Cell Culture
16HBE14o- human bronchial epithelial cells (a gift from Dr D. C. Gruenert, University of California) were cultured in high glucose Dulbecco’s Minimum Essential Medium with sodium pyruvate and L-glutamine (Life Technologies; Carlsbad, CA) supplemented with 10% fetal bovine serum (Tissue Culture Biologicals; Tulane, CA), 100 U/ml Penicillin and 100 µg/mL Streptomycin (Life Technologies), and 10 mmol/L HEPES (Life Technologies). For diesel exhaust particle exposures, 1.5x105 16HBE14o- cells were seeded onto collagen coated, permeable polyester Transwell inserts with 0.4 µm pores and 0.33 cm2 growth area (Corning; Kennebunk, ME) and cultured in an atmosphere of 95% air/5% CO2 at 37°C for five days. Serum concentration was reduced to 5% starting 18 hours prior to treatment with DEP in order to transition cells to lower serum conditions prior to DEP exposure.
Immunofluorescence
1.5x105 16HBE14o- cells were seeded onto collagen coated coverslips (18 mm diameter, thickness #1, Fisherbrand; Waltham, MA) and cultured in an atmosphere of 95% air/5% CO2 at 37°C for six days. Cells were fixed and stained according to [63]. Briefly, coverslips were fixed in ice cold 100% methanol (Fisher Chemical; Waltham, MA) for 15 minutes at -20°C. Fixed coverslips were blocked with 1x Dulbecco’s Phosphate Buffered Saline (DPBS, Life Technologies) + 5% normal donkey serum (Jackson ImmunoResearch Laboratories; West Groves, PA) + 0.3% Triton X-100 (Fisher Bioreagents; Waltham, MA) for 1 hour at room temperature and incubated with 2 µg/mL rabbit anti-Tricellulin (Invitrogen 48-8400) and mouse anti-Occludin (Invitrogen 33-1500) in antibody dilution buffer (1x DPBS + 1% Bovine serum albumin (BSA, Sigma-Aldrich; St. Louis, MO) + 0.3% Triton X-100) overnight at 4°C. Coverslips were then incubated with 4 µg/mL Alexa Fluor 568 donkey anti-mouse (Invitrogen A10037) and Alexa Fluor 488 donkey anti-rabbit (Invitrogen A21206) in antibody dilution buffer for 1 hour at room temperature protected from light, followed by an incubation with 300 nM DAPI (Invitrogen) for five minutes protected from light. Coverslips were washed three times with 1x DPBS for five minutes per wash between each step. Coverslips were blotted dry, and mounted with 10 µL ProLong Gold anti-fade reagent (Invitrogen). Coverslips were cured for 24 hours at room temperature protected from light and imaged with an Olympus FV1000 laser scanning confocal microscope (Olympus; Tokyo, Japan) at 60x magnification. Images were assembled using ImageJ software.
Diesel Exhaust Particle Exposure
Standard reference material 2975 (SRM 2975) was purchased from the National Institutes of Standards and Technology (Gaithersburg, MD). SRM 2975 was suspended to a concentration of 10 mg/mL in DPBS (Life Technologies) containing 0.05% Tween-20 (Bio-Rad, Hercules, CA). The resulting suspension was either sonicated with a Branson Sonifier 450 with cup horn attachment (Branson Ultrasonics; Danbury, CT) for 5 seconds on/off for a total time of 10 minutes, power setting 9, immediately before application, or with a Branson Sonifier 150 probe sonicator for 10 seconds on/off for a total time of 30 seconds, power setting 5, before being frozen at -80°C. Immediately prior to application, DEP was thawed, vortexed for 10 seconds, and sonicated with a Aquasonic 75T water bath sonicator (VWR International, Radnor PA) for 15 minutes at 4°C. DEPs were added to cell culture medium containing 1% FBS to concentrations of 16.5, 82.5, or 165 µg/mL. 100 µL of resulting solutions were added to apical Transwell chambers, resulting in final applied concentrations of 5, 25, or 50 µg/cm2. 1% serum 16HBE14o- medium was added to the basolateral chamber at the time of treatment. The time of addition of DEP was defined as time zero (T0).
In Vitro Dosimetry Estimations
Estimations of the fraction of applied particles deposited onto cells were made using the in vitro Sedimentation, Diffusion and Dosimetry model (ISDD) [25]. Values for media viscosity (0.0006913 Pa-s) and density (1.007 g/cm3) at 37°C were estimated according to values of similar cell culture media reported in [25]. The raw material density (1.27 g/cm3) and agglomerate effective density (1.78 g/cm3) of diesel exhaust particles were assigned according to values reported in [26] and [27]. The particle/agglomerate diameters were measured to be 1100 nm by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern Instruments, UK) with the following specifications: temperature, 25°C; material refractive index, 1.59; material absorption, 0.01; dispersant refractive index, 1.33; dispersant viscosity, 0.8881 centipoise. Media column height was defined as 3 mm, and a total simulation time was defined as six hours.
Transepithelial Electrical Resistance
TEER measurements were performed with an EVOMX volt-ohm-meter (World Precision Instruments; Sarasota, FL) on 16HBE14o- human bronchial epithelial cells grown on collagen coated, permeable polyester Transwell inserts with 0.4 µm pores and 0.33 cm2 growth area (Corning). TEER was measured at different time points after addition of DEP, as indicated in Figure Legends.
FITC-Dextran Permeability Assay
Paracellular permeability of fluorescent macromolecules was investigated by measuring passage of apically applied 4 kDa FITC-Dextran (Sigma-Aldrich) across epithelial monolayers. FITC-Dextran was suspended to a concentration of 10 mg/mL in phenol-free high glucose Dulbecco’s Minimum Essential Medium with L-glutamine and HEPES (Life Technologies), added to the apical chamber, and samples were collected from the basolateral chamber 2.5 hours later. Sample fluorescence was measured using a Beckman Coulter DTX 880 multimode detector and the concentration of FITC-Dextran in the basolateral chamber was calculated using a standard curve.
Cytotoxicity Assay
The CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega; Madison, WI) was performed according to the manufacturer’s instructions on 16HBE14o- human bronchial epithelial cells grown on collagen coated Transwell inserts (Corning) following six-hour exposure to 5 to 50 µg/cm2 DEP or Vehicle controls. Briefly, at the time of assessment, well media was diluted 1:25 in DPBS (Life Technologies) and 50 µl of the resulting medium was combined with 50 µl CytoTox 96 reagent and incubated for 30 minutes at room temperature. 50 µl stop reagent was then added to each well and absorbance was measured at 492 nm on a Multiskan Ascent Plate Reader (Thermo Fisher; Waltham, MA). LDH release was assessed by dividing individual absorbance values by the average Vehicle LDH release and graphed as fold change over Vehicle.
Transfection with Targeted siRNA
Fluorescein conjugated scramble siRNA (Santa Cruz Biotechnology; Dallas, TX), unconjugated scramble siRNA (Qiagen, Valencia, CA), or Tricellulin siRNA (Santa Cruz Biotechnology) were mixed 1:1 v/v with Lipofectamine 2000 (Invitrogen; Carlsbad, CA) in Opti-MEM medium (Life Technologies) to a final concentration of 400 pM and incubated for 30 minutes at room temperature protected from light. 2.5x106 16HBE14o- human bronchial epithelial cells were suspended in the resulting siRNA/Lipofectamine solution and incubated at 37°C for 30 minutes. 5x105 cells per well were seeded onto collagen coated Transwell inserts (Corning) and incubated at 37°C. Six hours post transfection, 20% serum medium was added to the apical chamber, with 10% serum medium in the basolateral chamber. Medium was changed in both chambers to fresh 10% serum medium 24 hours post transfection.
Western Blot of Tight Junction Proteins
16HBE14o- human bronchial epithelial cells or mouse lung tissue were homogenized and lysed in RIPA buffer (50 mM Tris-HCl, pH 8.0, 150mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate) supplemented with protease and phosphatase inhibitor cocktail on ice and frozen at -80°C. Samples were thawed and centrifuged at 15,000 rpm for 15 minutes at 4°C. Protein concentration was determined by Bradford assay and equal protein concentrations of lysate were run on a 5% stacking/10% separating SDS-PAGE gel. Proteins were transferred to PVDF membranes and blotted with 1:1000 rabbit anti-Tricellulin (Invitrogen 48-8400) or 1:50,000 mouse anti-GAPDH (Abcam ab8245) overnight at 4°C followed by 1:10,000 horseradish peroxidase linked donkey anti-rabbit IgG (GE Healthcare NA934V) or horseradish peroxidase linked sheep anti-mouse IgG (GE Healthcare NA931V) for 1 hour at room temperature. Signals were developed with Clarity western ECL substrate (Bio-Rad) and recorded with BioBlot BXR film (Laboratory Product Sales; Rochester, NY) or using Quality One software (Bio-Rad) with a Chemi Doc XRS scanner (Bio-Rad). Densitometry was assessed using ImageJ software.
RT-qPCR of Mouse Lung Tissue
Mouse lung tissue was snap frozen in liquid nitrogen and homogenized with Trizol reagent (Invitrogen). RNA phase was separated using chloroform extraction and RNA was collected using an E.Z.N.A. total RNA kit (Omega Biotek; Norcross, GA) according to manufacturer’s instruction. RNA was eluted in DEPC-treated water and RNA purity and concentration were measured using a NanoDrop spectrophotometer (Thermo Fisher). cDNA was reverse transcribed (RT) using an iScript cDNA synthesis kit (Bio-Rad) according to manufacturer’s protocol. Resulting cDNA template was added to wells containing 12.5 µl iQ SYBR Green Supermix (Bio-Rad) and 2 µl sense and antisense primers at a final concentration of 400 nM per primer (Tricellulin forward 5’ AATGACTCCTGAGCTGTTGAGTGG 3’, reverse 5’ TCCGCAGACAGCTCTTTGTACTCT 3’ or GAPDH forward 5’ CTTTGTCAAGCTCATTTCCTGG 3’, reverse 5’ TCTTGCTCAGTGTCCTTGC 3’). Wells were brought to a final volume of 25 µl using DEPC-treated water. qRT-PCR was run on a C1000 Touch Thermal Cycler (Bio-Rad) with the following protocol: An initial step at 95°C for 3 minutes was followed by 40-cycle sequence of denaturation (30 seconds at 95°C), annealing (30 seconds at 55°C) and elongation (30 seconds at 72°C). Data were evaluated by the 2-ΔΔCT method [64].
Generation of Diesel Aerosol
SRM 2975 DEP were suspended in water at 0.2 mg/mL with 5 µl/L TWEEN-80 (Millipore Sigma; St. Louis, MO). The resulting solution was mixed and sonicated with a probe sonicator (Sonics & Materials Inc.; Newtown, CT) at 750 watts, 20 kHz frequency, for 3 ten second bursts. 15 ml of this solution was put into an ultrasonic nebulizer (Model Ultrasonic2000, Nouvag Dental and Medical Equipment; Goldach, Switzerland) to generate the diesel mist. Clean dry dilution air (500-1000 ml/min) was passed through the nebulizer at a frequency of 2.4 MHz to produce the mist, which was then passed through a heated drying tube and cold trap to remove water. The resulting dry aerosol was mixed with diluting air and entrained into a 30 L stainless steel-reinforced Lexan exposure chamber at a rate of 25-30 L/min. Variation of the dilution air passing through the nebulizer controlled the concentration of aerosol that was delivered to the chamber. A peristaltic pump (Masterflex, Cole Palmer Inc.; Mount Vernon, IL) was used to maintain the diesel solution level in the nebulizer for the duration of the two-hour exposure session. Real-time exposure chamber particle number concentration was measured using a condensation particle counter (CPC, Model 3022A TSI Inc.; Shoreview, MN). The aerosol particle size distribution was assessed once per exposure using an electrostatic classifier (SMPS Model 3071, TSI Inc.; Shoreview, MN). Filter samples were periodically collected to determine gravimetric exposure concentration by mass. The goal was a nominal mass concentration value of 0.2 µg/L (200 µg/m3).
Neonatal Mouse Whole Body Inhalation Exposures
Adult male and female BALB/c mice were obtained from Jackson Laboratory and paired for breeding. After pairing, females were observed daily until vaginal plugs were noted. Upon identification of vaginal plugs, females were weighed, and male mice were removed. 14 days later, females were weighed to confirm pregnancy. Positive cages were observed daily until pups were noted. Starting between post-natal day (PND) 3 and 5, resulting male and female neonatal mouse pups were placed in individual wire mesh cages and placed inside a 30 L stainless steel-reinforced Lexan exposure chamber. Mice were exposed to aerosolized SRM 2975 or medical grade filtered air for 2 hours per day for five consecutive days. Cages were rotated daily within the chamber to ensure even exposure throughout the exposure regimen. Two weeks after the final exposure, mice were euthanized, and lung tissue was collected for RNA and protein isolation. All mice were housed in an AAALAC, internationally accredited, specific pathogen-free vivarium facility with ad libitum access to rodent chow and water (12-hour light/dark cycle). All procedures were reviewed and approved by the University of Rochester Committee on Animal Research.
In Vivo Dosimetry Estimation
In vivo particle dosimetry deposited dose was determined using the measured aerosol characteristics, estimated deposition fractions, and adjustments for neonatal mouse lung surface area. using the Multi-Path Particle Dosimetry Model v 3.04 (MPPD v 3.04) [33]. Deposition fractions were estimated using the Multi-Path Particle Dosimetry Model [33] (MPPD v 3.04), the measured aerosol CMD and GSD, determined for the adult mouse using and allometrically-adjusted values for adult mouse tidal volume and respiratory rate [65]. Body weights for adult male and female and BALB/c mice were obtained using growth charts available from the Jackson Laboratory and averaged for use in allometric equations. The inhaled deposited dose was calculated using the airborne mass concentration, allometrically-adjusted lung physiology parametersminute ventilation [65], the sum of tracheobronchial and alveolar deposition fracitons, and assuming that no clearance occurred over the total 10 hours of exposure. In order to account for differences in the adult and neonatal lung, we calculated the deposited dose over the entire surface area of the respiratory tract (adult mouse lung, ~500 cm2; PND 5 mouse lung, ~50 cm2;[34]).
Statistical Analysis
All values are expressed as mean ± standard deviation (SD). Exposure-related differences in measured outcomes were evaluated via Student’s t-tests, Unequal variances t-test, or one-way analysis of variance (ANOVA) followed by Tukey’s HSD group comparisons using GraphPad Prism software as indicated in the Figure Legends. Differences were considered to be statistically significant when p was less than 0.05.