Atsttrin Regulates Osteoblastogenesis and Osteoclastogenesis through TNFR Pathway

doi:10.21203/rs.3.rs-2565180/v1

Download PDF

Article

Atsttrin Regulates Osteoblastogenesis and Osteoclastogenesis through TNFR Pathway

https://doi.org/10.21203/rs.3.rs-2565180/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 11 Dec, 2023

Read the published version in Communications Biology →

Version 1

posted

You are reading this latest preprint version

Osteoporosis is a systemic metabolic bone disease. Osteoporosis is believed to be a systemic inflammatory condition in which inflammatory cytokines play an important role. Among these molecules, tumor necrosis factor-α (TNF-α) plays an important role in the initiation and development of osteoporosis. Atsttrin is an engineered protein derived from the growth factor, progranulin (PGRN). It’s well accepted Atsttrin inhibits TNF-α’s function by binding tumor necrosis factor-α receptors (TNFRs). The aim of this study was to investigate the role of Atsttrin in osteoporosis. Present study use cell TRAP staining to determine the role of Atsttrin in osteoclastogenesis. Alkaline phosphatase staining of cells was examined for ostoblastogenesis. Western blotting and ELISA assay were taken for the measurement of protein level and phorsphorylation. Real time PCR was used to test the transcriptional level expression. Gene silence method was taken for the pathway investigation. By applying these methods, we found Atsttrin inhibited TNF-α-induced osteoclastogenesis and inflammatory destruction. Further mechanism studies indicated Atsttrin inhibited TNF-α- induced osteoclastogenesis though TNFR1 signaling pathway. Moreover, Atsttrin rescued TNF-α-mediated inhibition of osteoblastogenesis via TNFR1 pathway. Importantly, present study found Atsttrin could not induce osteoblast differentiation, however, Atsttrin could significantly enhance osteoblastogenesis through TNFR2-Akt-Erk1/2 signaling.

Health sciences/Medical research

Health sciences/Diseases

Osteoporosis

Atsttrin

TNF-α

inflammation

TNFR pathway

Osteoporosis is defined as a systemic metabolic bone disease [1]. In osteoporosis, the balance between osteoclasts and osteoblasts is disturbed, resulting in increased bone resorption and/or decreased bone formation, which in turn reduced bone mass and bone micro-structure destruction, eventually making bones prone to fracture [2].

The disorder of cytokines plays an important role in the occurrence and development of osteoporosis [3]. TNF-α as a member of the tumor necrosis factor-α superfamily, often at the peak of the inflammatory cascade [4, 5]. The study found the TNF-α level of postmenopausal osteoporosis women is higher than that of non-osteoporosis women [6]. TNF-α increases RANKL secretion in osteoblasts and bone marrow stromal cells, which can further induce osteoclast formation and enhance osteoclast activity and bone resorption[7]. It was found that the expression of TNF- α in peripheral blood and local bone tissue of osteoporosis mice was increased by making age-related and ovariectomy induced osteoporosis mice model, which was positively correlated with the pathological process of osteoporosis [8]. At the same time, TNF- α can also inhibit the differentiation of osteoblasts and eventually lead to the destruction of normal bone metabolism balance, resulting in bone loss [9, 10].

PGRN is a multi-functional and widely expressed growth factor that plays an important role in many pathophysiological processes of the human body[11, 12], including anti-inflammatory, cartilage formation, tumorigenesis, tissue repair and wound healing[5, 13–15], which contains seven semi-repeated cysteine-rich motifs that can bind to tumor necrosis factor receptors (TNFR) and effectively inhibit TNFα-mediated inflammatory response, which can play a protective role in inflammatory diseases[4, 16]. Atsttrin is PGRN derived engineered proteins composed of three fragments of PGRN, including half-unit granulin A、C、F plus linked protein P3、P4 and P5[17, 18]. Atsttrin is the smallest molecule of PGRN function and still has affinity to TNF-α receptor [19]. Atsttrin and PGRN have similar physiological functions and can also bind to TNFR and inhibit TNF-α signaling pathways[19, 20]. What's more, Atsttrin showed longer half-lives and stronger therapeutic effects in previous studies compared to PGRN [18, 20]. At the same time, we found that Atsttrin plays an important role in protecting early inflammatory arthritis in animal models and promoting cartilage repair[19, 20].

However, researchers have not clearly determined whether Atsttrin plays a role in against the development of osteoporosis. Based on the results of previous studies, taken the importance of TNF-α in osteoporosis, the purpose of this study was to investigate the role of Atsttrin in regulating osteoclast and osteoblast formation as well as the potential involved molecular mechanism, providing alternative chance for the treatment of osteoporosis.

2.1 Media, reagents and animals

Dulbecco's Modified Eagle Medium (DMEM) (catalog no. 8120450) and α-modified Eagle’s medium (catalog no.8121119) was purchased from Gibco-BRL (Waltham, MA, USA). Specific antibodies against TRAP (catalog no. ab191406) and RUNX-2 (catalog no. ab236639) were purchased from Abcam(Cambridge, UK); anti-GAPDH (Catalog no. AF7021), anti-COX-2(Catalog no.AF7003), anti-iNOS(Catalog no.AF0199),anti-TNFR1(Catalog no.AF0282) and anti-TNFR2(Catalog no.AF0364) from Affinity Biosciences(OH.USA); lamin B1 (catalog no.13435),anti-P38 (catalog no.8690), anti-p-P38 (catalog no.4511), anti-JNK(catalog no.9252),anti-p-PJNK (catalog no.9255),anti-Erk1/2 (catalog no.4695),anti-p-Erk1/2 (catalog no.8544),anti-AKT (catalog no.4691),anti-p-AKT (catalog no.4060),anti-p-P65 (catalog no.3033) and anti-P65 (catalog no.8242) from Cell Signaling Technology (Danvers, MA, USA).

All the experimental animals included in this study were conducted in accordance with institutional guidelines and approved by the Institutional Animal Care and Use Committee of Shandong University (Shandong, China).8–12 weeks old male mice were used for experiments.

2.2 Cell culture and treatment

The murine cell lines RAW264.7 and MC3T3-E1 were obtained from the Cell Bank of Chinese Academy of Sciences. All cell lines were authenticated using short tandem repeat (STR) analysis, and the databases of the Chinese Academy of Sciences and American Type Culture Collection were used as references. MC3T3-E1 cells and primary marrow mesenchymal stem cells were maintained in α-modified Eagle’s medium, while RAW264.7 cells and primary bone marrow derived macrophages were maintained in Dulbecco’s modified Eagle’s medium (DMEM). The medium contained 10% FBS and 1% penicillin/streptomycin. The cells were cultured at 37 ◦C and 5% CO2. The culture medium was replaced once every 2 days. All cells were passaged when they reached approximately 80–90% confluence.

Primary bone marrow derived macrophages (BMDMs) and primary marrow mesenchymal stem cells(BMMSCs)were isolated from mice. After mice were anesthetized and sacrificed by cervical dislocation and then soaked in disinfectant alcohol for 20 minutes, followed by the tibia and femur were isolated and both ends of the epiphyses were cut to open bone medullary cavity. Flush the marrow into a 15 mL centrifuge tube using a 1 mL syringe. Use 5 mL PBS per bone. Bone marrow cells were collected and seeded in 6-well plates or cell culture dish, the cells were cultured in a saturated humidity incubator with 5% CO2 at 37℃[21]. For BMDMs, M-CSF (10ng/ mL, PeproTech, USA) was added to the culture medium for 6 days and the medium was changed on the third day, BMDMs could be successfully cultured six days later. For BMMSCs, the culture medium was replaced to remove the unadherent cells after 48 hour. The medium was replaced every 3 days. The adherent cells were subcultured after becoming 80–90% confluency. Passage 1 to 3 cell were used in this study.

2.3 Real-time reverse transcriptase-polymerase chain reaction (RT-PCR)

RAW264.7 and MC3T3-E1 cells were collected for test the expression of transcription level. Total RNA was separately extracted with TRIzol reagent (Takara Bio, Japan) and cDNA was synthesized using RT-PCR kit(Toyota, japan).SYBR Green PCR Master Mix (Toyobo, Japan) was used to perform for RT-PCR reaction. The expression level of target gene mRNA was calculated by ΔΔCT. Each experiment was repeated three times. The following primers were used: tartrate resistant acid phosphatase (TRAP)、Cathepsin K、Caltonin Receptor、alkaline phosphatase (ALP)、 RUNX2、Col-1、Interleukin-6(IL-6)、Interleukin-1β(IL-1β)、Cyclooxygenase-2(COX-2)、β-action. The primers are designed as listed in Table 1[22].

2.4 Western blotting

Protein samples were collected from the RAW264.7 and MC3T3-E1 cells. Absorb the supernatant and determine the protein concentration with BCA protein detection kit (Beijing Biotechnology Co., Ltd., China). The protein samples were separated by SDS-PAGE and then transferred to the PVDF membranes (Millipore, USA). Blocked the PVDF membrane with TBST containing 5% skim milk at room temperature for 1 hour. The PVDF membrane was incubate with primary antibody at 4°C for 12–14 hours. Next, it was washed 4 times with TBST at room temperature. The membrane was incubated in goat anti-rabbit immunoglobulin (IgG)- horseradish peroxidase (HRP) secondary antibody (1:3000; Beijing jinqiao biotechnology, china) for 1hour at room temperature. This protein bands were observed with enhanced chemiluminescence visualized using an enhanced chemiluminescence system (Amersham Life Science, Little Chalfont, UK)[23]. RAW264.7 cells were cultured with TNF-α (10 ng/mL) in the absence or presence of Atsttrin (500ng/ml) for various time points. Nuclear extraction (NE) and cytoplasmic extraction (CE) were tested by Immunoblotting analysis with anti-p65 antibody[24].

2.5 Enzyme-linked immunosorbent assay

BMDMs were seeded in a 6-well plate, Macrophage Colony-Stimulating Factor (M-CSF) (10 ng/mL) (PeproTech, USA) was added to the BMDM culture medium for 6 days. BMDMs were treated without or with TNF-α (10 ng/mL) (PeproTech, USA) in absence or presence of Atsttrin (500ng/ml) for 48 hours. The levels of IL-1β、IL-6 and IL-17 in supernatant were detected by ELISA kit(Elabscience, USA) according to the manufacturer’s instructions. The levels of CTSK and TRAP in the mouse serum were assayed through ELISA by using a commercial kit (Elabscience, USA) according to the manufacturer’s instructions.

2.6 Osteoclastogenesis

BMDMs and RAW264.7cells were treated with TNF-α(10ng/ml)and receptor activator of nuclear factor kappa-Β ligand (RANKL) (PeproTech, USA, 100ng/ml) and Atsttrin(500ng/ml) for 7 days. The medium was replaced every 2 days.

2.7 Tartrate-resistant acid phosphatase (TRAP) staining

The cells were fixed 4% paraformaldehyde for 20 min.The next, Cells were stained with TRAP Assay Kit (G1492; Beijing Solarbio). All the procedures were performed according to the manufacturer’s instructions. TRAP-positive cells with three or more nuclei were considered osteoclasts.

2.8 Osteoblastogenesis

BMMSCs were isolated by the above methods. Then, the cells were plated in a six-well plate and cultured in DMEM supplemented with 1% penicillin/streptomycin and 10% FBS for 24 h. Then, the cells were then washed with PBS and cultured in osteoblastogenesis medium(basal medium with 10% FBS, 10nM dexamethasone, 5mM β-glycerophosphate, and 50µg/ml ascorbate-2-phosphate) The osteoblastogenesis medium was replaced every 3 days.

2.9 Alkaline phosphatase (ALP) staining

BMMSCs were cultured in osteoblastogenesis medium, supplemented with 10ng/ml TNF-α in the absence or presence of Atsttrin(500ng/ml) for 7 days. Cells were stained with BCIP/NBT Alkaline Phosphatase Color Development Kit (C3206; Beyotime Biotechnology).

2.10 Alkaline phosphatase assay

The samples were lysed using Cell lysis buffer without inhibitors (P0013J; Beyotime Biotechnology), cell lysate was collected and then the protein concentration was detected by BCA assay kit (P0012; Beyotime Biotechnology). The sample were determined using the ALP assay kit (P0321; Beyotime Biotechnology). The absorbance optical density (OD) was measured by using a xMark Microplate Absorbance Spectrophotometer (Bio-Rad) with wavelength at 405 nm.

2.11 Knock down of TNFR1 and TNFR2 by siRNA

RAW264.7 cells or MC3T3-E1 cells were transfected with siTNFR1, siTNFR2, and scrambled control siRNA(scRNAi) using lipofectamine 2000 (11668-019, Invitrogen), according to the instructions. After 24 hours, the culture medium was changed. The efficiency of siRNA transfection was determined by Western blotting. The lysate was collected to detect the expression of mRNA and protein after different treatment.

2.12 CCK8 assay

To examine the effect of Atsttrin(1000ng/ml) on cell proliferation, Cell viability was analyzed by Cell Counting Kit-8 (CCK8, Beyotime, Shanghai, China). All the procedures were performed according to the manufacturer’s instructions.

2.13 Ovariectomy-Induced osteoporosis animal Model

Eight-week-old C57BL/6 mice were anesthetized with 1% sodium pentobarbital and subjected to sham operation or bilateral ovariectomy. Mice were intraperitoneally injected with or without 6µl PBS or 6µl recombinant Atsttrin (1µg/µl) weekly for 8 weeks. Then, the femurs were harvested for analyses.

2.14 Micro-CT scanning

Femur tissues fixed in 70% ethanol overnight and then analyzed by high- resolution low-dose x-ray scanner (SkyScan 1276, Bruker). Scan parameters were set at 6 µm per pixel resolution, 0.124mA current and 70 kV voltage. Further we constructed a three-dimensional models and analyzed bone mineral density (BMD), bone volume/tissue volume (BV/TV), trabecular number (Tb.N), trabecular separation (Tb.Sp), and cortical thickness by CTAn and CTVol.

2.15 Statistical analysis

All data are presented as the mean ± standard deviation. All statistical analyses were analyzed using the GraphPad Prism software (version 7.0; GraphPad Inc., La Jolla, CA, USA). Student’s t-test was used for comparisons between two independent groups, and 1-way or 2-way ANOVA (when appropriate) were performed. Statistical significance at two-sides was indicated when P < 0.05.

3.1 Atsttrin inhibited TNF - α - induced osteoclastogenesis

TNF-α is reported to play an predominate role in osteoclastogenesis[7, 25]. To determine the role of Atsttrin in TNF-α and/or RANKL-mediated osteoclastogenesis, we cultured BMDMs in presence of RANKL and/or TNF-α for 7 days followed by TRAP staining. As indicated in Fig. 1A-B, RANKL effectively induced osteoclast differentiation, while additional use of TNF-α significantly enhanced RANKL-induced osteoclastogenesis. Otherwise, Atsttrin significantly rescued TNF-α- enhanced osteoclast formation. To further confirm this finding, we cultured RAW264.7 cells with RANKL(100ng/ml) in absence or presence of TNF-α (10 ng/mL) or Atsttrin(500ng/ml). As indicated in Fig. 1C. Western bloting analysis indicated TRAP expression was increased in presence of TNF-α, meanwhile, Atsttrin dramatically reduced TNF-α and RANKL-induced osteoclastogenesis. Importantly, as illustrated in Fig. 1D, qualification of the bands indicates Atsttrin significantly reduced TNF-α and RANKL mediated TRAP expression. To further determine the role of Atsttrin in osteoclastogenesis, we cultured Raw264.7 cells as previous described for 8 hours and we extracted mRNA, followed by the real time PCR assay. As shown in Fig. 1E-G. TNF-α significantly upregulated transcriptional level of the expression of Tartrate resistant acid phosphatase (TRAP)、Cathepsin K and Caltonin Receptor. Meanwhile Atsttrin effectively reduced the expression of TNF-α-mediated osteoclastogenesis gene markers.

3.2 Atsttrin inhibited TNF -α- mediated inflammatory catabolism

TNF-α was believed to play an inflammatory catabolic effect in the pathogenesis of osteoporosis[10, 26]. To further determine the antagonistic effect of Atsttrin on TNF-α-mediated inflammatory responses, we cultured RAW264.7 cells with or without TNF-α(10ng/ml) in the absence or presence of Atsttrin(500ng/ml) to examined the expression of downstream inflammatory factors(IL-1β, IL-6,IL-17,COX-2 and iNOS) and as shown in Fig. 2A-K, TNF-α dramatically increased the expression of inflammation factors(IL-1β, IL-6,IL-17,COX-2 and iNOS), while Atsttrin reduced the mRNA and protein expression of these molecules’ expression. To further investigate the involved molecule mechanism, we cultured RAW264.7 cells with or without TNF-α(10ng/ml) in the absence or presence of Atsttrin(500ng/ml) for various time points. As demonstrated in Fig. 2L-P, TNF-α effectively phosphorylated p38, JNK, IκBα and p65 in time dependent manner. However, Atsttrin significantly inhabited TNF-α-induced phosphorylation of p38, JNK, p65 and the degradation of IκBα. To further investigate whether Atsttrin inhibited TNF-α-induced p65 translocation, RAW264.7 cells were cultured with TNF-α (10 ng/mL) in the absence or presence of Atsttrin (500ng/ml) for various time points. Nuclear extraction (NE) and cytoplasmic extraction (CE) were examined by Western blotting. As shown in Fig. 2Q-S, the total expression of P65 in cytoplasm was decreased while that of P65 in nuclear was increased with time going by in presence of TNF-α. Collectively, Atsttrin effectively inhibited TNF-α-mediated inflammatory catabolism through TNF-α/NF-κB signaling pathway.

3.3 Atsttrin inhibited TNF-α- induced osteoclastogenesis via TNFR1.

TNF-α exhibited its role through TNF-α receptors, including TNFR1 and TNFR2[27]. TNFR1 is reported to promoted inflammatory effect and TNFR2 is reported to play protective effect[20]. We next sought to determine whether Atsttrin mediated effect through TNFR1 or TNFR2. We thus suppressed the expression of TNFR1 using its specific siRNAs in RAW264.7 cells, and as indicated in Fig. 3A&C, we found TNFR1 RNAi dramatically inhabited TNFR1 expression. In addition, we found after knock down TNFR1 in RAW264.7 cells, TNF-α-mediated TRAP expression was dramatically reduced (Fig. 3B&D). Importantly, Atsttrin mediated inhibition of TRAP expression was also almost abolished (Fig. 3B&D). Moreover, as revealed in Fig. 3E&F, TRAP staining showed a significant reduction of osteoclast formation after knock down of TNFR1. To investigate the involved mechanisms, Real-time PCR assay was taken. As revealed in Fig. 3G-I, after the blockage of TNFR1, Atsttrin-mediated inhibition of TNF-α’s effect was almost abolished. These findings indicated Atsttrin mediated anti-osteoclastogenesis primarily through TNFR1 signaling.

3.4 Atsttrin rescues TNF-α-mediated inhibition of osteoblastogenesis though TNFR1.

TNF-α was believed to significantly inhibit osteoblastogenesis[28]. Therefore, to investigate whether Atsttrin rescue TNF-α-mediated inhibition of osteoblastogenesis, BMMSCs were cultured in prescence of osteoblastogenesis medium with or without TNF-α (10 ng/mL) in absence or presence of Atsttrin(500ng/ml) for 7 days, followed by ALP staining. As revealed in Fig. 4A-B, TNF-α effectively inhibited osteoblast formation, while Atsttrin significantly rescued this pathogenesis. In addition, to determine the protein level change, total protein was extracted, and followed by Western blotting analysis. As shown in Fig. 4C-D, RUNX-2 expression was significantly reduced in presence of TNF-α, while Atsttrin effectively attenuated this process. To investigate the involved transcriptional change, we next cultured MC3T3-E1 cells with 10 ng/mL TNF-α with or without Atsttrin for 8 hours. Total mRNA was extracted, and Real time PCR assay was performed. As illustrated in Fig. 4E-G, Atsttrin alleviated TNF-α-mediated down-regulation of the bone formation markers, including ALP、RUNX2 and Col-1. To further investigate the involved molecule mechanism, MC3T3-E1 cells were cultured in the absence or presence of 10 ng/ml TNFα with or without 500 ng/ml Atsttrin for different time points. Western blot analysis indicated that Atsttrin downgraded TNFα-activated signaling pathways(Fig. 4H-K).Collectively, these results indicated that Atsttrin rescued TNF-α-mediated inbibition of osteoblast formation.

Given the importance of TNFRs signaling as well as the nature of Atsttrin as the binding protein of TNFRs, we next determined whether Atsttrin exhibited this protective effect though TNFRs pathway. To address this issue, we thus suppressed the expression of TNFR1 using its specific siRNAs in MC3T3-E1 cells (Fig. 5A). As illustrated in Fig. 5B, TNF-α dramatically reduced the expression of RUNX2, however, the expression of RUNX2 was back after blocking TNFR1. Consequently, as shown in Fig. 5C-D, cell alkaline phosphatase (ALP) staining of osteoblast indicated osteoblast formation was reduced in presence of TNF-α. However, knockdown of TNFR1 remarkably reversed TNF-α-inhibited osteoblast formation. Importantly, additional use of Atsttrin even slightly enhanced the osteoblastogenesis after TNFR1 blockage. To further examine the gene markers expression, we cultured cells for 8 hours and collected total mRNA. As demonstrated in Fig. 6E-G, the transcriptional level of ALP、RUNX2 and Col-1 was down-regulated in presence of TNF-α. However, this phenomenon was reversed when TNFR1 was knockdown. Thus, these findings indicated that Atsttrin exhibited protective effect by inhibiting TNF-α-mediated prohibition of osteoblastogenesis primarily through TNFR1 pathway.

3.5 Atsttrin enhances osteoblastogenesis through TNFR2.

Given the importance of osteoblast in osteoporosis, we next determined whether Atsttrin has anabolic effect in osteoblastogenesis. Present study found Atsttrin alone active Erk1/2 or Akt signaling weakly (Fig. S1 B). Consequently, the bone formation protein and transcriptional expression of ALP、 RUNX2 and Col-1 was not altered in the presence of Atsttrin (Fig.S1 C-F). In addition, to examine whether Atsttrin and osteoblastogenesis medium, has a synthetize effect in osteoblast formation, MC3T3-E1 cells were cultured in the presence of osteoblastogenesis medium, with or without 500 ng/mL Atsttrin. As shown in Fig. 6A, Atsttrin significantly enhanced osteoblastogenesis in the presence of osteoblastogenesis medium. In addition, alkaline phosphatase (ALP) staining indicated more osteoblast formation was observed in the presence of Atsttrin (Fig. 6B). Real-time PCR was carried out, which showed that Atsttrin treatment enhanced the transcriptional expression of bone formation markers, including ALP、RUNX2 and Col-1(Fig. 6C-E). Importantly, ALP activity demonstrated Atsttrin not only enhanced osteoblostogenesis, but also enhanced activity of osteoblast (Fig. 6F).

To determine whether the Atsttrin-mediated enhancement in osteoblastogenesis is dependent upon TNFR1 or TNFR2, or both receptors, we thus suppressed the expression of TNFR2 using its specific siRNAs in MC3T3-E1 cells (Fig. 6G). MC3T3-E1 cells were collected from different experimental groups, Western blot to detect RUNX2(Fig. 6H), real-time PCR to detect ALP、RUNX2、Col-1(Fig. 6J-L), In addition, alkaline phosphatase (ALP) staining to detect the expression of ALP (Fig. 6I). We found that, suppression of TNFR2 lead to almost abolishment of the Atsttrin-enhanced osteoblastogenesis.

3.6 Atsttrin-mediated enhancement of osteoblastogenesis primarily depends on TNFR2-Akt-Erk1/2 signaling.

Atsttrin is known to selectively binds to TNFRs and that the Atsttrin-mediated beneficial effect in osteoblastogenesis depends on TNFR2. We next sought to explore the molecular mechanisms. Previous study indicated Atsttrin activated Akt and Erk1/2 signaling in chondrocytes[19, 20], interestingly, present study demonstrated Atsttrin strongly enhanced the activation of Akt signaling and Erk1/2 signaling in osteoblostogenesis medium (Fig. 7A-C& Fig.S1 A).

To further determine whether Atsttrin-mediated enhancement rely on Akt and/or Erk1/2 signaling, MC3T3-E1 cells were cultured with osteoblastogenesis medium, in the absence or presence Atsttrin(1000ng/ml) with or without PI3K/Akt-signaling inhibition using 1µM Wortmannin or Erk1/2 signaling inhibition using 1µM U0126 for 8hours, followed by Real-time PCR assay. As indicated in Fig. 7D-I, Atsttrin’s positive effect was partially lost after blocking Akt signaling alone using Wortmannin or blocking the Erk1/2 signaling pathway alone using Wortmannin. Furthermore, by applying both Akt and Erk1/2 signaling inhibitors together, as shown in Fig. 7J-L, we found that Atsttrin-mediated positive effect in osteoblastogenesis was almost abolished. Collectively, Atsttrin-mediated enhancement of osteoblastogenesis depended on TNFR2/Akt and Erk1/2 pathway.

3.7 Atsttrin attenuates bone loss in Ovariectomy-Induced mouse

The above study in vitro experiments confirmed the role of Atsttrin in osteoclastogenesis and osteoblastogenesis. To investigate whether Atsttrin could prevent the accelerated bone loss in Ovariectomy-Induced mouse. Mouse received an intraperitoneal injection of Atsttrin or PBS weekly for 8 weeks after OVX surgery. As shown in Fig. 8A-D, the quantitative analysis points out that Atsttrin effectively protected against bone loss after OVX surgery. Specifically, it manifests as an increase in BMD, Tb.N, and BV/TV. In addition, as shown in Fig. 8E-F, the application of recombinant Atsttrin also significantly reduced the levels of bone catabolism indicators(TRAP and CTSK) in peripheral blood serum as assayed by ELISA. Together, these studies indicate that Atsttrin is a therapeutic candidate for reducing bone loss in Ovariectomy-Induced mouse.

Osteoporosis is a common degenerative disease in clinics, but the underlying mechanisms involved remain unclear[29]. Under physiological conditions, bone metabolism is maintained through a delicate balance between bone formation and bone resorption. Nevertheless, this balance is disrupted in osteoporosis[30, 31]. Previous reports have shown that inflammation plays an important role in the development of osteoporosis[32, 33]. TNF-α is located at the top of the inflammatory cascade, plays an important role in the occurrence of osteoporosis[9]. TNF-α can lead to decreased activity of osteoblasts and increased number and activity of osteoclasts, resulting in bone loss[6, 25].

In osteoarthritis, inflammatory bowel disease, and psoriasis, PGRN can effectively inhibit the inflammatory signaling pathway mediated by TNF-α and reduce the expression of downstream inflammatory factors, thus inhibiting the inflammatory response mediated by TNF-α[34, 35]. In TNF-α transgenic mice, TNF-α over-expression resulted in significant bone loss, which was significantly reduced by the application of exogenous PGRN[36]. Moreover, PGRN can mediate bone formation induced by BMP-2[36, 37]. Further studies have shown that PGRN can promote fracture healing under physiological conditions[5, 38]. It was hypothesized that Atsttrin as an engineered protein derived from PGRN, would regulate bone metabolism balance through a mechanism highly similar to that of PGRN. In the current study, BMDMs were treated with receptor activator of nuclear factor kappa-Β ligand (RANKL) (100 ng/mL) for 7days to induce osteoclast differentiation. We found that TNF-α can enhance the activity of osteoclasts and promote the proliferation of osteoclasts, while Atsttrin attenuated this progress. Furthermore, we established a TNF-α-induced inflammatory response model of RAW264.7 cells to explore the role of Atsttrin in inhibiting osteoclastogenesis and to investigate the mechanism of this effect, and found that Atsttrin effectively prevented TNF-α-mediated inflammatory catabolism signaling pathway, evidenced by the expression levels of IL-1β, IL-6,IL-17,COX-2 and iNOS were significantly suppressed and reduced serum level of IL-17、IL-1β and IL-6 fragments. Moreover, TNF-α is involved in osteoclastogenesis mainly through activation of NF-κB、p38 and JNK signaling pathway. The levels of p-P38、p-PJNK and p-P65 were significantly reduced by Atsttrin treatment. In addition, the NF-κB signaling pathway plays a critical role in TNF-α function. Nuclear translocation of p65 can be inhibited after treatment with Atsttrin.

TNF-α plays an important role in the pathogenesis of osteoporosis and is a major inflammatory factor. There are two binding sites of TNF - α on the cell surface, TNF receptor-1 and TNF receptor-2[16]. The interaction between TNF-α and TNFR1 mediates inflammatory signaling[19, 20]. TNF-α induces the expression of molecules associated with inflammation in osteoclast precursors, includingIL-1β, IL-6,IL-17,COX-2 and iNOS, through binding to its receptors TNFR1. We also assessed the expression of biomarkers in TNF-α -induced osteoclastgenesis. In addition, TNF-αinhibits osteoblast precursor differentiation through TNFR1. While the additional use of Atsttrin to blocking TNFR1 prominently repressed this process. Previous reports demonstrate that TNFR2 mediates protective signaling[39, 40]. We found that Atsttrin can enhance osteoblastogenesis through binding to TNFR2. Therefore, during the progression of osteoporosis, we found that Atsttrin exhibited its effect through both inhibiting TNFα/TNFR1-mediated inflammation and activating anabolic TNFR2 pathways.

We found that Erk1/2 and Akt signaling are involved in osteoblastogenesis. In detail, in the presence of osteoblastogenesis medium, Atsttrin strongly activates Akt/Erk1/2 signaling. However, in normal media, Atsttrin can activate the Akt/Erk1/2 signaling pathways weakly. Furthermore, Atsttrin completely lost its effect when using specific inhibitors of Akt and Erk1/2 signaling. Consequently, we found that the Atsttrin-mediated anabolic effect in osteoblastogenesis depends on TNFR2-Akt/Erk1/2 signaling.

Ovariectomy-Induced mouse model is a well-accepted research method to study the pathogenesis of osteoporosis in vivo[41, 42]. Our finding that intraperitoneal injection of recombinant Atsttrin could dramatically prevent bone loss in VOX model. In the current study, we confirmed the role of Atsttrin in osteoclastogenesis and osteoblastogenesis. Although Atsttrin is derived from PGRN, whether PGRN can prevent osteoporosis has not been reported, which needs further investigation.

Above all, Atsttrin exerts its effect in enhancing osteoblastogeneis and inhibiting osteoclastogenesis under inflammatory condition through at least 3 pathways: a) Atsttrin directly binding to TNFR1, inhibited TNF-α-induced osteoclastogenesis; b) Atsttrin competitively binding to TNFR1, rescued TNF-α-mediated inhibition of osteoblastogenesis; c) Atsttrin synthesized with osteoblastogenesis medium, enhanced osteoblast formation and activity via TNFR2-Akt/Erk1/2 signaling (Fig. 8G). It provides new ideas for research on the mechanism of osteoblast-osteoclast regulation under inflammatory condition and provides potential therapeutic target for clinical treatment.

TNF-α: tumor necrosis factor-α; TNFR: tumor necrosis factor receptors; PGRN: progranulin; RANKL: Receptor Activator for Nuclear Factor-κB Ligand; TRAP: tartrate resistant acid phosphatase; CTSK: Cathepsin K; CTR: Calcitonin Receptor; ALP:Alkaline phosphatase; IL-6: Interleukin-6; IL-1β: Interleukin-1β; IL-17: Interleukin-17; COX-2: Cyclooxygenase-2; iNOS: Inducible nitric oxide synthase; OVX: ovariectomy; NE: Nuclear extraction; CE: cytoplasmic extraction; M-CSF: Macrophage Colony-Stimulating Factor; scRNAi: scrambled control siRNA; BMP-2: Bone morphogenetic protein-2; BMDMs: Bone marrow-derived macrophages; BMMSCs: Bone marrow mesenchymal stem cells

Availability of data and materials

The datasets used and/or analyzed of this study are available from authors on reasonable request.

Ethics Approval

This study was approved by medical ethics regulations of the Medical Ethical Committee of Qilu Hospital of Shandong University.

Conflicts of interest

The authors declare no competing financial interests.

Author’s contributions

J.W. and L.C. designed the experiments; K. L. acquired the data, J.L., W.Z., F.Q. and Z.W. performed the statistical analyses; Q.H. analyzed and interpreted the data; J.S. and Q.M.maintained the mice; J.W. and K.L. edited the manuscript. All authors drafted and reviewed the manuscript.

Funding

This work was supported partly by the National Key Research and Development Program of China (2020YFC2009004),the National Natural Science Foundation of China (81900804),the Natural Science Foundation of Shandong Province (ZR2019BH071)and (2019GSF108029),Shandong University Qilu Hospital Clinical Practical New Technology Fund (2019-8), and China Postdoctoral Science Foundation Grant (2019M651064).

Eastell, R., et al., Postmenopausal osteoporosis. Nat Rev Dis Primers, 2016. 2: p. 16069.
Hong, G., et al., A novel RANKL-targeted flavonoid glycoside prevents osteoporosis through inhibiting NFATc1 and reactive oxygen species. Clin Transl Med, 2021. 11(5): p. e392.
Fischer, V. and M. Haffner-Luntzer, Interaction between bone and immune cells: Implications for postmenopausal osteoporosis. Semin Cell Dev Biol, 2021.
Tang, W., et al., The growth factor progranulin binds to TNF receptors and is therapeutic against inflammatory arthritis in mice. Science, 2011. 332(6028): p. 478-84.
Wei, J., et al., Progranulin promotes diabetic fracture healing in mice with type 1 diabetes. Ann N Y Acad Sci, 2020. 1460(1): p. 43-56.
Liu, Z., et al., CircHmbox1 Targeting miRNA-1247-5p Is Involved in the Regulation of Bone Metabolism by TNF-alpha in Postmenopausal Osteoporosis. Front Cell Dev Biol, 2020. 8: p. 594785.
Marahleh, A., et al., TNF-alpha Directly Enhances Osteocyte RANKL Expression and Promotes Osteoclast Formation. Front Immunol, 2019. 10: p. 2925.
Yu, M., et al., Ovariectomy induces bone loss via microbial-dependent trafficking of intestinal TNF+ T cells and Th17 cells. J Clin Invest, 2021. 131(4).
Osta, B., G. Benedetti, and P. Miossec, Classical and Paradoxical Effects of TNF-alpha on Bone Homeostasis. Front Immunol, 2014. 5: p. 48.
Zhao, B., TNF and Bone Remodeling. Curr Osteoporos Rep, 2017. 15(3): p. 126-134.
Cui, Y., A. Hettinghouse, and C.J. Liu, Progranulin: A conductor of receptors orchestra, a chaperone of lysosomal enzymes and a therapeutic target for multiple diseases. Cytokine Growth Factor Rev, 2019. 45: p. 53-64.
Wang, S., et al., Progranulin Is Positively Associated with Intervertebral Disc Degeneration by Interaction with IL-10 and IL-17 Through TNF Pathways. Inflammation, 2018. 41(5): p. 1852-1863.
Jian, J., et al., Progranulin Recruits HSP70 to beta-Glucocerebrosidase and Is Therapeutic Against Gaucher Disease. EBioMedicine, 2016. 13: p. 212-224.
Wei, J., A. Hettinghouse, and C. Liu, The role of progranulin in arthritis. Ann N Y Acad Sci, 2016. 1383(1): p. 5-20.
Zhao, Y.P., et al., Progranulin suppresses titanium particle induced inflammatory osteolysis by targeting TNFalpha signaling. Sci Rep, 2016. 6: p. 20909.
Williams, A., et al., Review: Novel Insights Into Tumor Necrosis Factor Receptor, Death Receptor 3, and Progranulin Pathways in Arthritis and Bone Remodeling. Arthritis Rheumatol, 2016. 68(12): p. 2845-2856.
Wang, Q., et al., 3D-Printed Atsttrin-Incorporated Alginate/Hydroxyapatite Scaffold Promotes Bone Defect Regeneration with TNF/TNFR Signaling Involvement. Adv Healthc Mater, 2015. 4(11): p. 1701-8.
Xia, Q., et al., Intra-articular transplantation of atsttrin-transduced mesenchymal stem cells ameliorate osteoarthritis development. Stem Cells Transl Med, 2015. 4(5): p. 523-31.
Wei, J., et al., Atsttrin Promotes Cartilage Repair Primarily Through TNFR2-Akt Pathway. Front Cell Dev Biol, 2020. 8: p. 577572.
Wei, J.L., et al., Progranulin derivative Atsttrin protects against early osteoarthritis in mouse and rat models. Arthritis Res Ther, 2017. 19(1): p. 280.
Edgar, L., et al., Hyperglycemia Induces Trained Immunity in Macrophages and Their Precursors and Promotes Atherosclerosis. Circulation, 2021. 144(12): p. 961-982.
Wei, J.L., et al., Role of ADAMTS-12 in Protecting Against Inflammatory Arthritis in Mice By Interacting With and Inactivating Proinflammatory Connective Tissue Growth Factor. Arthritis Rheumatol, 2018. 70(11): p. 1745-1756.
Zhao, Y., et al., Cortistatin protects against intervertebral disc degeneration through targeting mitochondrial ROS-dependent NLRP3 inflammasome activation. Theranostics, 2020. 10(15): p. 7015-7033.
Liu, R., et al., Fexofenadine inhibits TNF signaling through targeting to cytosolic phospholipase A2 and is therapeutic against inflammatory arthritis. Ann Rheum Dis, 2019. 78(11): p. 1524-1535.
Zha, L., et al., TNF-alpha contributes to postmenopausal osteoporosis by synergistically promoting RANKL-induced osteoclast formation. Biomed Pharmacother, 2018. 102: p. 369-374.
Kawai, V.K., et al., Effects of anti-tumor necrosis factor alpha agents on bone. Curr Opin Rheumatol, 2012. 24(5): p. 576-85.
Zhao, Y., et al., Cortistatin binds to TNF-alpha receptors and protects against osteoarthritis. EBioMedicine, 2019. 41: p. 556-570.
Yang, B., et al., YAP1 inhibits the induction of TNF-alpha-stimulated bone-resorbing mediators by suppressing the NF-kappaB signaling pathway in MC3T3-E1 cells. J Cell Physiol, 2020. 235(5): p. 4698-4708.
Awasthi, H., et al., The underlying pathophysiology and therapeutic approaches for osteoporosis. Med Res Rev, 2018. 38(6): p. 2024-2057.
Foger-Samwald, U., et al., Osteoporosis: Pathophysiology and therapeutic options. EXCLI J, 2020. 19: p. 1017-1037.
Gkastaris, K., et al., Obesity, osteoporosis and bone metabolism. J Musculoskelet Neuronal Interact, 2020. 20(3): p. 372-381.
Qian, H., et al., A monoclonal antibody ameliorates local inflammation and osteoporosis by targeting TNF-alpha and RANKL. Int Immunopharmacol, 2014. 20(2): p. 370-6.
Rao, S.S., et al., Omentin-1 prevents inflammation-induced osteoporosis by downregulating the pro-inflammatory cytokines. Bone Res, 2018. 6: p. 9.
Jian, J., et al., Progranulin: A key player in autoimmune diseases. Cytokine, 2018. 101: p. 48-55.
Tian, Q., et al., Three TNFR-binding domains of PGRN act independently in inhibition of TNF-alpha binding and activity. Front Biosci (Landmark Ed), 2014. 19: p. 1176-85.
Zhao, Y.P., et al., The promotion of bone healing by progranulin, a downstream molecule of BMP-2, through interacting with TNF/TNFR signaling. Biomaterials, 2013. 34(27): p. 6412-21.
Feng, J.Q., et al., Granulin epithelin precursor: a bone morphogenic protein 2-inducible growth factor that activates Erk1/2 signaling and JunB transcription factor in chondrogenesis. FASEB J, 2010. 24(6): p. 1879-92.
Ding, Y., et al., Progranulin promotes bone fracture healing via TNFR pathways in mice with type 2 diabetes mellitus. Ann N Y Acad Sci, 2021. 1490(1): p. 77-89.
Liu, C., et al., Progranulin-derived Atsttrin directly binds to TNFRSF25 (DR3) and inhibits TNF-like ligand 1A (TL1A) activity. PLoS One, 2014. 9(3): p. e92743.
Zhao, Y.P., et al., Progranulin protects against osteoarthritis through interacting with TNF-alpha and beta-Catenin signalling. Ann Rheum Dis, 2015. 74(12): p. 2244-2253.
Li, X., et al., Targeting actin-bundling protein L-plastin as an anabolic therapy for bone loss. Sci Adv, 2020. 6(47).
Hu, Y., et al., RANKL from bone marrow adipose lineage cells promotes osteoclast formation and bone loss. EMBO Rep, 2021. 22(7): p. e52481.

Table.1 Primers used for quantitative real-time PCR

Target	Forward primers, 5′–3′	Reverse primers, 5′–3′
TRAP	AGCAGCCAAGGAGGACTAC	CATAGCCCACACCGTTCTC
Cathepsin K	AGCTTCCCCAAGATGTGAT	AGCACCAACGAGAGGAGAA
Caltonin Receptor	CTCCTTGTCGATTGCTGCT	TCACCCTCTGGCAGCTAAG
IL-6	GCCTTCTTGGGACTGATGCT	GCCATTGCACAACTCTTTTCTCA
IL-1β	GTGTCTTTCCCGTGGACCTT	AATGGGAACGTCACACACCA
COX-2	GCATTCTTTGCCCAGCACTT	ACCTCTCCACCAATGACCTGA
ALP	CATCGCCTATCAGCTAATGCACA	ATGAGGTCCAGGCCATCCAG
Col-1	GACATGTTCAGCTTTGTGGACCTC	AGGGACCCTTAGGCCATTGTGTA
RUNX2	TCTGACAAAGCCTTCATGTCC	AAATAGTGATACCGTAGATGCG
β-action	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
scRNAi	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
TNFR1 RNAi1	CCGCUUGCAAAUGUCACAATT	UUGUGACAUUUGCAAGCGGTT
TNFR1 RNAi2	CCGAAGUCUACUCCAUCAUTT	AUGAUGGAGUAGACUUCGGTT
TNFR1 RNAi3	GGAGAUCUCUCCUUGCCAATT	UUGGCAAGGAGAGAUCUCCTT
TNFR2 RNAi1	CUGGCCAAUAUGUGAAACATT	UGUUUCACAUAUUGGCCAGTT
TNFR2 RNAi2	CUGGCUGGUUUGAUCAGAUTT	AUCUGAUCAAACCAGCCAGTT
TNFR2 RNAi3	CCAAACUCCAAGCAUCCUUTT	AAGGAUGCUUGGAGUUUGGTT

There is NO Competing Interest.

3.Supplementarydata.pdf

Download PDF

Journal Publication

published 11 Dec, 2023

Read the published version in Communications Biology →

Version 1

posted

You are reading this latest preprint version

Atsttrin Regulates Osteoblastogenesis and Osteoclastogenesis through TNFR Pathway

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Media, reagents and animals

2.2 Cell culture and treatment

2.3 Real-time reverse transcriptase-polymerase chain reaction (RT-PCR)

2.4 Western blotting

2.5 Enzyme-linked immunosorbent assay

2.6 Osteoclastogenesis

2.7 Tartrate-resistant acid phosphatase (TRAP) staining

2.8 Osteoblastogenesis

2.9 Alkaline phosphatase (ALP) staining

2.10 Alkaline phosphatase assay

3. Results

3.1 Atsttrin inhibited TNF - α - induced osteoclastogenesis

3.2 Atsttrin inhibited TNF -α- mediated inflammatory catabolism

3.3 Atsttrin inhibited TNF-α- induced osteoclastogenesis via TNFR1.

3.4 Atsttrin rescues TNF-α-mediated inhibition of osteoblastogenesis though TNFR1.

3.5 Atsttrin enhances osteoblastogenesis through TNFR2.

3.6 Atsttrin-mediated enhancement of osteoblastogenesis primarily depends on TNFR2-Akt-Erk1/2 signaling.

3.7 Atsttrin attenuates bone loss in Ovariectomy-Induced mouse

4. Discussion

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1