Given the retrospective nature of the study, ethical approval was granted by the local ethics committee of the Shanghai XinChao Biotechnology Co (Shanghai, China). The study was conducted in accordance with the principles of the Declaration of Helsinki.
Patient and tissue samples
For this study, 59 cases of individual patient samples were included. The age range of the patients was 44 to 85 years of age with a mean age of 68 years. Patients did not receive preoperative chemotherapy or radiotherapy before surgery. The clinico-pathologic parameters included the patient’s age, gender, tumor size, pathological grade, depth of tumor invasion (T), lymph node status (N), and clinical staging (The eighth edition of the American Cancer Federation staging system was used for TNM staging). Clinico-pathological parameters are shown in Table 1.
Table 1
Correlation between SIRT4 levels with the clinicopathologic variables in bladder urothelial carcinoma
Clinicopathologic parameters | SIRT4 levels | | χ2 | P-valuea |
| All cases | Low | High | | | |
Age (years) | | | | | 0.01 | 0.92 |
≤ 60 | 14 | 6 | 8 | | | |
> 60 | 45 | 20 | 25 | | | |
Gender | | | | | | 0.14 |
Male | 50 | 20 | 30 | | | |
Female | 9 | 1 | 8 | | | |
Tumor size (cm) | | | | | 6.0 | 0.02 |
≤ 5 | 37 | 10 | 27 | | | |
> 5 | 22 | 13 | 9 | | | |
Differentiation | | | | | 0.21 | 0.65 |
I-II | 20 | 6 | 14 | | | |
III-IV | 39 | 14 | 25 | | | |
Stage (T) | | | | | 5.4 | 0.02 |
T1-T2 | 33 | 6 | 27 | | | |
T3-T4 | 26 | 12 | 14 | | | |
Stage (N) | | | | | 0.01 | 0.92 |
N0 | 37 | 13 | 24 | | | |
N1-N2 | 22 | 8 | 14 | | | |
AJCC stage | | | | | 5.5 | 0.02 |
I-II | 34 | 10 | 24 | | | |
III-IV | 25 | 15 | 10 | | | |
Bold values are statistically significant (P < 0.05). |
aChi-square test. |
Tissue gene array chips were obtained commercially (Superchip Inc., Shanghai, China) and included 59 cases of BLAC samples and corresponding adjacent non-neoplastic tissues specimens. Thus, one tissue microarray included 118 points. The tissue diameter of the tissue on the tissue microarray was 1.5 mm, and all samples were coated with paraffin wax.
Immunohistochemistry
Tissue microarray was prepared by baking the array in a hot incubator for 2 hrs after which it was incubated twice in xylene for 5 min at 37°C to deparaffinize the specimen. To rehydrate the specimen, the tissue microarray was transferred every 5 min to sequentially graded ethanol concentrations at 100%, 100%, 95%, 85%, and 70%. Antigen retrieval was performed in a pressure cooker in citrate buffer (10 mM citrate and 0.05% Tween 20, pH 6.0). To suppress endogenous peroxidase activity, the tissue microarray was incubated in 0.3% H2O2 in Tris-HCl buffer for 15 min at 37°C. Subsequently, the tissue microarray was incubated overnight with a polyclonal rabbit anti-SIRT4 antibody (HPA029692, 1:400, Sigma, USA) at 4°C. A secondary antibody was applied using the GTVision Kit (Gene Tech Inc., Shanghai, China). Next, the microarray chip section was stained with a diaminobenzidine (DAB) solution and counterstained with hematoxylin. The chip was then dehydrated and sealed with a coverslip. As a negative control, tissue was treated with antibody dilution solution alone.
After the tissue microarray staining is completed the chip was imaged by scanning through a scanner (3D HISTECH, Budapest, Hungary), a file is created which contains all the tissue information on that tissue section. The file can be magnified 1-400 times in the Pannoramic software (3D HISTECH, Budapest, Hungary), and two pathologists who were unaware of the patient's information used the software on their computers to score the degree of staining. Each tissue point was assigned a score that was based on the staining intensity multiplied by the area of the staining[8]. The staining intensity was divided into four categories and included the following criteria: 0 = no staining; 1 = weak staining; 2 = moderate staining; and 3 = strong staining. Staining area assessment was as follows: 0 = 5% or none of the cells were stained; 1 = 5%-25% of the cells were positively stained; 2 = 26%-50% of the cells were positively stained; 3 = 51–75% of the cells were positively stained; and 4 = more than 75% of the cells showed a positive staining. The final degree of staining was divided into two categories: 0–6 = low expression; and 7–12 = high expression. When the evaluation of the staining patterns did not match, a consensus opinion was performed by both pathologists.
Cell lines and culture conditions
Human BLCA cell line T24 were purchased from Shanghai Institute of cell biology, Chinese Academy of sciences, in October 2021. The cell bank used four primer pairs, DXS52, MD17S5, Apo-B and D2S44 to monitor changes in the cell lines during passage. The cells were last tested in October 2020 and the experiment ended five months after the cells were purchased. The cells were maintained in Dulbecco’s modified Eagle’s media (DMEM; Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and penicillin/streptomycin (Gibco, USA). The conditions for the CO2 incubator were 37°C, 5%CO2.
Vector and virus production
We designed three siRNA sequences against SIRT4, namely, 5'-GCGTGTCTGAAACTGAATTCT − 3', 5'- GCTCCTGATGGTGACGTCTTTCTCT − 3' and 5'- GCGTTCAATGTGGAGGCCATCTGAA − 3', respectively. The negative control sequence was: 5′- TTCTCCGAACGTGTCACGTAA − 3′. The following are the ATG5 interference sequences: ATG5-HOMO-853: 5' CCAUCAAUCGGAAACUCAUTT 3', ATG5-HOMO-393: 5' GGACGAAUUCCAACUUGUUTT 3', and ATG5-HOMO-940: 5' GACCUUUCAUUCAGAAGCUTT 3', and the negative control sequence is: 5' UUCUCCGAACGUGUCACGUTT' 3’. Lentiviruses that overexpressed and silenced SIRT4, were purchased from Hanbio (Shanghai, China), and the lentiviral vector was pHBLV-U6-Puro. The final titer of lentivirus and negative control virus was 2 × 108 PFU/ml. We screened the siRNA sequences with the highest interference efficiency by PCR experiments (data not shown), cells were then transfected with the overexpressing or interfering lentivirus with the highest interference efficiency for 72 hours and screened with puromycin to achieve stable transfection of the overexpressing or interfering SIRT4 lentivirus in T24 cells.
Reverse transcription RT-PCR
Total RNA from the tissue was purified using the TRIzol kit (Invitrogen, USA) following the manufacturer’s protocol. Total cDNA 500 ng was synthesized using reverse transcription kit (PrimeScriptTM RT Master Mix, TaKaRa, Japan). The cDNA was diluted three times using the RT-PCR Kit (SYBR® Premix Ex Taq™ II, TaKaRa, Japan) in the RT-PCR reaction apparatus (DNA engine option 2, BioRad). GAPDH was selected as the reference gene. Primers for each gene were the following: SIRT4 forward primer 5’- GCGAGAAACTTCGTAGGCTG − 3’, reverse primer 5’- TCAGGACTTGGAAACGCTCT − 3’; GAPDH forward primer 5’- TCAAGAAGGTGGTGAAGCAGG − 3’, reverse primer 5’- TCAAAGGTGGAGGAGTGGGT − 3’. The PCR reaction conditions were as follows: 2 min at 94 ºC, 30 s at 94 ºC, 30 s at 57 ºC, 1 min at 72 ºC for 40 cycles, 5 min at 72 ºC and cooling at 4ºC. After the loop, melting curve was analyzed to ensure uniformity of the PCR product. Gene expression was calculated by 2−∆∆Ct method.
Western blot
Cells were lysed with Ripa lysis buffer (Beyotime, China) supplemented with protease inhibitor cocktail (Beyotime, China). Protein concentrations were determined by BCA protein concentration reagent kit (Beyotime, China). Cell lysates were separated by SDA-PAGE and transferred to PVDF membrane. The reference antibodies for this assay were rabbit anti-human SIRT4 (36 KDa) polyclonal antibody (HPA029692, Sigma, USA), rabbit anti-human caspase3 (35/18 KDa) polyclonal antibody (9662, CST, USA), rabbit anti-human caspase9 (46/35 KDa) polyclonal antibody (10380-1-AP, Proteintech, China), rabbit anti-human p65 (65 KDa) polyclonal antibody (10745-1-AP, Proteintech, China), abbit anti-human LC3B monoclonal antibody (ab192890, Abcam, England), rabbit anti-human p62 monoclonal antibody (ab109012, Abcam, England), rabbit anti-human beclin1 monoclonal antibody (ab207612, Abcam, England), rabbit anti-human GABARAP monoclonal antibody (ab109299, Abcam, England), rabbit anti-human GABARAPL2 monoclonal antibody (ab126607, Abcam, England), rabbit anti-human ATG5 monoclonal antibody (ab108327, Abcam, England), goat anti-rabbit detection antibody (ab97200, Abcam, England), rabbit anti-human GAPDH (37 KDa) polyclonal antibody (AB-P-R 001, Goodhere, China).
Cell proliferation activity
Seeding cells at 1000/well for cell proliferation activity for cell proliferation in a 96 well plate. The medium was then changed every other day and incubated until the day when the assay was performed. For the assay, 10ul of CCK-8 (Dojindo, Japan) solution was added to each well, and then the absorbance was measured at 450 nm after incubation in a CO2 incubator for 2 hours.
Wound healing assay
The experimental group and negative control group cells of T24 cells were seeded in 5*105 per hole in 6 well plate, and were culture overnight. When the cell density reached about 90%, with a 200 microlite tip head perpendicular to the bottom of the 6 well plate. Wash 3 times with PBS and then continue incubation in serum-free medium for 24 hours. Images of cells after scraping and at the end of culture were obtained at 3 locations using a light microscope, which was used to calculate the distance of cell migration.
Cell Migration and Invasion Assays
For the migration assay, the transfected cells (6×104cells) were suspended in 0.2 ml of serum-free medium and seeded in the upper chambers of 24-well Transwell plates (Corning Inc., Corning, NY, USA). The lower chambers were filled with 0.6 ml of growth medium containing 10% FBS. Cells were cultured at 37°C and allowed to migrate for 18 h. After migration, cells in the top chambers were abandoned by a cotton swab, and the cells in the bottom chambers were fixed in 4% paraformaldehyde and stained with 0.1% crystal violet (Sigma, USA). Stained cells were counted under the microscope in five random fields of view of each well (Olympus, Japan). For the invasion assay, a similar protocol was followed except that the top chamber of the trans-well plate was precoated with Matrigel (BD Biosciences).
Flow cytometric analysis for apoptosis rate and cell cycle
Cells were harvested by trypsinization, pelleted by centrifugation, and resuspended in PBS containing 3% fetal bovine serum. The measurement of cell apoptosis was performed by flow cytometry (C6, BD, USA) using annexin V-APC and 7-AAD (BD, USA) staining. Apoptosis rate was calculated for early apoptosis, which were the cells stained by APC. Flow cytometry analysis software is Accuri C6 software (BD, USA). The cell cycle was determined using a Propidium Iodide (PI)/RNase kit (BD, USA), and the results were examined with the ModFit analysis software program (Verity Software House, Topsham, ME, USA).
Confocal fluorescence microscopy
Cells were cultured on glass slides, transiently transfected with the GFP-RFP-LC3 adenovirus, and processed accordingly. After being washed with PBS buffer, the cells were fixed with 4% paraformaldehyde. The slides were then sealed with glycerol and the location of the LC3 spot was observed using a confocal fluorescence microscope.
Statistical analysis
Statistical analysis was performed using the SPSS software package version 20.0 (SPSS, Inc., IBM, USA). Data from three or more independent experiments are expressed as mean ± standard deviation. A paired Student’s t-test was used to analyze the final score of the tumor and non-tumor tissues. Chi-squared analysis was used to analyze the relation between SIRT4 horizontal grouping and clinico-pathological parameters. The Kaplan-Meier method (the log-rank test) was used for single-factor analysis and the Cox proportional hazards regression model was used to identify independent prognostic factors. P < 0.05 (two-tailed) was considered statistically significant.