementary Fig. 4G, H). Interestingly, only the combination of WNT activation and TGF-β inhibition promoted further differentiation of myogenic progenitor cells (MPCs) (Fig. 2B). The pgEpiSCs-derived MPCs expressed PAX7 in conjunction with MYOD (Fig. 2D, F), with a high proportion of CD31⁻CD45⁻CD56⁺ cells of 96.14% (Fig. 2E, G) and exhibited a differentiation efficiency similar to that of hPSCs³² or mPSCs³⁶. Moreover, we utilized N₂ to perform serum-free terminal differentiation. The morphology of the differentiated cells was similar to that of cells induced with horse serum (HS)³³ (Fig. 2H), and the pgEpiSCs-derived MCs were able to form multinucleated myotubes (Supplementary Fig. 5A, B), express genes-related to myofiber maturation and markers of mature skeletal muscle fibers (SMFs) with F-actin, Myosin, and MF20 (Fig. 2I & Supplementary Fig. 5C), maintain high levels of cell activity and chromosomal numbers were unaltered (Supplementary Fig. 5D-F). Taken together, these findings show that we were able to consistently induce pgEpiSCs into mature SMFs by using transgene-free and serum-free differentiation protocols.

Transcriptome features of myogenic differentiation of pgEpiSCs We subsequently analysed RNA-Seq data, with a focus on the expression levels of marker genes known to be involved in critical phases of myogenic lineage differentiation, to determine whether the differentiation scheme generates cells of the expected lineage at each stage. We identified 14546 genes with a median expression value of > 0.5 within each group (Supplementary Fig. 6A), and PCA demonstrated correlations among the three cell groups (Fig. 3A & Supplementary Fig. 6B), showing the changes in transcription from pgEpiSCs to pgEpiSCs-MPCs and pgEpiSCs-MCs. This finding was also corroborated by ternary plots (Fig. 3B) and the distribution of marker genes ranked by loading score (Fig. 3C).

To understand the in vitro myogenic differentiation process of pgEpiSCs, we utilized K-means clustering to divide genes with significant time-dependent changes in expression into 10 clusters (Supplementary Fig. 6C, D). The signature genes of each cluster were vastly enriched at the corresponding phase (Supplementary. Figure 6E), supporting the accuracy of the K-mean clustering. Each cluster displayed distinct transcriptional alterations, with seven clusters matching the expression patterns of characteristic genes during myogenesis (Fig. 3D). Highlighting myogenesis patterns generally ranged from pgEpiSCs to multinucleated myotubes by GO term functional enrichment analysis (Fig. 3E), and remodelling of the extracellular matrix was observed, which was consistent with the qPCR results (Fig. 3F, G). Clusters 1 and 7 had PSC characteristics (Supplementary Fig. 7A, B); Clusters 2 and 3 had MPC characteristics (Supplementary Fig. 7C, D); and Clusters 5, 8, and 10 had mature myoblast and myofiber characteristics (Supplementary Fig. 7E-H). Moreover, Venn diagrams revealed that both were enriched for muscle development-related functions and that the same gene expression patterns (Supplementary Fig. 6F, G) were associated with myogenic differentiation of pgEpiSCs-MCs and pMuSCs, implying that SMFs derived from pgEpiSCs are similar to those derived from differentiated pMuSCs. In general, the results indicated that pgEpiSCs-derived skeletal muscle cells exhibit typical muscle cell transcriptome features.

Significant changes in the metabolites of skeletal muscle cells generated from pgEpiSCs

The cell differentiation process is accompanied by changes not only in gene expression but also in energy metabolism, enabling stem cells to satisfy the requirements of lineage specification³⁷. To investigate the changes in metabolites during myogenic differentiation of pgEpiSCs, we performed an untargeted metabolomics analysis (Fig. 4A).

We first performed quality control to confirm the accuracy of the metabolomic sequencing data (Supplementary Fig. 8A, B) and observed that the two groups (pgEpiSCs and pgEpiSCs-MCs) were distinguishable (Fig. 4B & Supplementary Fig. 8C-E) when analysed with three different methods (PCA, PLSDA, and OPLS-DA), implying that the data were reliable. We identified a total of 70 different metabolites (Fig. 4C). Then, we performed hierarchical clustering of all significant metabolites (Fig. 4D) to better understand the differences in metabolite abundance among different samples. Differentially abundant metabolites were shown to be enriched in multiple distinct metabolic pathways (Fig. 4E), including vitamin B6, the pentose phosphate pathway, mineral absorption, protein digestion and absorption, which were identified as myogenic differentiation stage alterations of crucial pathways³⁸. Moreover, succinic acid expression was downregulated, while glucose 6-phosphate expression was upregulated (Fig. 4G). Furthermore, the genes associated with the production of acetyl-coenzyme A, ATP, glycolysis metabolism-related enzymes exhibited significant changes after myogenic differentiation, as confirmed by qPCR (Fig. 4F, H). In addition, compared to undifferentiated cells, differentiated cells produced significantly more ATP and lactate, but less glucose (Fig. 4I & Supplementary Fig. 8F, G). In conclusion, these results established the metabolomic characteristics of pgEpiSCs-derived skeletal MCs, validating the feasibility of differentiation at the metabolic level.

Plant-based 3D edible scaffolds enable the creation of meat-like tissue.

Innovations in scaffold technology that support cell growth and morphology could provide textural properties to CM. We designed plant-based 3D edible scaffolds without animal-derived components by achieving ionic cross-linking between konjac glucomannan (KGM), sodium alginate (SA) and calcium ions through solution substitution of an ethanol-water solution. To estimate the physico-mechanical characteristics and basic suitability for muscle cell cultivation of scaffolds with different compounding ratios, we compared the structural characteristics (Supplementary Fig. 9B, C, F, G), the inoculation efficiency, adhesion and survival of C2C12 and pMuSCs (Supplementary Fig. 9D, E, H), water absorption and degradation (Supplementary Fig. 10A-C), and mechanical stability (Supplementary Fig. 10D) of scaffolds. The results showed that the Ca²⁺-KGM₅-SA₅ scaffold not only has a porous and homogeneous lamellar structure, but also has rapid, high-water uptake and low degradation properties, while providing over 95% to adhesion live cells and stable mechanical support. Thus, the Ca²⁺-KGM₅-SA₅ scaffold could be used as the scaffold type for future research.

To acquire CM derived from pgEpiSCs, we next inoculated pgEpiSCs-MCs on the Ca²⁺-KGM₅-SA₅ scaffold (Fig. 5A) and assessed their ability for initial culture, proliferation and myogenic differentiation. The pgEpiSCs-MCs adhered to the scaffolds with a high survival rate (Fig. 5B & Supplementary Fig. 11B), and significant proliferation (Supplementary Fig. 11A). Further study revealed that pgEpiSCs-MCs exhibited interconnected, extended myofiber morphology and covered the porous structure (Fig. 5C, D), and expressed myofiber differentiation-related proteins (Supplementary Fig. 11F). Besides, pgEpiSCs-MCs showed high mRNA expression of genes related to maturation of myogenic differentiation (MYOG, MYMK), skeletal muscle fibers (MYH2, MYH3) and collagen formation (COL3A1, COL5A2) on 3D scaffolds, while the pluripotency genes (OCT4, NANOG) were down-regulated (Fig. 5E). Eventually, CMs produced from pgEpiSCs stained with food coloring had a meat-like appearance (Fig. 5F & Supplementary Fig. 11G) and enhanced textural properties compared to scaffolds of uninoculated cells (Fig. 5G), especially after cooking (Supplementary Fig. 11H). Importantly, our CMs produced by pgEpiSCs are rich in conditional essential amino acids and free of contamination by foodborne pathogenic bacteria, while inoculated cells maintain stable karyotypes (Supplementary Fig. 11C-E). Overall, we have achieved the initial generation of pgEpiSCs-derived CM.

CM, a cutting-edge technology in cellular agriculture^{2, 15, 19, 21}, aims to differentiate stem cells into mature muscle fibers in vitro by using tissue engineering techniques and is expected to address the imbalance between population growth and meat demand^{1, 2}. However, obtaining initiating cell lines, establishing serum-free culture systems and constructing 3D edible scaffolds remain challenges. In this study, we achieved myogenic differentiation of stably passaged pgEpiSCs in vitro, not only employing serum-free conditions throughout the process but also achieving the generation of CM from pgEpiSCs on a screened 3D edible scaffold of non-animal origin.

One of the critical limitations in the development of CM is the availability of natural cell lines^{3, 19}. Previous studies have used MuSCs^39–42 of various species for CM development; however, these cells cannot be expanded stably in vitro^{25, 29}. Recently, immortalized fibroblasts as initiating cells have been demonstrated to generate the required number of cells, but the regulating mechanism remains to be elucidated⁴³. Although induced pluripotent stem cells (iPSCs) have been generated from various livestock animals^{44, 45}, their application in CM development has raised safety concerns and must be approached with caution due to the requirement for exogenous gene introduction or the use of viruses during the induction process¹⁹. The use of PSCs does not entail the aforementioned problems, as they can self-renew indefinitely and differentiate into all cell lineages²⁷. Our findings further indicated that pgEpiSCs have the molecular characteristics of pluripotency and differentiation potential independent of cell generation expansion. Moreover, pgEpiSCs possess genomic stability, and we confirmed that the high-generation cells did not undergo significant DNA damage or exhibit cancer cell-related characteristics^{30, 31} at P200. We are continuing these passaging experiments, and the findings to date support the great potential of pgEpiSCs for biosafety and promoting cellular agriculture applications²⁶.

Skeletal myoblasts are the most prevalent cell type in skeletal muscle tissue and the essential cellular component in the production of CM²⁵. Despite the development of a chemically defined serum-free differentiation medium for MuSCs²⁸, these cells still require the addition of serum during their proliferation. PSCs culture is fundamentally a serum-free maintenance system, and previous research on transgenic⁴³ and serum-dependent²⁹ approaches for myogenic differentiation exposed the technical barriers to CM development. Moreover, extending the myogenic differentiation of PSCs to livestock species is a critical challenge¹⁹ because the early induction stage holds the key to the difference in the effectiveness and consistency of differentiation⁴⁶. Apart from the previously described system³³, early WNT activation, as well as the presence of endogenous BMP4 and TGF-β inhibitors³⁴, was a decisive requirement for maximal PAX7 induction, and the efficiency of differentiation was similar to that of hPSCs³² or mPSCs³⁶. In addition, MuSCs undergo serum starvation to accomplish myogenic terminal differentiation²⁵, but the addition of N2 ensures that MPCs achieve terminal myogenic differentiation in vitro, and the accuracy of differentiation at the transcriptional and metabolic levels were further verified^{38, 47–51}. Thus, it is feasible to complete the entire process from pgEpiSC proliferation to myogenic differentiation without transgenes or serum, which is expected to increase the reliability of CM development. Besides, the problem of cost has to be resolved, with the creation of chicken breast production costing between $5.10 and $8.20 per kilogram⁴³. However, the commercial stem-cell grade serum substitutes and growth factors used in the culture medium are protected by patents and are not yet cost-controlled. Future research and development are required for the cost reduction of the culture medium, such as later large-scale production of growth factors by biosynthesis, serum substitutes according to food industrial product standards, which are also the projects we are currently tackling. Moreover, we are investigating the technique of large-scale cell suspension culture, which is projected to overcome the limit of cell quantity and thereby satisfy the demands of industrial applications.

Scaffold-based CM research needs to overcome the key technical challenge of cell adhesion^{41, 52}, and scaffolds rich in animal-derived components are widely used in CM because of their natural adhesion sites. Further, culture protocols entirely free of animal products are another new challenge driving CM development, thus previous studies focused on plant-based scaffolding materials^{39, 53} such as texturized soy protein^{42, 43}, wheat gluten³⁹, peanut wire-drawing protein^{54, 55}, prolamins⁵⁶ or decellularized plants⁵⁷, which still require small amounts of animal-derived components⁴¹ such as fibrinogen⁵⁸, thrombin⁴², collagen^{59, 60} and gelatin^{40, 41, 48, 61} during cell inoculation to promote cell adhesion. The studies based on plant polysaccharides also provide ideas to reduce the addition of animal-derived components⁵³, but they involve chemical modifications that are difficult to achieve in terms of safety and cost control. We produced plant-derived polysaccharide-based 3D edible scaffolds with lyophilization-independent ionically cross-linked porous lamellar structures by ethanol-water solution substitution to construct pgEpiSCs-derived CMs in this study. The scaffolds consist of plant-based polysaccharide components that can provide cell adhesion^{39, 62} and well-growth for pgEpiSCs-MCs without additional animal-derived adhesion materials or complex polysaccharide modifications, which not only exhibit significant cell proliferation, differentiation properties, but also rich in amino acids and free of contamination by foodborne pathogens with better safety. Moreover, the use of plant-derived polysaccharide materials has enabled controlled costs for large-scale scaffolding production⁶³. Along with its low cost, this scaffold exhibits great potential for future mass manufacturing, but its structural and mechanical features must be enhanced for future mixed cultures of different cells in addition to skeletal muscle fibers.

In conclusion, we have generated pgEpiSCs-derived CM that could overcome challenges related to cell expansion and serum dependence. This work is expected to enhance the utilization of PSCs in the CM industry, not only providing a novel technological approach for the development of CM but also benefitting the development of cellular agriculture and sustainable animal husbandry.

Culturing pgEpiSCs. The culture medium (pgEpiSCs culture medium in Table 1) was configured as previously²⁷ described, pgEpiSCs were maintained on the MEFs, which were washed with DPBS (Gibco, Cat# C14190500CP) and treated by Acctuase (Gibco, Cat# A11105-01) for 5 min to passage each 2–3 days at a density of 3–5 × 10⁴ cells/cm².

Myogenic differentiation of pgEpiSCs by serum-free induction. The procedure of myogenic differentiation was adapted from a previously published study³³ and modified to allow for myogenic differentiation of pgEpiSCs. The pgEpiSCs were digested into single cells and harvested using Acctuase (Gibco, Cat# A11105-01), which were rested in the incubator for 30 minutes to remove the feeder and seeded on gelatin-coated (Stem Cell Technologies, Cat# 07903) plates at a density of 1.5×10⁵ cells/cm² to induce myogenic differentiation. All pgEpiSCs differentiated cells were dissociated with TryPLE (Gibco, Cat# 12605010) and harvested cells were needed to be supplemented with 10µM Y27632 (Selleckchem, Cat# S1049) for 24 h following inoculation, which with new medium replaced every other day. The approach for myogenic differentiation was divided into the following major steps, and the culture medium configuration is shown in Table 1.

1) Adherent medium optimization. The culture of basic medium (BM) configuration was optimized based on the published literature. For details, see adherent medium in Table 1.

2) Optimization of myogenic differentiation medium (MDM) induction approaches. For details, see MDM medium in Table 1. (I) Single cells of pgEpiSCs were resuspended in MDM I and maintained for 3 days, which was optimized from previous studies^32–35: a) MDM BM supplemented with 1% B27 (Thermo Fisher Scientific, Cat# 12587-010), 3 µM CHIR99021 (Selleckchem, Cat# S1263) and 0.5 µM LDN193189 (Stemgent, Cat# 04–0074); b) MDM BM supplemented with 1% B27 (Thermo Fisher Scientific, Cat# 12587-010), 3 µM CHIR99021 (Selleckchem, Cat# S1263) and 2 µM SB431542 (Selleckchem, Cat# S1067); c) MDM BM supplemented with 1% B27 (Thermo Fisher Scientific, Cat# 12587-010), 3 µM CHIR99021 (Selleckchem, Cat# S1263), 0.5 µM LDN193189 (Stemgent, Cat# 04–0074) and 2 µM SB431542 (Selleckchem, Cat# S1067). (II) Cells were harvested using TryPLE (Gibco, Cat# 12605010) after 3 days of induction and inoculated in MDM II. (III) The culture was replaced with MDM IIII for 2 days. (IV) After 2 days of induction, MDM IV was supplied and maintained for 4 days. (V) Incubate for 20–25 days in MDM V. (VI) Replaced V with N₂ differentiation medium.

Isolation and culture of porcine MuSCs. Porcine MuSCs were isolated from 1-week-old pigs. 1 g of the longest dorsal muscle was washed in DPBS (Gibco, Cat# C14190500CP) containing 10% penicillin-streptomycin (Thermo Fisher Scientific, Cat# 15140-122), which was minced with surgical scissors and added to the digestion working solution (each 10 mL of digestion working solution contained 6.9 mL DMEM (Gibco, Cat# 11960-044), 1.5 mL of collagenase II (Coolaber, Cat# CC3791G ) stock solution (10×), 1.5 mL of Dispase II (Coolaber, Cat# CD4691)stock solution (10×), and 1% penicillin-streptomycin (Thermo Fisher Scientific, Cat# 15140-122)), shaking digestion at 37°C for 1 h. After terminating the digestion with complete culture medium (DMEM/F12 (Thermo Fisher Scientific, Cat# 10565-018) supplemented with 1% penicillin-streptomycin (Thermo Fisher Scientific, Cat# 15140-122), 1% MEM Non-Essential Amino Acids Solution (Thermo Fisher Scientific, Cat# 1140-050), 10% FBS (Gibco, Cat# 16000-044), and 5 ng/mL FGF₂ (PeproTech, Cat# 100-18B)) and screening successively, the complete culture medium was resuspended with cell precipitation and inoculated onto T25 culture dishes and cultured at 37°C in a 5% CO₂ incubator. The differential apposition method was used to purify MuSCs, which involved aspirating the supernatant after 2h of growth and transferring it to a fresh cell culture dish. Porcine MuSCs were cultured on gelatin-coated (Stem Cell Technologies, Cat# 07903) cell culture plates with complete medium and the media was replaced every two or three days, while cell fusion reached 90%, the cultured medium was changed to MuSCs differentiation medium (DMEM (Gibco, Cat# 11960-044) supplemented with 1% penicillin-streptomycin (Thermo Fisher Scientific, Cat# 15140-122) and 2% HS (Gibco, Cat# 26050088) for 4 days.

Embryoid body (EB) differentiation. Different generations of pgEpiSCs were grown to approximately 85% fusion, digested by Accutase (Gibco, Cat# A11105-01) for 5 min to dissociate into single cells, and inoculated at a density of 1.0 × 10⁵ cells on 3.5 cm low-attachment dishes with differentiation medium (DMEM (Gibco, Cat# 11960-044) supplemented with 10% FBS (Gibco, Cat# 16000-044), 1% penicillin–streptomycin (Thermo Fisher Scientific, Cat# 15140-122), 1% GlutaMAX (Thermo Fisher Scientific, Cat# 35050-061)) for 7 days at 37°C, 5% CO₂, 50 rpm. EBs with excellent spheroid shape were chosen and inoculated on gelatin-pre-incubated plates for 10 days before collecting or fixing the matching cell samples for future tests.

Alkaline Phosphatase (AP) staining. The AP staining assay kit (Millipore, Cat# SCR004) was performed exactly as recommended. The pgEpiSCs and its differentiated cells were fixed with 4% PFA for 5min, which were washed with DPBS (Gibco, Cat# C14190500CP) and incubated with AP staining working solution (A:B:DPBS = 2:1:1) for 15–20 min at 37°C in a 5% CO₂ incubator sheltered from light. DPBS washing was performed for observation.

Karyotype analyses. The proliferating pgEpiSCs were incubated in culture medium supplemented with 15% colcemid solution (Gibco, Cat# 15210-040) for 2.5 h. Cells were harvested and resuspended in 10 ml of 75 mM KCl solution and incubated at 37°C for 30 min with blowing or turning every 5 min. Followed by addition of pre-cooled fixative solution (methanol/glacial acetic acid 3:1), centrifugation at 1500 rpm for 5 min, resuspension of precipitate in pre-cooled fixative solution and incubation on ice for 30 min, repeated once and incubation on ice for 1 h. Cells were dropped onto glass slides, which were dried in an oven at 37°C and stained for visualization using a Rapid Giemsa Staining kit (BBI Life Science, Cat# E6073141).

Alkaline Comet assay. We used an alkaline comet assay experiment to determine the degree of DNA damage at the single-cell level, which known as the single-cell gel electrophoresis. It was performed with reference to the description of the previous studies⁶⁴ and with a slight modification of the method. Accutase (Gibco, Cat# A11105-01) was used to separate different generations of pgEpiSCs into single cells, which were then resuspended in ice-cold DPBS (Gibco, Cat# C14190500CP) with the cell density adjusted to 1.0×10⁶ cells/mL. A suspension of 30 µL cells was mixed thoroughly with 70 µL of 0.7% low-melting agarose, and the cell-agarose suspension was applied fast and evenly dropwise onto comet slides, which were kept at 4°C for 10 minutes followed by subsequent immersion in lysis buffer (2.5 M NaCl, 100 mM Na₂EDTA, 10 mM Tris, 1% N-lauroylsarcosine, 1% Triton X-100, pH 10.0) for 1 h protected from light. The slides were washed with DPBS (Gibco, Cat# C14190500CP) for 3 min each time before being submerged in cold electrophoresis buffer (300 mM NaOH, 1 mM EDTA, pH > 13) for 30 minutes at 4°C, which shielded from light with electrophoresis for 30 minutes (1 V/cm, 300 mA, 4°C). The slides were submerged in neutralization buffer (0.4 M Tris-HCl, pH 7.4) for 5 minutes after electrophoresis before being maintained in cold 100% ethanol for 1 hour. After drying at room temperature away from light, the slides were stained for 30 minutes with nucleic acid dye (GenStar, Cat# ZE111-101S) and photographed for recording. CASP Comet assay software was used to evaluate the samples, which at least 50 cells were counted for each sample. Experiments were performed with 200 µM H₂0₂-treated (Sigma, Cat# 316989) pgEpiSCs as a positive control group.

Immunofluorescent staining. Cells were fixed for 30 min in freshly prepared 4% PFA at room temperature, permeabilized for 20 min in 0.5% Triton X 100, and blocked with 3% BSA (Sigma, Cat# A1470) for 2 h at 4°C. Primary antibodies (Mouse-OCT3/4 (Santa Cruz Biotechnology, Cat# sc-5279), Mouse-SOX2 (Santa Cruz Biotechnology, Cat# sc-365823), Rabbit-NANOG (PeproTech, Cat# 500-P236), Rabbit-tubulin (Abcam, Cat# ab18207), Rabbit-SMA (Abcam, Cat# ab5694), Rabbit-Vimentin (Abcam, Cat# ab92547), Rabbit-Brachyury (Abcam, Cat# ab20680), Mouse-PAX7 (DSHB, Cat# PAX7-S), Rabbit-MYOD (Proteintch, Cat# 18943-1-AP), Mouse-Myosin (Sigma, Cat# M4276), Mouse-MyHc (DSHB, Cat# MF20-S)) were incubated on cells at 4°C overnight, followed by incubation with diluted secondary antibodies for 1 hour. The Actin-Tracker Red (Beyotime, Cat# C2205S) were incubated on cells at 4°C for 2h. Cells were washed three times in DPBS (Gibco, Cat# C14190500CP) for 5 min and stained with DAPI (Roche Life Science, Cat# 10236276001) for 5 minutes, which were photographed under a fluorescence microscope. The information of antibodies is listed in antibodies of Table 1.

Flow cytometric analysis. Cells were digested by TryPLE (Gibco, Cat# 12605010) for 5 min into single cells and centrifuged at 1000 rpm for 5 min, which were washed three times with DPBS (Gibco, Cat# C14190500CP) before being resuspended with diluted antibodies (Alexa Fluor 647 anti-pig CD45 (BIO-RAD, Cat# MCA1222A647), APC-conjugated anti-pig CD31 (BIO-RAD, Cat# MCA1746APC), PE-conjugated anti-human CD56 (BioLegend; Cat# 304606)) and incubated on ice for 30 min. followed by washing three times with cold DPBS (Gibco, Cat# C14190500CP) and resuspending precipitates for flow analysis of CD31⁻ CD45⁻CD56⁺ ratios, where unstained cells were used as negative controls for delineation of FACS gating parameters. The information of antibodies is listed in antibodies of Table 1.

Quantitative RT-PCR. Total RNA was extracted by using RNAprep pure Cell/Bacteria Kit RNAprep pure (TIANGEN, Cat# DP430) and its concentration was measured, which inverted to cDNA using Hifair® III 1st Strand cDNA Synthesis SuperMix (YEASEN, Cat# 11141ES60) for qPCR. RT-qPCR by using 2 × RealStar Green Power Mixture (GenStar, Cat# A311-05). Primer information for RT-qPCR was shown in Table 1. The resulting cycle thresholds (CT) were analyzed using the comparative CT (2-^ΔΔCT) approach and EF-1α was determined as an internal control. All experiments included three biological replicates and primer sequences are shown in Table 1 for primer.

Transcriptome sequencing. Library preparation. The RNA from the quality-checked samples as the starting sample, and the RNA with Poly-A structure in the eukaryotic total RNA was enriched with the TIANSeq mRNA capture kit (TIANGEN, Cat# NR105), and the captured RNA as the initial sample for library construction with the VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina (VAZYME, Cat# NR604-02). Following the construction of the library, Qubit2.0 was used for initial quantification, and the Agilent 2100 Bioanalyzer was utilized to evaluate the insert size of the library. After the insert size was determined to be acceptable, Q-PCR was performed to precisely quantify the effective concentration of the library (effective library concentration > 2nM) to guarantee the library's quality. Furthermore, separate libraries were combined based on effective concentration and target downstream data volume, and PE150 sequencing was done on the Illumina platform to get 150bp double-end sequencing reads.

Raw data quality control, alignment to the genome and analysis of differential expression genes (DEGs). For the paired-end data, trim garole (v-0.6.6) software was used for quality control with the parameters: “-q 25 -j 8 --phred33 --length 74 -e 0.1 --stringency 4 --paired”. Then, high quality reads were mapped to the reference pig genome (Sscrofa 11.1) using HISAT2 (v-2.1.0) with default parameters⁶⁵. Expression levels of all genes were quantified as reads counts using FeatureCounts (v-2.0.1) with the parameters for all exons were calculated. We calculated the TPM in R for all samples and only considered a protein coding gene as detected if its TPM value was more than 0.5 in at least half replicates of all biological replicates. DEGs between different samples were identified using the DESeq2 tool with Wald-test (v-1.30.1).

Principal component analysis. Analyses of all samples PCA’s plot were performed using the R package FactoMineR (v-2.4) and visualization was performed using the R package factoextra (v-1.0.7). The loading score of PC1 were calculate by “prcomp” function.

Correlation matrices and heatmaps. Correlation matrices of all samples were generated using Pearson’s correlation coefficient for all detected genes by “cor” function. R packages pheatmap (v-1.0.12) was used to display correlation matrices and gene expression matrices.

Volcano plots. Volcano plots were plot by R packages Enhanced Volcano (v-1.14.0), cutoff of log₂^FoldChange = 1.5, padj = 0.05.

Ternary plots. Ternary plots were produced with the R package ggtern (v-3.3.5) using the average expression for each chosen samples, marker genes of samples from each period were highlighted. Density areas were computed using 2D kernel density estimation.

Construction of Expression Tendencies. To systematically explore the characteristics of pgEpiSCs during differentiation into muscle cells, we constructed the expression tendencies by median TPM value in the selected samples. We first calculated median TPM value in each sample separately. The median TPM value were rescaled and analyzed by the k-means clustering method with parameters k = 10 and iter.max = 100. The average and standard deviation of median expression levels of the log for each cluster were calculated to evaluate the performance of clustering. We then selected clusters representing the respective characteristics of different cells for further analysis.

Functional Enrichment Analysis. Functional enrichment analysis of selected genes was performed using Metascape⁶⁶ (http://metascape.org). The pig genes were mapped to their human orthologs and human (Homo sapiens) was the target species for analysis. Enrichment analyses were performed using all genes in the genome as the background set with GO-biological processes (GO-BP) pathway as ontology sources. Terms with a minimum count ≥ 3, adjusted p < 0.05 were considered to be significant. Those terms were depicted using lollipop plot by ggplot2.

Untargeted metabolomic determination and analysis. Sample preparation. The harvested cell samples were placed in a liquid nitrogen tank with 400 µL of extraction solution (methanol:acetonitrile:water = 2:2:1, containing isotope-labeled internal standard mixture). They were then sonicated for 10 min in an ice water bath before resting for 1 h at -40°C. After centrifuging the samples at 4°C for 15 min at 12000 rpm, the supernatant was recovered from the injection vial and analyzed on the machine. After that, all samples were mixed into QC samples with comparable amounts of supernatant.

Measurement of metabolites. The target compounds were separated using a Vanquish (Thermo Fisher Scientific) Ultra Performance liquid chromatograph on a Waters ACQUITY UPLC BEH Amide liquid chromatographic column. The aqueous A phase of fluid chromatography included 25 mmol/L ammonium acetate and 25 mmol/L ammonia, and the acetonitrile B phase. The temperature of the sample tray was 4°C, and the injection volume was 2 µL.

Metabolomics data processing and analysis. All LC/MS acquired raw data were converted to mzXML using ProteoWizard. We then perform peak identification, peak extraction, peak alignment, and integration with XCMS. Subsequently, we identified metabolites by matching with compounds in mzCloud database, and then selected compounds with CV (Coefficient of Variance) values less than 30% in QC pool samples as identification results for subsequent analysis. Using Compound Discoverer software, the chromatographic peaks detected in the samples were integrated, in which the peak area of each characteristic peak represented the relative quantitative value of a compound. The quantitative results were normalized using the total peak area, and finally the quantitative results of metabolites were obtained. IP4M and mixOmics⁶⁷ were used for PCA, PLSDA, OPLDSA, enrichment analysis and other data processing.

Intracellular ATP measuring. Intracellular ATP levels were measured using the ATP Assay Kit (Beyotime, S0027) and rigorous manipulation as instructed by the manufacturer. Acctuase (Gibco, A11105-01) was used to dissociate pgEpiSCs into single cells, while TryPLE (Gibco, 12605010) was used to dissociate pgEpiSCs-MCs into single cells. After centrifuging at 1,000 rpm for 5 min and removing the supernatant, 200 μL of lysis buffer was added to resuspend the cells. Cell precipitates were maintained on ice for 20 minutes before being centrifuged at 4°C, 12,000g for 5 min. The supernatant was taken for further analysis. Add 100 μL of ATP assay buffer to each well of a 96-well microtiter plates and stand for 5 minutes, then add 40 μL of sample and mix quickly, then measure the RLU value by Multimode reader (Tecan, spark). The standard curve was used to calculate the concentration of ATP in the samples. Protein concentrations were used to adjust relative ATP levels.

Preparation of 3D edible scaffolds. According to the previous studies⁵⁸, the concentrations and addition ratios in the two tables in Extended Data Fig. 8a. (I) Preparation of Chitosan (CS, Macklin, C804726)- Sodium alginate (SA, Sinopharm Chemical Reagent Co.,Ltd., 9005-38-3)-Collagen (Col, Sigma, C9879) scaffold mix solution, the stock solution was configured according to the concentration in Extended Data Fig. 8a, and the mix solution was obtained by mixing drop by drop in equal proportions according to the order of CS-Col-SA addition; (II) Preparation of CS-SA-Col-Gelatin (Gel Sigma,V900863) scaffold mix solution, on the basis of the preparation of the 2-CS-SA-Col mixed solution, Col was replaced with Gel according to the ratio in Extended Data Fig. 8a, and another mixed solution was obtained by mixing drop by drop according to the order of adding CS-Col-Gel-SA. The two mixed solutions were stirred at room temperature for 24 h and homogenized to obtain the scaffold precursor solution, which was transferred to a 24-well plate (0.3 g/well) and pre-frozen at -20°C and then freeze-dried at -60 °C for 24 h to obtain the scaffolds.

Water absorption capacity. The swelling ratio was used to evaluate the water absorption capacity of the scaffolds. The lyophilized scaffolds were placed in DPBS at room temperature for 6 h, 12 h, 24 h, and observed for changes in weight to signify fluid uptake. Surface moisture was removed from the sample by wiping with filter paper. Using a balance to measure the weight of the scaffold in the expanded scaffold (Wss) and the dry scaffold (Wds). The swelling ratio (%) of the scaffold was calculated using the following formula:

$$Swelling ratio\left(\%\right)=\left[\left(Wss-Wds\right)/Wds\right]\times 100$$

Degradation ratio. The scaffolds were immersed in the medium at 37°C for 1 h, and the excess solution on the surface of the scaffolds was gently removed with filter paper and weighed as W0. After weighing, the scaffolds were placed back and filled with the medium placed under the condition of 37°C and 5% CO₂. Then removed on Days 3, 6, 9, 12 and 15, respectively, weighed as Wt. The degradation ratio (%) was calculated by the following equation:

$$Degradation ratio\left(\%\right)=\left[\left(W0-Wt\right)/W0\right]\times 100$$

Mechanical Property Assay. The compression tests of the scaffolds were measured by a texture analyzer (TA. XT Plus, Stable Micro systems Ltd, UK). Briefly, the scaffolds were compressed to 75% of its initial height at 5 mm·s^− 1 with a cylindrical probe of 36 mm diameter. Compression force was recorded during the entire compression process.

SEM Analysis. The sample preparation for SEM was divided into 2 parts: 1) pretreatment of the lyophilized scaffolds, which were placed in liquid nitrogen to brittle the surface, cross-sections and longitudinal sections to the proper size; 2) pretreatment of the scaffolds inoculated and cultured with pgEpiSCs-MCs, which were fixed with 4% PFA for 1 h, washed with HBSS (Beyotime, Cat # C0219) and then dehydrated using a gradual concentration of ethanol in water (30%, 50%, 70%, 80%, 90%, 100%), followed by supercritical drying. The pretreated samples were sputter-coated with Pt/Pd on SEM stubs and scanned at an acceleration voltage of 5 kV, and images were analyzed by ImageJ software to calculate pore area and pore diameter.

Three-dimensional (3D) scaffolds for cell culturing. The scaffolds were sterilized with ionizing irradiation at 1 kGy prior. C2C12, pMuSCs or pgEpiSCs-MCs were resuspended in media and seeded at a density of 1.0×10⁶ cells/mL into 3D edible scaffolds, which were allowed to adhere for 4 h and supplied with the matching medium. C2C12 were maintained in proliferation medium (MEM supplemented with 10% FBS (Gibco, 16000-044), 1% penicillin–streptomycin (Thermo Fisher Scientific, 15140-122)). pMuSCs were maintained in proliferation medium (DMEM supplemented with 10% FBS, 1% penicillin–streptomycin, 1% MEM Non-Essential Amino Acids Solution (Thermo Fisher Scientific, 1140-050), 1% GlutaMAX (Thermo Fisher Scientific, 35050-061) and 5 ng/mL FGF2 (PeproTech, 100-18B)). The pgEpiSCs-MCs were maintained in Stage V medium for the first 7 days and in differentiation medium containing N2 for the next 7 days. All three-dimensional cell cultures were cultured in a 37°C 5% CO₂ incubator with individual liquid changes.

Assay of cell survival efficiency on 3D edible scaffolds. C2C12, MuSCs or pgEpiSC-MCs were cultivated on scaffolds and cell survival status was measured by using the Calcein / PI Cell Activity and Cytotoxicity Assay Kit (Beyotime, C2015M). Cells were stained with Calcein-AM (AM) and propidium iodide (PI) double fluorescence, observed with a fluorescence microscope (DM6 B, LECIA, Germany), and flow cytometry was used to determine cell survival effectiveness (BD FACSVerse), the scaffold with the highest survival rate was selected as the most proportional scaffold.

Cell proliferation analysis. Tracking the proliferation of differentiated pgEpiSCs on scaffolds using a lab-owned reporter system cell line (NLS-GFP). Briefly, pgEpiSCs-MCs were inoculated into the scaffold at different times in the identical area to track changes in cell numbers.

Confocal microscopy. The scaffolds were washed with HBSS (Beyotime, Cat# C0219) after inoculation of cells and fixed with 4% PFA at room temperature for 1h. The method for 3D-staining was the same as for immunofluorescence staining, with Actin-Tracker Red-594 (Beyotime, Cat# C2205S) for 2h to observe the morphology of the cytoskeleton F-actin. The nuclei were stained with DAPI (Roche Life Science, Cat# 10236276001) for 10 minutes and rinsed with HBSS (Beyotime, Cat # C0219) after staining. Images were taken using a laser scanning confocal microscope.

Texture profile analysis (TPA) of scaffolds inoculated pgEpiSCs-MCs. TPA was measured by a texture analyzer (TA. XT Plus, Stable Micro systems Ltd, UK). Briefly, pgEpiSCs-MCs were seeded on Ca²⁺-KGM₅-SA₅ scaffolds and incubated for 10 d to obtain pgEpiSCs-CM. Blank scaffold without inoculated cells, pgEpiSCs-CM and fresh meat were tested for TPA before and after cooking with a double compression cycle test was performed up to 75% compression of the original portion height a compressive strain rate of 5 mm · s-1 twice.

Staining and frying of pgEpiSCs-derived cultured meat. The pgEpiSCs-derived cultured meat was stained at room temperature with edible pigments (0.0075% monascus colors and 0.05% beet red pigment) for 1 h. Then the stained tissues were fried in a pan with a little oil for 30s.

Statistical analysis. All values in the graphs are reported as mean ± SD. Prism was used to construct diagrams and the student's t-test was used to compare various groups. Date was subjected to one-way ANOVA with Duncan's new multiple range test for analysis of significance, and p < 0.05 being considered statistically significant.

Data availability

The RNA-seq datasets generated in this study are available at NCBI GEO, which had been deposited in the NCBI under accession GSE223433 (reviewer token: qnqpuyiuhvqdzcv). Source data are provided with this paper.

Acknowledgements

This research was supported by the Future Functional Food R&D Program of China Agricultural University (SJ2021002004), the National Key R&D Program of China (2022YFD1302201, 2016YFA0100202), the National Natural Science Foundation of China (31970825, 31772601, 31972099, 32172143), Beijing Natural Science Foundation (6192005), Plan 111 (B12008).

Author contributions

J. Han, and X. Feng conceptualized this project and supervised the overall experiments. G. Zhu performed pgEpiSCs in vitro culture and characteristics analysis of high and low generation. J. Han, G. Zhu and D. Gao coordinated and performed bioinformatics analysis of the RNA-seq and Untargeted metabolomic determination sequencing data. G. Zhu, L. Li and A. Ma completed the preparation, screening, cell inoculation of 3D edible scaffolds and SEM. M, Zhi and J, Zhang performed pgEpiSC derivation. Y. Yao, Y. Wang and X. Zhang performed flow cytometric analysis. G. Zhu, Q. Zhu, J. Gao, S. Cao and T. Chen performed qPCR primer design, quantitative validation and immunofluorescence image processing. G. Zhu, L. Li, T. Wang and X. Chen performed the preparation of the experimental schematic. J. Han, G. Zhu, X. Feng, S. Cao, L. Li, and D. Gao performed manuscript writing, review, and editing.

Competing interests

All authors declare no competing interests.

Xu, X. et al. Global greenhouse gas emissions from animal-based foods are twice those of plant-based foods. Nat. Food 2, 724-732 (2021).
O'Neill, E.N., Cosenza, Z.A., Baar, K. & Block, D.E. Considerations for the development of cost-effective cell culture media for cultivated meat production. Compr. Rev. Food Sci. Food Saf. 20, 686-709 (2021).
Zhang, G.Q. et al. Challenges and possibilities for bio-manufacturing cultured meat. Trends Food Sci. Technol. 97, 443-450 (2020).
Guthman, J., Butler, M., Martin, S.J., Mather, C. & Biltekoff, C. In the name of protein. Nat. Food 3, 391-393 (2022).
Domigan, L.J., Feisst, V. & Ogilvie, O.J. Recipes for cultured meat. Nat. Food 3, 9-10 (2022).
Bhat, Z.F., Morton, J.D., Mason, S.L., Bekhit, A.E.A. & Bhat, H.F. Technological, Regulatory, and Ethical Aspects of In Vitro Meat: A Future Slaughter-Free Harvest. Compr. Rev. Food Sci. Food Saf. 18, 1192-1208 (2019).
Errickson, F., Kuruc, K. & McFadden, J. Animal-based foods have high social and climate costs. Nat. Food 2, 274-281 (2021).
Mazac, R. et al. Incorporation of novel foods in European diets can reduce global warming potential, water use and land use by over 80%. Nat. Food 3, 286-293 (2022).
Hasegawa, T. et al. Extreme climate events increase risk of global food insecurity and adaptation needs. Nat. Food 2, 587-595 (2021).
Resare Sahlin, K. & Trewern, J. A systematic review of the definitions and interpretations in scientific literature of ‘less but better’ meat in high-income settings. Nat. Food 3, 454-460 (2022).
Henchion, M.M. The many meanings of ‘less but better’ meat. Nat. Food 3, 408-408 (2022).
Mehrabi, Z., Gill, M., Wijk, M.v., Herrero, M. & Ramankutty, N. Livestock policy for sustainable development. Nat. Food 1, 160-165 (2020).
Rulli, M.C., D’Odorico, P., Galli, N. & Hayman, D.T.S. Land-use change and the livestock revolution increase the risk of zoonotic coronavirus transmission from rhinolophid bats. Nat. Food 2, 409-416 (2021).
Falkendal, T. et al. Grain export restrictions during COVID-19 risk food insecurity in many low- and middle-income countries. Nat. Food 2, 11-14 (2021).
Tzachor, A., Richards, C.E. & Holt, L. Future foods for risk-resilient diets. Nat. Food 2, 326-329 (2021).
Siegrist, M. & Hartmann, C. Consumer acceptance of novel food technologies. Nat. Food 1, 343-350 (2020).
Heffernan, O. Sustainability: A meaty issue. Nature 544, S18-S20 (2017).
Thorrez, L. & Vandenburgh, H. Challenges in the quest for 'clean meat'. Nat. Biotechnol. 37, 215-216 (2019).
Post, M.J. et al. Scientific, sustainability and regulatory challenges of cultured meat. Nat. Food 1, 403-415 (2020).
Singh, A. et al. Stem cells-derived in vitro meat: from petri dish to dinner plate. Crit. Rev. Food Sci. Nutr. 1-14 (2020).
Choi, K.H. et al. Muscle stem cell isolation and in vitro culture for meat production: A methodological review. Compr. Rev. Food Sci. Food Saf. 20, 429-457 (2021).
Zhang, L. et al. Prospects of artificial meat: Opportunities and challenges around consumer acceptance. Trends Food Sci. Technol. 116, 434-444 (2021).
Levi, S., Yen, F.-C., Baruch, L. & Machluf, M. Scaffolding technologies for the engineering of cultured meat: Towards a safe, sustainable, and scalable production. Trends Food Sci. Technol. 126, 13-25 (2022).
Fish, K.D., Rubio, N.R., Stout, A.J., Yuen, J.S.K. & Kaplan, D.L. Prospects and challenges for cell-cultured fat as a novel food ingredient. Trends Food Sci. Technol. 98, 53-67 (2020).
Guan, X., Zhou, J., Du, G. & Chen, J. Bioprocessing technology of muscle stem cells: implications for cultured meat. Trends Biotechnol 40, 721-734 (2022).
Zhang, J. et al. Research progress and application prospects of stable porcine pluripotent stem cells†. Biol Reprod 107, 226-236 (2022).
Zhi, M. et al. Generation and characterization of stable pig pregastrulation epiblast stem cell lines. Cell Res 32, 383-400 (2022).
Messmer, T. et al. A serum-free media formulation for cultured meat production supports bovine satellite cell differentiation in the absence of serum starvation. Nat. Food 3, 74-85 (2022).
Ding, S. et al. Characterization and isolation of highly purified porcine satellite cells. Cell Death Discov 3, 17003 (2017).
Rahman, M.A., Krainer, A.R. & Abdel-Wahab, O. SnapShot: Splicing Alterations in Cancer. Cell 180, 208-208 e201 (2020).
Yuan, H. et al. CancerSEA: a cancer single-cell state atlas. Nucleic Acids Res. 47, D900-D908 (2019).
Wu, J. et al. A Myogenic Double-Reporter Human Pluripotent Stem Cell Line Allows Prospective Isolation of Skeletal Muscle Progenitors. Cell Rep 25, 1966-1981 e1964 (2018).
Chal, J. et al. Generation of human muscle fibers and satellite-like cells from human pluripotent stem cells in vitro. Nat. Protoc. 11, 1833-1850 (2016).
Xi, H. et al. In Vivo Human Somitogenesis Guides Somite Development from hPSCs. Cell Rep 18, 1573-1585 (2017).
Xi, H. et al. A Human Skeletal Muscle Atlas Identifies the Trajectories of Stem and Progenitor Cells across Development and from Human Pluripotent Stem Cells. Cell Stem Cell 27, 158-176.e110 (2020).
Darabi, R. et al. Human ES- and iPS-derived myogenic progenitors restore DYSTROPHIN and improve contractility upon transplantation in dystrophic mice. Cell Stem Cell 10, 610-619 (2012).
Folmes, C.D., Dzeja, P.P., Nelson, T.J. & Terzic, A. Metabolic plasticity in stem cell homeostasis and differentiation. Cell Stem Cell 11, 596-606 (2012).
Kumar, A. et al. Metabolomic analysis of primary human skeletal muscle cells during myogenic progression. Sci. Rep. 10, 11824 (2020).
Xiang, N. et al. 3D porous scaffolds from wheat glutenin for cultured meat applications. Biomaterials 285, 121543 (2022).
Liu, Y. et al. Engineered meatballs via scalable skeletal muscle cell expansion and modular micro-tissue assembly using porous gelatin micro-carriers. Biomaterials 287, 121615 (2022).
Kang, D.H. et al. Engineered whole cut meat-like tissue by the assembly of cell fibers using tendon-gel integrated bioprinting. Nat. Commun. 12, 5059 (2021).
Ben-Arye, T. et al. Textured soy protein scaffolds enable the generation of three-dimensional bovine skeletal muscle tissue for cell-based meat. Nat. Food 1, 210-220 (2020).
Pasitka, L. et al. Spontaneous immortalization of chicken fibroblasts generates stable, high-yield cell lines for serum-free production of cultured meat. Nat. Food, 4, 35-50 (2023).
Genovese, N.J., Domeier, T.L., Telugu, B.P. & Roberts, R.M. Enhanced Development of Skeletal Myotubes from Porcine Induced Pluripotent Stem Cells. Sci. Rep. 7, 41833 (2017).
Stanton, M.M. et al. Prospects for the Use of Induced Pluripotent Stem Cells in Animal Conservation and Environmental Protection. Stem Cells Transl Med 8, 7-13 (2019).
Kim, J. et al. Expansion and Purification Are Critical for the Therapeutic Application of Pluripotent Stem Cell-Derived Myogenic Progenitors. Stem Cell Reports 9, 12-22 (2017).
Wust, S. et al. Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by miR-1/133a-Mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster. Cell Metab 27, 1026-1039 e1026 (2018).
Norris, S.C.P., Kawecki, N.S., Davis, A.R., Chen, K.K. & Rowat, A.C. Emulsion-templated microparticles with tunable stiffness and topology: Applications as edible microcarriers for cultured meat. Biomaterials 287, 121669 (2022).
Agathocleous, M. & Harris, W.A. Metabolism in physiological cell proliferation and differentiation. Trends Cell Biol 23, 484-492 (2013).
Meacham, C.E., DeVilbiss, A.W. & Morrison, S.J. Metabolic regulation of somatic stem cells in vivo. Nat Rev Mol Cell Biol 23, 428-443 (2022).
Yucel, N. et al. Glucose Metabolism Drives Histone Acetylation Landscape Transitions that Dictate Muscle Stem Cell Function. Cell Rep 27, 3939-3955 e3936 (2019).
Lanovici, I., Zagury, Y., Redenski, I., Lavon, N. & Levenberg, S. 3D-printable plant protein-enriched scaffolds for cultivated meat development. Biomaterials 284, 121487 (2022).
Bomkamp, C. et al. Scaffolding Biomaterials for 3D Cultivated Meat: Prospects and Challenges. Adv Sci (Weinh) 9, e2102908 (2022).
Yue, L. et al. Mthfd2 Modulates Mitochondrial Function and DNA Repair to Maintain the Pluripotency of Mouse Stem Cells. Stem Cell Reports 15, 529-545 (2020).
Pertea, M., Kim, D., Pertea, G.M., Leek, J.T. & Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 11, 1650-1667 (2016).
Zhou, Y. et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 10, 1523 (2019).
Rohart, F., Gautier, B., Singh, A. & Le Cao, K.A. mixOmics: An R package for 'omics feature selection and multiple data integration. PLoS Comput Biol 13, e1005752 (2017).
Li, L. et al. Chitosansodium alginate-collagen/gelatin three-dimensional edible scaffolds for building a structured model for cell cultured meat. Int J Biol Macromol209, 668-679 (2022).

Table 1

REAGENT or RESOURCE	SOURCE		IDENTIFIER	DILUTION RATIO
Antibodies
Mouse monoclinal anti-Oct-3/4	Santa Cruz Biotechnology		Cat# sc-5279	1:500
Mouse monoclinal anti-Sox2	Santa Cruz Biotechnology		Cat# sc-365823	1:300
Rabbit polyclonal anti-human Nanog	PeproTech		Cat# 500-P236	1:300
Rabbit polyclonal anti-neuron specific beta III Tubulin	Abcam		Cat# ab18207	1:250
Rabbit polyclonal anti-alpha smooth muscle Actin	Abcam		Cat# ab5694	1:250
Rabbit monoclinal anti-Vimentin	Abcam		Cat# ab92547	1:250
Goat polyclonal anti-Brachyury	Santa Cruz Biotechnology		Cat# sc17743	1:50
Mouse monoclinal anti-PAX7	DSHB		Cat# PAX7-S	1:100
Rabbit polyclonal anti-MYOD1	Proteintech		Cat# 18943-1-AP	1:200
Mouse monoclinal anti-Skeletal Myosin (Fast)	Sigma-Aldrich		Cat# M4276	1:300
Mouse monoclinal anti-Myosin heavy chain (MyHc)	DSHB		Cat# MF20-S	1:200
Mouse monoclinal anti-MYH3	Santa Cruz Biotechnology		Cat# sc-376157	1:1000
Rabbit monoclonal anti-GAPDH (D16H11)	Cell Signaling Technology		Cat# 5174	1:5000
Actin-Tracker Red-594	Beyotime		Cat# C2205S	1:100
DAPI	Roche Life Science		Cat# 10236276001	1:10000
Donkey anti-Rabbit IgG (H + L) highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594	Thermo Fisher Scientific		Cat# A-21207	1:1000
Donkey anti-Mouse IgG (H + L) highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594	Thermo Fisher Scientific		Cat# A-21203	1:1000
Donkey anti-Mouse IgG (H + L) highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	Thermo Fisher Scientific		Cat# A-21202	1:1000
Horseradish peroxidase (HRP)-conjugated anti-rabbit IgG	Beyotime		Cat# P1050	1:10000
Horseradish peroxidase (HRP)-conjugated anti-mouse IgG	Cell Signaling Technology		Cat# 7076	1:10000
Horseradish peroxidase (HRP)-conjugated anti-goat IgG	Beyotime		Cat# A0181	1:10000
APC-conjugated anti-pig CD31	BIO-RAD		Cat# MCA1746APC	1:30
Alexa Fluor 647 anti-pig CD45	BIO-RAD		Cat# MCA1222A647	1:30
PEconjugated anti-human CD56	BioLegend		Cat# 304606	1:50
StarGreen safe Nucleic Acid Dye 10000×	GenStar		Cat# ZE111-101S	1:10000
Chemicals, Peptides and Recombinant Protein
CHIR99021	Selleckchem		Cat# S1263
IWR-1-endo	Selleckchem		Cat# S7086
Y-27632	Selleckchem		Cat# S1049
WH-4-023	Selleckchem		Cat# S7565
Recombinant Human LIF	PeproTech		Cat# 300-05
Human/Murine/Rat Activin A	PeproTech		Cat# 120-14E
Recombinant Human FGF-2	PeproTech		Cat# 100-18B
Recombinant Human IGF-1	PeproTech		Cat# 100 − 11
Recombinant Human HGF	PeproTech		Cat# 100-39H
SB431542	Selleckchem		Cat# S1067
LDN193189	Stemgent		Cat# 04–0074
Bovine Serum Albumin	Sigma-Aldrich		Cat# A1470
Ascorbic Acid (Vc)	Sigma-Aldrich		Cat# A4544
KnockOut Serum Replacement	Thermo Fisher Scientific		Cat# A3181502
NeurobasalTM Medium	Thermo Fisher Scientific		Cat# 21103-049
DMEM/F12, GlutaMAXTM supplement	Thermo Fisher Scientific		Cat# 10565-018
N-2 Supplement (100 ×)	Thermo Fisher Scientific		Cat# 17502-048
B-27 TM Supplement (50 ×), minus vitamin A	Thermo Fisher Scientific		Cat# 12587-010
Insulin–transferrin–selenium (ITS)	Thermo Fisher Scientific		Cat# 41400-045
GlutaMAXTM Supplement	Thermo Fisher Scientific		Cat# 35050-061
MEM Non-Essential Amino Acids Solution (100 ×)	Thermo Fisher Scientific		Cat# 1140-050
2-Mercaptoethanol	Thermo Fisher Scientific		Cat# 21985-023
Penicillin-Streptomycin (10,000 U/mL)	Thermo Fisher Scientific		Cat# 15140-122
Gelatin (0.1% in water)	Stem Cell Technologies		Cat# 07903
Trypsin-EDTA (0.05%), phenol red	Gibco		Cat# 25300120
DMEM, high glucose, no glutamine	Gibco		Cat# 11960-044
Fetal bovine serum (FBS)	Gibco		Cat# 16000-044
Horse serum	Gibco		Cat# 26050088
Accutase cell dissociation reagent	Gibco		Cat# A11105-01
TrypLETM Express	Gibco		Cat# 12605010
Dispase II	Coolaber		Cat# CD4691
Collagenase II	Coolaber		Cat# CC3791G
Calcium chloride	Sigma-Aldrich		Cat# C5670
RIPA	Cell Signaling Technology		Cat# 9806
Protease inhibitor cocktail	Beyotime		Cat# P1050
SuperSignalTM West Dura Extended Duration Substrate	Thermo Fisher Scientific		Cat# 34075
H202	Sigma-Aldrich		Cat# 316989
Colcemid Solution	Gibco		Cat# 15210-040
Dulbecco's phosphate-buffered saline (DPBS)	Gibco		Cat# C14190500CP
Hanks' Balanced Salt Solution (with Ca2+ & Mg2+)	Beyotime		Cat# C0219
Sodium alginate	Sinopharm Chemical Reagent Co.,Ltd.		Cat# 9005-38-3
Konjack glueomnnan	Hubei konson Konjac Technology Co.		Cat# KJ30
Primer
OCT4: F: CAAACTGAGGTGCCTGCCCTTC R: ATTGAACTTCACCTTCCCTCCA	This paper		N/A
SOX2: F: CATCAACGGTACACTGCCTCTC R: ACTCTCCTCCCATTTCCCTCTT	This paper		N/A
NANOG: F: CATCTGCTGAGACCCTCGAC R: GGGCTTGTGGAAGAATCAGG	This paper		N/A
T: F: GCCAGATCATGCTGAACTCCTTA R: ATAAGCCGTCACCGCTATGAAC	This paper		N/A
MSGN1: F: AACTACCTGCCACCGGTCTA R: TCCGCTGTTGAGAAGGTCTG	This paper		N/A
PDGFRα: F: GACAGTGCTGGAAGTGGTCA R: TCCGGGTCTGGCACATAGAT	This paper		N/A
PAX6: F: TGTCCAACGGATGTGTGAGT R: TCTGTCTCGGATTTCCCAA	This paper		N/A
EOMES: F: ACTCCCATGGACCTCCAGAA R: TCGCTTACAAGCACTGGTGT	This paper		N/A
BMP4: F: TTCATTTTAGGAGCCATTCTGTAGT R: TCCTAGCAGGACTTGGCATAAT	This paper		N/A
PAX7: F: GTGCCCTCAGTGAGTTCGATTA R: TTCCCTTTGTCGCCCAAGAT	This paper		N/A
MYOD: F: CGCTTGAGCAAAGTCAACGA R: GCTATAATCCATCATGCCGTCG	This paper		N/A
MYF5: F: ACGGCATGCCTGAATGCAAC R: TGCTGATCCGATCCACTATGC	This paper		N/A
MYOG: F: CCAGGGGATCATCTGCTCACA R: TGGGCATGGTTTCATCTGGG	This paper		N/A
MYMK: F: CTTCCTCCCCACGGTCAG R: TACTCCAGGATGTCAAGGCG	This paper		N/A
MYH1: F: TCTTTGACTGGGCTGCCATC R: TTCACTGTCAAAGTCGCCCC	This paper		N/A
MYH2: F: GGGCTCAAACTGGTGAAGC R: AGATGCGGATGCCCTCCA	This paper		N/A
MYH3: F: GCCGACGCTGACAGCGGAAA R: AGATGCGGATGCCCTCCA	This paper		N/A
MEF2A: F: CACGGGGTGACTTCCATTCT R: CAGGGTGCTCTGTTTGCCAT	This paper		N/A
MEF2C: F: GACAACAAAGCCCTCAGCAG R: CTGCATTCGTTCCTGCACAT	This paper		N/A
ACTN2: F: CAGCAAAGGCGTGAAACTGG R: TGGCAGAGGTTTCTTCGACT	This paper		N/A
MYL3: F: GCCCAAGAAGGATGATGCCA R: TCACACTTGGGTGTACGGTC	This paper		N/A
MYL4: F: CACATCTCCCGCAACAAGGA R: TCTTCCTGCTCCACCCTG	This paper		N/A
MYH8: F: TCTGGCATCCAGAGGCAGAAT R: GTTAGCGTTGCTCCACGTTC	This paper		N/A
MYH11: F: GAGCGCCACATCTCAACTCT R: CTCCTCGGCCAACAACTGAT	This paper		N/A
COL11A1: F: ACTGTCATCAGTCAGCAGCC R: TAGCCTTTTCTGGACGCACA	This paper		N/A
FBN1: F: ATGAATGTCTGGAGCCACCC R: TCCAGAGCGGGTATCAACAC	This paper		N/A
COL6A3: F: AGCATCGGACCAAAGGGAAT R: TGGAAACCTTGAGTGCCGTT	This paper		N/A
COL5A2: F: AAACTGGGCAGAAGCAAGAC R: ATTTCTTCACCATATCCTTCATCCT	This paper		N/A
COL3A1: F: CTAGCCGAGCTTCCCAGAAC R: TCCCCAGTGTGTTTAGTGCAA	This paper		N/A
LAMA4: F: TCCTGCTACCCAGAAATGCG R: CTCTCCTGTTGTGTTCCGCT	This paper		N/A
ELN: F: GAGCCTTTGGAGGTGTGTCC R: CGCCACCTGGGAAAATAGGA	This paper		N/A
PKM: F: CCAGAAACCAAGCAGCAACA R: AAGTCACTCGCTGTCCTTCA	This paper		N/A
PGK1: F: GAATGGACCTGTGGGCGTAT R: CAGTGTCTCCACCACCTATGA	This paper		N/A
PGAM1: F: GCAACATCAGTAAGGATCGCA R: GCTCCATGATCGCCTCTTCA	This paper		N/A
LDHA: F: AAGTGCACTCCCGATTCCTTT R: AGGAAAAGGCTGCCATGTTG	This paper		N/A
PDK4: F: ACCAGGAAAACTGGCCTTCT R: CCGTAACCAAAACCAGCCAAAG	This paper		N/A
PDP1: F: CCCAGACGAATTGGAACCCC R: GGATGGGGCGTGTATCTCAG	This paper		N/A
PDHA1: F: TTAGGTCTTAGCGTCCTCCC R: GCCGGTGAAGATCACATTTCTTA	This paper		N/A
HK1: F: AGCTTCATCCACACTTCTCCA R: GCACAGCTCGCTAGACAGAA	This paper		N/A
HK2: F: CTCCGGATGGGACAGAACAC R: TGAAGTTAGCCAGGCACTCG	This paper		N/A
SLC2A11: F: AATGCCCCAACCTTGCACAT R: TTCCTTCCCAGCTTGATGGC	This paper		N/A
SLC2A12: F: AGTCTGCTGAAACCGAAGGG R: GTAAACATGCCGCAACCTCTC	This paper		N/A
SLC2A13: F: GCTCGGCATCGGTATTGCT R: CCTCCCGTGATGAAGAGGGT	This paper		N/A
PGM1: F: CGGAATTTCTTCACCAGGTACG R: AATGCTTCCGTCCACAGGAT	This paper		N/A
GPI: F: TTCGAGTTCTGGGATTGGGTG R: TTCTTCTCCAGGGGTGTCGT	This paper		N/A
EF-1α: F: AATGCGGTGGGATCGACAAA R: CACGCTCACGTTCAGCCTTT	This paper		N/A
Critical Commercial Assays
RNApre pure Cell / Bacteria Kit	TIANGEN		Cat# DP430
Hifair® III 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus)	YEASEN		Cat# 11141ES60
2 × RealStar Green Power Mixture	GenStar		Cat# A311-05
Alkaline Phosphatase Detection Kit	Millipore		Cat# SCR004
Rapid Giemsa Staining kit	BBI Life Science		Cat# E6073141
Calcein / PI Cell Activity and Cytotoxicity Assay Kit	Beyotime		Cat# C201M
Modified BCA Protein Assay Kit	Sangon Biotech		Cat# C503051
ATP Assay Kit	Beyotime		Cat# S0027
Glucose Assay Kit	Beyotime		Cat# S0201M
Lactic Acid assay kit	Nanjing Jiancheng institute of Biotechnology		Cat# A019-2-1
TIANSeq mRNA capture kit	TIANGEN		Cat# NR105
VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina	VAZYME		Cat# NR604-02
Configuration of culture medium
(1) pgEpiSCs culture medium
Basic culture medium:227.5 mL DMEM/F12, 227.5 mL neurobasal, 2.5 mL N2 supplement, 5 mL B27 supplement, 0.5% GlutaMAX, 1% nonessential amino acids, 0.1 mM β-mercaptoethanol, 1% penicillin–streptomycin, 5% knockout serum replacement, and 50 µg/mL ascorbic acid. 3i/LAF medium: small molecules and cytokines were added to BM to the following final concentrations, 1 µM CHIR99021, 2.5 µM IWR-1-endo, 1 µM WH-4-023, 10 ng/mL recombinant human LIF, 25 ng/mL recombinant human activin A, 10 ng/mL recombinant human FGF2.
(2) pMuSCs culture and differentiation medium
Culture medium: DMEM/F12 supplemented with 1% penicillin-streptomycin, 1% MEM Non-Essential Amino Acids Solution, 10% FBS, and 5 ng/mL FGF2. Differentiation medium: DMEM supplemented with 1% penicillin-streptomycin and 2% Horse serum.
(3) Embryoid body differentiation medium
DMEM supplemented with 10% FBS, 1% penicillin–streptomycin, 1% GlutaMAX.
(4) Adherent medium
ITS group (appropriate adjustments): DMEM/F12 supplemented with 1% ITS, 0.1 mM β-mercaptoethanol ,1% nonessential amino acids, 1% penicillin–streptomycin and 200 µM ascorbic acid. YH BM group (appropriate adjustments): DMEM/F12 and neurobasal (1:1) supplemented with 0.5% N2 supplement, 1% B27 supplement, 1% nonessential amino acids, 0.1 mM β-mercaptoethanol, 1% penicillin–streptomycin, 15% knockout serum replacement, and 200 µM ascorbic acid. YHBM-Neur: DMEM/F12 supplemented with 0.5% N2, 1% B27, 1% nonessential amino acids, 0.1 mM β-mercaptoethanol, 1% penicillin–streptomycin, 15% knockout serum replacement, and 200 µM ascorbic acid. F12 + N2 group: DMEM/F12 supplemented with 0.5% N2, 1% nonessential amino acids, 0.1 mM β-mercaptoethanol, 1% penicillin–streptomycin, 15% knockout serum replacement, and 200 µM ascorbic acid. F12 + B27 group: DMEM/F12 supplemented with 1% B27, 1% nonessential amino acids, 0.1 mM β-mercaptoethanol, 1% penicillin–streptomycin, 15% knockout serum replacement, and 200 µM ascorbic acid.
(5) Myogenic differentiation medium (MDM)
MDM basic medium (MDM BM): DMEM/F12 supplemented with 1% nonessential amino acids, 0.1 mM β-mercaptoethanol, 1% penicillin–streptomycin, 15% knockout serum replacement, 200 µM ascorbic acid. MDM I (Optimization of MDM I): a) MDM BM supplemented with 1% B27, 3 µM CHIR99021 and 0.5 µM LDN193189; b) MDM BM supplemented with 1% B27, 3 µM CHIR99021 and 2 µM SB431542; c) MDM BM supplemented with 1% B27, 3 µM CHIR99021, 0.5 µM LDN193189 and 2 µM SB431542. MDM II: MDM BM supplemented with 3 µM CHIR99021, 0.5 µM LDN193189, and 20 ng/ml FGF2. MDM III: MDM BM supplemented with 10 ng/ml HGF, 10 ng/ml IGF-1, 20 ng/ml FGF2 and 0.5 µM LDN193189. MDM IV: MDM BM supplemented with 10 ng/ml IGF-1. MDM V: MDM BM supplemented with 10 ng/ml HGF and 10 ng/ml IGF-1. N2 medium: DMEM/F12 supplemented with 15% KOSR, 1% N2, 1% penicillin–streptomycin, and 1% nonessential amino acids. HS medium: DMEM/F12 supplemented with 15% KOSR, 2% HS, 1% penicillin–streptomycin, and 1% nonessential amino acids.
Deposited Data
pgEpiSCs Low and High passages RNA-seq data		This articile
pgEpiSCs, pgEpiSCs-MPCs and pgEpiSCs-MCs RNA-seq data		This articile
Muscle progenitor cells (MPCs) differentiation RNA-seq data		This articile
PEFs		¹
Software and Algorithms
Trim garole		²
HISAT2		³
FeatureCounts		⁴
DEseq2 tool		⁵
R package FactoMineR		⁶
R package factoextra		⁷
R packages pheatmap		⁸
R packages EnhancedVolcano		⁹
R package ggtern		¹⁰
Metascape		¹¹
ggplot2		¹²
ProteoWizard		¹³
XCMS		¹⁴
IP4M		¹⁵
mixOmics		¹⁶

References

1. Xu, J. et al. Generation of pig induced pluripotent stem cells using an extended pluripotent stem cell culture system. Stem Cell Res Ther 10, 193 (2019).

2. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17, 10-12 (2011).

3. Pertea, M., Kim, D., Pertea, G.M., Leek, J.T. & Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc 11, 1650-1667 (2016).

4. Liao, Y., Smyth, G.K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930 (2014).

5. Love, M.I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014).

6. Lê, S., Josse, J. & Husson, F. FactoMineR: An R Package for Multivariate Analysis. J Stat Softw 25, 1-18 (2008).

7. Kassambara, A., and Mundt, F. Package ‘factoextra’. Extract and visualize the results of multi-variate data analyses.76 (2017).

8. Kolde, R. pheatmap: Pretty Heatmaps. R package version 1.0. 12. CRAN R-project org/package=pheatmap. (2019).

9. Blighe, K., Rana, S., and Lewis, M.. EnhancedVolcano: Publication-ready volcano plots with

enhanced colouring and labeling. R package version1 (2019).

10. Hamilton, N.E. & Ferry, M.J.J.o.s.s. ggtern : Ternary Diagrams Using ggplot2. J Stat Softw 87, 1--17 (2018).

11. Zhou, Y. et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun 10, 1523 (2019).

12. Hadley, W. Data analysis. In ggplot2 (Springer), pp. 189-201 (2016).

13. Darren, K., Matt, C., Robert, B., David, A. & Parag, M.J.B.-O.-. ProteoWizard: open source software for rapid proteomics tools development. Bioinformatics 24, 2534-2536 (2008).

14. Want, E.J, et al. XCMS: Processing Mass Spectrometry Data for Metabolite Profiling Using Nonlinear Peak Alignment, Matching, and Identification. Anal Chem 78, 779-787 (2006).

15. Liang, D. et al. IP4M: an integrated platform for mass spectrometry-based metabolomics data mining. BMC Bioinformatics 21, 444 (2020).

16. Rohart, F., Gautier, B., Singh, A. & Cao, K.J.P.C.B. mixOmics: An R package for 'omics feature selection and multiple data integration. PLoS Comput Biol 13, e1005752 (2017).

There is NO Competing Interest.

FigureandFigurecaption.pdf

Download PDF

Journal Publication

published 09 Dec, 2023

Read the published version in Nature Communications →

Version 1

posted

You are reading this latest preprint version

Generation of three-dimensional skeletal muscle tissue as cultured meat from stable pig epiblast stem cells

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

pgEpiSCs are ideal initiating cells for the development of CM

A serum-free approach for myogenic differentiation from pgEpiSCs

Significant changes in the metabolites of skeletal muscle cells generated from pgEpiSCs

Discussion

Methods

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1