This is a preprint, a preliminary version of a manuscript that has not completed peer review at a journal. Research Square does not conduct peer review prior to posting preprints. The posting of a preprint on this server should not be interpreted as an endorsement of its validity or suitability for dissemination as established information or for guiding clinical practice.
Research Article
Rong Zhang
Sun Yat-Sen University Cancer Prevention and Treatment Center: Sun Yat-sen University Cancer Center
Corresponding Author
ORCiD: https://orcid.org/0000-0002-0003-2200
License:
This work is licensed under a CC BY 4.0 License. Read Full License
Chemotherapy is one of the effective ways to treat esophageal squamous cell carcinoma (ESCC), but the development of chemoresistance during chemotherapy lowers drug efficacy. Although previous studies have shown that the ribosomal protein S15A (RPS15A) involved in the progression and overall survival of malignancies, its function in chemoresistance is unknown. This study sought to elucidate the function of RPS15A in chemoresistance in ESCC. Our results show that knocking down or overexpressing RPS15A in ESCC cell lines can significantly change the sensitivity of chemotherapeutic drugs and affect cisplatin-induced apoptosis. Moreover, an increase in chemotherapeutic drug concentration leads to increased expression of RPS15A and CD44 proteins. When we utilized the ESCC cisplatin-resistant cell line to corroborate our findings, we found that the levels of RPS15A and CD44 proteins were substantially greater in daughter than parental cells. Subsequent experiments indicated that RPS15A modulated chemoresistance by controlling the expression of CD44 and the cell stemness in ESCC. Hence, our data suggest that RPS15A participates in the chemoresistance in ESCC by controlling the expression of CD44 and regulating cell stemness. Taken together, our study provides plausible mechanisms for RPS15A-mediated chemoresistance in ESCC cells and suggests that the inhibition of the RPS15A/CD44 pathway may be a potential target for improving chemotherapy efficacy.
Keywords
RPS15A, esophageal cancer, chemoresistance, CD44, stemness
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
This is a list of supplementary files associated with this preprint. Click to download.
- FigS101.tif
Fig.S1. The expression of RPS15A in ESCC and detection of transfection efficiency A, RT-qPCR analysis of the relative expression of RPS15A mRNA in Eca109, Kyse510, Kyse450, and Kyse140 cell lines. B, WB analysis of RPS15A protein expression in Eca109, Kyse510, Kyse450, and Kyse140 cell lines. C, Differential expression of RPS15A in ESCC and adjacent normal tissues (GSE53625 dataset). The expression of RPS15A in ESCC and surrounding tissues was analyzed by RPS15A probe; the probe sequence is TATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTT CTCACTGTGATGATGAAGCATGGTTA in this study. Paired t-test was used for statistical analysis; P=0.0022. D, Transfection efficiency detected by flow cytometry. E, Verification of RPS15A expression efficiency after lentivirus transfection (MOI=20) in TE-1 cells by RT-qPCR and WB. ***P <0.01 vs control. ***P < 0. 001.
- FigS201.tif
Fig.S2. The sensitivity of ESCC cells to chemotherapeutics after lentivirus-induced RPS15A knockdown and overexpression A and B, The effects of RPS15A on the sensitivity of Kyse510-shRPS15A cells to CDDP (A) and 5-Fu (B) examined by CCK-8 assay. C, The clone formation ability of Kyse510 cells treated with 0.04μg/ml CDDP after RPS15A knockdown or overexpression; cisplatin-free medium was used as a control. D, The influence of RPS15A knockdown on the apoptosis-related proteins detected by WB in Kyse510-shRPS15A cells treated with 0.4μg/ml CDDP; β-Actin was used as a loading control.
- FigS301.tif
Fig.S3 Annexin-V / PI Double staining to assess cell apoptosis A and B, Apoptosis assessed using flow cytometry with Annexin V-Alexa Fluor 488/PI staining in Eca109-shRPS15A cells treated with 0.4μg/mL CDDP for 48 hours (A) and calculation of the apoptosis rate by Q2+Q3 (B). C and D, Apoptosis assessed using flow cytometry with Annexin V-Alexa Fluor 488/PI staining in Eca109-oeRPS15A cells treated with 1.2μg/mL CDDP for 48 hours and (C) the apoptosis rate calculated by Q2+Q3 (D). **P < 0. 01, ***P < 0. 001.
- FigS401.tif
Fig.S4 The sensitivity of Eca109/CDDP and Eca109 to CDDP A and B, The clone formation ability of Eca109 cells and Eca109/CDDP cells (A) and the histogram of clone formation numbers (B). C and D, The 50% inhibitory concentration (IC50) value calculated by CCK-8 assay in Eca109 (C) and Eca109/CDDP cells (D). **P < 0. 01.
- FigS501.tif
Fig.S5 RPS15A regulates the spherogenesis ability of TE-1 cells A, Comparison of cell morphology between TE-1 parental cells (left) and tumorspheres (right). B, WB analysis of RPS15A, Nanog, OCT-4, Sox2, CD44, and CD133 proteins in TE-1 parental cells and tumorspheres. C, Relative expressions of RPS15A, Nanog, OCT-4, Sox2, CD44, and CD133 in TE-1 parental cells and tumorspheres. D and E, Representative images of tumorsphere formation capacity of primary (top panel) and secondary (lower panel) and a histogram showing the number of sphere-formed (E). GAPDH was used as a reference in RT-qPCR and β-Actin used as a loading control in WB analysis. **P < 0. 01, ***P < 0. 001.
- FigS601.tif
Fig.S6. RPS15A regulates the expression of stem cell markers and critical signaling molecules that maintain TE-1 cell stemness A-C, The relative levels of Nanog (A), OCT-4 (B), Sox2 (C) mRNA in TE-1 cells after RPS15A knockdown or overexpression, analyzed by RT-qPCR. D and E, WB analysis of the levels of expression levels of Nanog, OCT-4, and Sox2 (D) and Erk1/2, mTOR, p38, and AKT (E) protein in TE-1 cells with RPS15A silenced or overexpressed RPS15A. GAPDH was used as a reference in RT-qPCR and as a loading control in WB analysis. *P < 0. 05, **P < 0. 01, ***P < 0. 001.
Loading...
Badges
Prescreen
This manuscript passed our Prescreen assessment
Complete author information
Appropriate declaration statements
Potential risks to human health
Prescreen
History
CURRENT STATUS: Posted
Version 1
Posted 03 Mar, 2021
No community comments so far
Metrics
Comments: 0
PDF Downloads: ...
HTML Views: ...
Subject Areas
Oncology
Learn more about our company.
This is a preprint. It has not completed peer review.
Research Article
Rong Zhang
Sun Yat-Sen University Cancer Prevention and Treatment Center: Sun Yat-sen University Cancer Center
Corresponding Author
ORCiD: https://orcid.org/0000-0002-0003-2200
Badges
Prescreen
This manuscript passed our Prescreen assessment
Complete author information
Appropriate declaration statements
Potential risks to human health
Prescreen
History
CURRENT STATUS: Posted
Version 1
Posted 03 Mar, 2021
No community comments so far
Metrics
Comments: 0
PDF Downloads: ...
HTML Views: ...
Subject Areas
Oncology
License:
This work is licensed under a CC BY 4.0 License. Read Full License
Chemotherapy is one of the effective ways to treat esophageal squamous cell carcinoma (ESCC), but the development of chemoresistance during chemotherapy lowers drug efficacy. Although previous studies have shown that the ribosomal protein S15A (RPS15A) involved in the progression and overall survival of malignancies, its function in chemoresistance is unknown. This study sought to elucidate the function of RPS15A in chemoresistance in ESCC. Our results show that knocking down or overexpressing RPS15A in ESCC cell lines can significantly change the sensitivity of chemotherapeutic drugs and affect cisplatin-induced apoptosis. Moreover, an increase in chemotherapeutic drug concentration leads to increased expression of RPS15A and CD44 proteins. When we utilized the ESCC cisplatin-resistant cell line to corroborate our findings, we found that the levels of RPS15A and CD44 proteins were substantially greater in daughter than parental cells. Subsequent experiments indicated that RPS15A modulated chemoresistance by controlling the expression of CD44 and the cell stemness in ESCC. Hence, our data suggest that RPS15A participates in the chemoresistance in ESCC by controlling the expression of CD44 and regulating cell stemness. Taken together, our study provides plausible mechanisms for RPS15A-mediated chemoresistance in ESCC cells and suggests that the inhibition of the RPS15A/CD44 pathway may be a potential target for improving chemotherapy efficacy.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Loading...