Reagents, cell lines, plasmids and viruses
Wogonin and acyclovir were got from the National Institutes for Food and Drug Control in China (Beijing, China). SB203580, SP600125, and MG132 were purchased from Beyotime Biotechnology Institute (Haimen, Jiangsu, China). Alexa Fluor 488 goat anti-mouse IgG (H + L), DAPI, DRAQ5 and SYBR green real-time PCR reagent were got from Life Technologies, Thermo Fisher Scientific (Carlsbad, CA, USA). IRDye 680 goat-anti-rabbit and IRDye 800 goat-anti-mouse were obtained from LI-COR (Lincoln, NE, USA). Antibodies specific for HSV gD-1/2, HSV-1 ICP0, HSV-1 ICP4, HSV-1 ICP27, JNK2, p38, GAPDH, and RIPA lysis buffer were purchased from Santa Cruz (Santa Cruz, CA, USA). p65, p-p38, p-c-Jun, p-JNK1/2, p-ATF-2, IκB-α antibodies were from Cell Signaling Technology (Beverly, USA). Bright-Glo luciferase assay system was purchased from Promega (Madison, WI, USA).
Vero, HEC-1-A cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). NF-κB-luc and AP-1-luc reporter plasmid was purchased from Clontech (Palo Alto, CA, USA). HSV-1(HF), HSV-1/blue and HSV-2 (G) were propagated and titrated on Vero cells as described [12].
In vitro viral inhibition assay
In vitro viral inhibition of wogonin was determined via titrating infectious virions according to previously described method [13]. Briefly, confluent HEC-1-A cells in 96-well plates were pretreated with serial concentrations of wogonin for 30 min, and then infected with HSV-1 or HSV-2 (multiplicity of infection [moi] = 1). At 24 hrs post-infection (p.i.), the culture medium was replaced with fresh medium. The infected cells were frozen and thawed with three cycles for releasing the virions. Viral titration was quantified by counting the numbers of plaques on confluent Vero monolayer cells.
In vitro Cytotoxicity assay
The in vitro cytotoxicity was determined using the commercial CCK-8 kit (Dojindo, Kumamoto, Japan) according to the manufacturer’s instructions. Briefly, 2 × 104 cells per well were seeded into 96-well plates and cultured for 24 h, then serially diluted compound were dispensed in triplicate. After 24 hrs incubation, 10 µl CCK-8 reagent was added into each well, and the plates were incubated at 37 °C for 3 h. The absorbance at 450 nm was measured using a TECAN Infinite M200 microplate reader (Männedorf, Switzerland), and cell viability was plotted as the percent viable cells of the mock-treated control cells.
Western Blot And In-cell Western Assay
The method was described previously [14]. Cells were lysed using RIPA lysis buffer on ice for 30 min and then centrifuged at 12,000 × g for 10 min at 4 °C to collect the supernatants. Total protein concentrations were determined using BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA). After separated via SDS-PAGE, electroluted onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA), membrane blocking using Odyssey blocking buffer (LI-COR), and primary and secondary antibodies incubation, protein bands were visualized via Odyssey Infrared Imager (LI-COR).
In-cell Western assay was performed in 96-well plate. Cells were fixed with 4% paraformaldehyde for 20 min at room temperature (RT) and permeabilized by five washes in 0.1% Triton X-100 in PBS with 5 min for each wash. Cell monolayers were blocked for 90 min in blocking buffer, 4% nonfat dry milk in PBS-T (phosphate-buffered saline, 0.1% Tween-20), and then incubated with primary antibodies diluted into blocking buffer (1:200) for 2 hrs at RT. After washing with PBS-T, cell layers were stained in IRDye IgG (1:1500) for 1 hr. The plate was rinsed and scanned in Odyssey Infrared Imager. Relative protein expression level was normalized against DRAQ5.
Time-of-drug-addition Assay
The Time-of-drug-addition assay was carried out via measuring HSV-2 glycoprotein D (gD) protein expression level, which could indicate viral replication efficiency. HEC-1-A cells were seeded in 96-well plate and infected with HSV-2 (moi = 1). Wogonin or other drugs with known inhibitory mechanisms were dispensed at different time points. Viral gD level was determined via in-cell western assay at 24 hrs p.i. as described previously [15].
Cell Transfection And Luciferase Assay
HEC-1-A cells were transiently transfected with luciferase reporter plasmids using Lipofectamine 2000 transfection reagent (Life Technologies, Thermo Fisher Scientific). The relative luminescence units (RLUs) were determined using Bright-Glo luciferase assay system (Promega, Madison, WI, USA). Briefly, HEC-1-A cells were seeded into 96-well plates. When the confluence reaching ~ 90%, cells were transfected with 100 ng NF-κB or AP-1 luciferase reporter plasmids. Cells were subsequently cultured for 24 hrs and then treated with inhibitors for another 24 hrs. The luminescence signal was monitored by GloMax-96 microplate luminometer (Promega, Madison, USA).
Rna Extraction And Real-time Pcr
Total RNA was extracted using TRIzol reagent (Life Technologies, Thermo Fisher Scientific) according to manufacturer’s instructions. Complementary DNA (cDNA) was reverse-transcribed using ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). Real-time PCR was performed in triplicate on ABI Prism 7300 Sequence Detection System using the SYBR Green PCR Master Mix (Life Technologies). The sequences of primers used in this study was as follow: HSV-1 gD (Forward: 5’-AGCAGGGGTTAGGGAGTTG-3’; Reverse: 5’-CCATCTTGAGAGAGGCATC-3’); HSV-2 gD (Forward: 5’- CCAAATACGCCTTAGCAGACC − 3’; Reverse: 5’- CACAGTGATCGGGATGCTGG − 3’); human GAPDH (Forward: 5’- TGCACCACCAACTGCTTAGC − 3’; Reverse: 5’- GGCATGGACTGTGGTCATGAG − 3’). Messenger RNA (mRNA) transcription levels were standardized against housekeeping gene GAPDH.
Hsv-1/blue Assay
HSV-1/blue assay was performed as described, but modified [16]. Confluent HEC-1-A cells in 96-well plate were pre-incubated with serial diluted drugs for 30 min at 37℃. Cells were infected with HSV-1/blue (moi = 1). Cells were lysed with 1% NP-40 in DMEM 12 hrs p.i. Cell lysates from each well were then transferred into a new Costar 96-well flat plate. β-gal substrate solution-chlorophenol red-β-D-galactopyranoside (CPRG) were added into each well. Absorbance at 570 nm was measured after 1 hr using a TECAN Infinite M200 microplate reader.
Immunofluorescence Staining And Confocal Microscopy
HEC-1-A cells were seeded onto Φ10mm glass coverslips which were placed in a 24-well plate. The cells growing on the coverslips were rinsed with PBS and then fixed with 4% paraformaldehyde for 15 min at RT, following the permeabilization with 0.2% Triton X-100 for 15 min. The coverslips were blocked with 1% BSA in PBS for 30 min at RT. Target biomarkers were immunolabeled using the respective primary antibodies and followed by Alexa Fluor 488 IgG. Nuclei were visualized by staining with DAPI. Images were acquired using an Olmpus FluoView FV10i confocal microscope (Tokyo, Japan).
Drug Synergistic Analysis
Firstly, we employed the in-cell western assay to determine the inhibitory efficiency for HSV-2 gD expression of wogonin and acyclovir in HEC-1-A cells, respectively. And the 50% maximal effective concentrations (EC50s) of the two compounds were calculated. The compounds combinations were investigated with a fixed molar concentration ratio, which was optimized to give the greatest synergism with a range of serial dilutions. The combination index (CI) of the two drugs was calculated by CalcuSyn software (Biosoft, Cambridge, UK), and the method was referred to Chou and Talalay [17]. The synergy was indicated according to the CI values and scored as follows: CI < 0.1, very strong synergism; CI = 0.1 to 0.3, strong synergism; CI = 0.3 to 0.7, synergism; CI = 0.7 to 0.85, moderate synergism; CI = 0.85 to 0.90, slight synergism; CI = 0.9 to 1.1, nearly additive synergism; and CI = > 1.1, antagonism.