25-Hydroxycholesterol and 27-hydroxycholesterol induce neuroinflammation by activating microglia

doi:10.21203/rs.3.rs-2567512/v1

Download PDF

Research Article

25-Hydroxycholesterol and 27-hydroxycholesterol induce neuroinflammation by activating microglia

https://doi.org/10.21203/rs.3.rs-2567512/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Interleukin-1β (IL-1β) levels and side-chain oxygenated cholesterol molecules (oxysterols) are elevated in the brains of patients with Alzheimer’s disease (AD), and high cholesterol levels increase the risk of AD. However, roles of high cholesterol and side-chain oxysterols in IL-1β expression remain to be determined. Therefore, we investigated whether side-chain oxysterols such as 24s-hydroxycholesterol (24sOHChol), 25-hydroxycholsterol (25OHChol), and 27-hydroxycholesterol (27OHChol) along with cholesterol are involved in IL-1β expression. Treatment of microglial HMC3 cells with 25OHChol and 27OHChol induced IL-1β expression at both the transcript and protein levels. 25OHChol and 27OHChol also upregulated the surface expression of MHC class II (MHC II), a marker of activated microglia. In contrast, cholesterol and 24sOHChol did not increase IL-1β transcript levels or MHC II surface expression. 25OHChol and 27OHChol more potently increased IL-1β transcript levels than oligomeric amyloid beta. Polymyxin B impaired IL-1β expression induced by lipopolysaccharides, but not by 25OHChol and 27OHChol. Both oxysterols enhanced the phosphorylation of Akt, ERK, and Src, and inhibition of the kinase pathways by LY294002 (a PI3K inhibitor), U0126 (a MEK inhibitor), and PP2 (an Src kinase inhibitor) impaired the expression of IL-1β and MHC II. We also investigated microglial activation under condition of hypercholesterolemia which enhances oxysterol concentration. Immunohistochemistry revealed increased microglial expression of IL-1β and MHC II, as determined by their co-immunoreactivity with Iba-1, in apolipoprotein E-deficient mice. These results indicate that 25OHChol and 27OHChol activate the microglia to secrete IL-1β and the activation requires multiple signaling pathways. Because IL-1β is a key cytokine that drives inflammation in the brain, we suggest that elevated levels of 25OHChol and 27OHChol function as immunosterols, inducing neuroinflammation in patients with AD, and thereby are involved in the development of neurodegenerative diseases.

Alzheimer’s disease

interleukin-1β

microglia

oxysterol

neuroinflammation

Cholesterol is susceptible to oxidation; it undergoes enzymatic oxidation or autoxidation upon exposure to oxidizing agents, leading to the formation of oxysterols [1]. The brain is the most cholesterol-rich organ, and the oxysterol profiles of the brains of patients with Alzheimer’s disease (AD) differ from those of normal brains [2]. In the normal brain, the most abundant oxysterol is 24s-hydroxycholesterol (24sOHChol), followed by 25-hydroxycholesterol (25OHChol) and 27-hydroxycholesterol (27OHChol). In the brains of AD patients, levels of most oxysterols such as 25OHChol, 27OHChol, 7-ketocholesterol (7 K), 7α-hydroxycholesterol (7αOHChol), and 7β-hydroxycholesterol (7βOHChol) increase, while 24sOHChol decreases [3, 4]. In addition, inflammatory factors such as interleukin-1 β (IL-1β), monocyte chemotactic protein (MCP)-1, and matrix metalloprotease (MMP)-9 are also significantly increased in the brains of AD patients [3, 4]. Certain side-chain oxysterols, such as 25OHchol and 27OHChol, are classified as immunosterols involved in inflammatory immune responses because they activate immune cells and enhance the production of immune mediators, thereby amplifying inflammation [5–7]. However, it is unknown whether side-chain oxysterols activate microglia, which are the resident immune cells in the brain.

Microglia act as the first and main form of active immune defense in the central nervous system (CNS). They are activated and upregulate the corresponding receptors in response to noxious stimuli, thereby mounting inflammatory responses [8, 9]. Activated microglia secrete inflammatory cytokines at the site of inflammation, including IL-1β, and express increased levels of MHC class II (MHC II) molecules, in addition to changing morphology [10]. IL-1β is an endogenous pyrogen with multiple functions [11]. In addition to neuroinflammation, IL-1β is involved in cellular events, such as proliferation, differentiation, and apoptosis [12]. MHC II, on which antigenic peptides are present, is found on antigen-presenting cells, including dendritic cells and macrophages, and is important for initiating immune responses [13]. Because the activation of microglia in the brain is a prominent feature of AD, identifying endogenous stimuli involved in microglial activation is important for understanding the pathophysiology and etiology of AD.

Because high cholesterol is a non-genetic factor linked to AD [14], we investigated the correlation between high cholesterol levels and microglial activation by examining the expression of IL-1β and MHC II in ApoE-deficient mice. We also identified oxysterol molecules that activate microglia and attempted to determine the signaling pathways involved in oxysterol-mediated activation of microglia. In this study, we report data suggesting that immunosterols formed in a cholesterol-rich milieu play a fundamental role in neuroinflammation.

Cell culture and reagents

The human microglial clone 3 cell line (HMC3) was purchased from the American Type Culture Collection (ATCC, Manassas, VA 20108, USA). HMC3 microglia were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) in the presence of penicillin and streptomycin. Cholesterol was purchased from Sigma-Aldrich (St. Louis, MO, USA) and 24sOHChol, 25OHChol, and 27OHChol were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The human β-amyloid peptide (1–42) (Aβ₁₋₄₂) was purchased from Abcam (Cambridge, UK). Primary antibodies against MHC II and the phosphorylated and unphosphorylated forms of ERK were purchased from Santa Cruz Biotechnology. Antibodies against the phosphorylated and unphosphorylated forms of Akt (Ser473) and Src (Tyr416) were purchased from Cell Signaling Technology (Danvers, MA, USA).

Reverse transcriptase and real-time polymerase chain reaction (RT and real-time PCR)

Total RNA was reverse transcribed at 42°C for 1 h using 100 U Moloney Murine Leukemia Virus (MMLV) reverse transcriptase in a 10-µL reaction volume containing 50 mM Tris-HCl (pH 8.3 at 25°C, 55 mM KCl, 3 mM MgCl₂, 10 mM DTT, 1 µg oligo dT 15 primers, 0.125 mM each dNTP, and 40 U RNase inhibitor. The cDNA was amplified for 27 cycles at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. PCR products were visualized on an EtBr-containing agarose gel. Quantitative real-time PCR was performed as previously described [15]. Briefly, IL-1β gene transcripts were assessed by real-time PCR using a LightCycler® 96 Real-Time PCR System (Roche, Germany). Real-time quantitative PCR was performed in triplicate; each 20 µl reaction consisted of 10 µl of SYBR Green Master Mix, 2 µl of forward and reverse primers (10 pM each) of genes to be analyzed, and a cDNA template. Thermal cycling conditions were as follows: 95°C for 10 min, and 45 cycles at 95°C for 10 s, 50°C for 10 s, and an elongation period of 10 s at 72°C. The primer sequences for real-time PCR were IL1β:5-'TGAGCTCGCCAGTGAAATGA-3' (forward) and 5'AGATTCGTAGCTGGATGCCG3' (reverse); GAPDH:5′-ATGGGGAAGGTGAAGGTCG-3' (forward) and 5′-GGGGTCATTGATGGCAACAATA-3' (reverse). The relative expression of each gene was then calculated as a ratio to GAPDH using LightCycler 96 software (Version 1.1.0.1320).

Western blot analysis

HMC3 microglia were lysed using Pro-Prep™ lysis buffer (Intron Biotechnology, Sungnam, Korea). Equal amounts of protein from each sample were separated by SDS-PAGE and transferred onto a nitrocellulose membrane. After blocking non-specific binding of the primary antibody with 5% skim milk in 0.1% Tween 20/TBS, the membrane was probed with indicated primary antibodies at 4°C overnight. After washing thrice with 0.1% Tween 20/TBS for 15 min each, the membranes were incubated with HRP-conjugated secondary antibodies for an hour at room temperature. After washing three times with washing buffer for 15 min each, bands were detected with a PIERCE® enhanced chemiluminescence western blotting detection system (Thermo Scientific, IL, USA). Chemiluminescent images were captured using an Amersham Imager 600 (GE Healthcare Life Sciences, Pittsburgh, PA, USA).

Enzyme-linked immunosorbent assay

The levels of IL-1β secreted into the culture medium were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit (BD OptEIA™ Human IL-1β ELISA Kit II) according to the manufacturer’s instructions (BD Biosciences, San Diego, CA, USA).

Immunofluorescence of MHC II

HMC3 cells were cultured on coverslips coated with gelatin (0.2% gelatin in PBS) and stimulated with cholesterol or oxysterols for 48 h. Cells were fixed with 1% paraformaldehyde for 20 min and incubated with blocking solution of 5% skim milk in PBS for 1 h. After incubation for 2 h with primary antibody against MHC II diluted in blocking solution (1:100) at room temperature, cells were washed twice for 5 min each with PBS. Following incubation for 1 h with fluorescence-conjugated secondary antibodies diluted in PBS (1:200) at room temperature in the dark, the cells were washed with PBS. Cells stained with fluorescence were mounted and visualized using a confocal microscope (FV1000; Olympus Corp., Tokyo, Japan).

Murine brain tissue immunofluorescence staining

Animal experiment protocols were approved by the Institutional Animal Care and Use Committee of the School of Medicine, Pusan National University, and were performed in accordance with the Korean Food and Drug Administration (KFDA) guidelines. ApoE-deficient mice (8-week-old, female) were fed a high-fat diet (HFD) rich in cholesterol (7.5% cocoa butter and 1.25% cholesterol) for 8 weeks, as previously described [6]. After 8 weeks of feeding, the mice were euthanized by inhalation of carbon dioxide. Whole brains were immediately isolated from the murine skulls, fixed in 4% paraformaldehyde for 48 h at 4°C, and transferred to 30% sucrose solution. The brains were then cut into 10-µm sections using a cryostat microtome (Leica CM 1850; Leica Microsystems, Seoul, Korea). The sections were biotinylated with anti-IL-1β, MHC II (Invitrogen, #14-5321-82) and Iba-1 (Wako, # 019-19741) antibodies (1:100) overnight incubation at 4°C. After incubation with the primary antibodies, the brain sections were washed three times in PBS for 10 min each. After washing, the brain sections were incubated for 1–2 h at room temperature with an anti-rat secondary antibody conjugated to Alexa Fluor 488 nm and anti-rabbit secondary antibody conjugated to Alexa Fluor 568 nm (Invitrogen-Molecular Probes). After washing twice in PBS for 10 min each, followed by in distilled water for 10 min, sections were mounted with VectaShield™ mounting media with DAPI and incubated overnight at 4°C without light. Immunofluorescence images were acquired using a K1-Fluo laser scanning confocal microscope (Nanoscope Systems).

Statistical analysis

Statistical analyses were performed using one-way ANOVA, followed by Dunnett’s multiple comparison test, using GraphPad PRISM (version 5.0; GraphPad Software Inc., CA, USA).

Upregulation of IL-1β in microglia following treatment with 25OHChol and 27OHChol

To determine which molecules are involved in microglial activation under hypercholesterolemic conditions, we investigated the effects of cholesterol, 24sOHChol, 25OHChol, and 27OHChol on IL-1β expression using the HMC3 cell line. IL-1β transcript levels were significantly increased after treatment with 25OHChol and 27OHChol, whereas transcription of the IL-1β gene was not affected by treatment with cholesterol or 24sOHChol, as assessed by RT-PCR (Fig. 1A) and real-time PCR (Fig. 1B). We also determined whether oxysterols affected IL-1β secretion (Fig. 1C). In agreement with the quantitative PCR data, 25OHChol and 27OHChol enhanced IL-1β secretion from microglia, whereas cholesterol or 24sOHChol did not. These results indicated that 25OHChol and 27OHChol induced IL-1β production in microglia.

Concentration and time-course effects of 25OHChol and 27OHChol

We investigated the concentration- and time-course effects of 25OHChol and 27OHChol on IL-1β expression (Fig. 2). Concentration effects were determined after treating HMC3 cells with sub-cytotoxic concentrations of each oxysterol for 48 h. We found that 25OHChol and 27OHChol did not change the viability of HMC3 cells at concentrations up to 2 µg/ml (Supplementary Fig. 1A, 1B). 25OHChol increased the levels of IL-1β transcripts at a concentration of 0.5 µg/ml, and the increase reached a plateau at 1 µg/ml, which was sustained at 2 µg/ml of 25OHChol. 27OHChol also elevated the levels of IL-1β at a concentration of 0.5 µg/ml and the elevation reached a maximum at 1 µg/ml of 27OHChol, but decreased thereafter (Fig. 2A). The two oxysterols enhanced IL-1β secretion from microglia in a pattern similar to that observed for its transcription (Fig. 2B).

Time-course effects were determined after treatment with 1 µg/ml of each, which displayed the maximum expression of IL-1β. Each oxysterol showed almost identical time-course effects on IL-1β expression at both the transcript and protein levels. While 27OHChol increased IL-1β gene transcripts and IL-1β protein secretion 48 h post-treatment, both IL-1β gene transcripts and IL-1β protein secretion started to increase 24 h post-treatment with 25OHChol, which was further enhanced 48 h post-treatment (Fig. 2C, 2D). These results suggest that 25OHChol and 27OHChol induced IL-1β expression in a similar but discrete pattern.

Induction of IL-1β expression via patterns or mechanisms different from those of Aβ and lipopolysaccharide

Since Aβ accumulates extracellularly in AD, we determined whether aggregated Aβ affects IL-1β expression in HMC3 cells. First, we investigated the effects of Aβ on IL-1β expression. IL-1β transcript levels were not elevated following treatment of HMC3 microglial cells with 5 µM Aβ₁₋₄₂ for 48 h. IL-1β transcript and secreted IL-1β protein levels significantly increased after treatment with as high as 10 µM Aβ₁₋₄₂ (Fig. 3A). However, decreased cell viability was observed at this concentration (Supplementary Fig. 1C). To investigate the interaction between Aβ and oxysterols, cells were treated with sub-cytotoxic concentrations of Aβ, 25OHChol, and 27OHChol (Fig. 3B). Both oxysterols increased IL-1β transcript levels and enhanced IL-1β secretion. The oxysterol-induced expression of IL-1β was not influenced by the presence of 5 µM Aβ₁₋₄₂, suggesting that oxysterols and Aβ did not synergistically induce IL-1β expression. We also investigated whether polymyxin B, which is widely used to counteract the effects of endotoxins, affects IL-1β expression (Fig. 3C). Lipopolysaccharide (LPS; from E. coli K12) induced IL-1β expression in HMC3 microglial cells, and LPS-induced IL-1β expression was significantly attenuated in the presence of polymyxin B. Treatment with polymyxin B, however, did not influence IL-1β expression induced by 25OHChol and 27OHChol, which excluded the possible contribution of contaminated endotoxin to IL-1β expression induced by oxysterols. Collectively, these results suggested that 25OHChol and 27OHChol induced IL-1β expression via patterns or mechanisms were distinct from those induced by Aβ and LPS.

Involvement of multiple signaling pathways in 25OHChol-and 27OHChol-induced expression of IL-1β

We determined whether Akt, ERK1/2, and Src were activated by examining their phosphorylation in response to oxysterols by immunoblotting. 25OHChol and 27OHChol enhanced the phosphorylation of Akt, ERK1/2, and Src (Fig. 4A). Phosphorylation of Akt was enhanced at 3 h and 6 h after treatment with 25OHChol and 27OHChol, respectively, which was sustained for up to 9 h. Phosphorylation of Src and ERK increased in an identical pattern. Treatment with 27OHChol also led to the increased phosphorylation of kinases. We investigated the role of protein kinases in IL-1β expression using pharmacological inhibitors. Treatment with LY294002 (a PI3K inhibitor), U0126 (an inhibitor of ERK1/2 activation), and PP2 (an Src kinase inhibitor) downregulated the transcription of IL-1β induced by 25OHChol and 27OHChol (Fig. 4B). The inhibitors also significantly suppressed the oxysterol-induced secretion of IL-1β from microglia (Fig. 4C). The inhibitory effects of kinase inhibitors were not due to cytotoxicity because cell viability did not change (Supplementary Fig. 1D). Collectively, these results suggested that the Akt, ERK1/2, and Src pathways are involved in 25OHChol-and 27OHChol-induced IL-1β expression.

Upregulation of MHC II on cell surface following exposure to 25OHChol and 27OHChol

We investigated whether oxysterols affected the expression of MHC II molecules, an activation marker of microglia, in the HMC3 cell line (Fig. 5A). Increases in MHC II immunoreactivity (green fluorescence) were observed in microglia treated with 25OHChol and 27OHChol, whereas MHC II was not detected after treatment with cholesterol or 24sOHChol, suggesting microglial activation in the presence of 25OHChol and 27OHChol. We also examined the effects of protein kinase inhibitors on MHC class II expression. MHC II immunoreactivity increased following treatment with 25OHChol, and 27OHChol was impaired in the presence of LY294002, U0126, or PP2. These results suggest that PI3K, ERK, and Src pathways also mediate 25OHChol- and 27OHChol-induced microglial activation.

Increased microglial expression of IL-1β and MHC II of ApoE deficient mice

To investigate the correlation between high cholesterol levels and microglial activation, we examined the expression of IL-1β and MHC II in ApoE-deficient mice who were fed a HFD rich in cholesterol. Murine brain tissue was immunostained with fluorescence-conjugated antibodies against Iba-1 (for microglia; red signal) and IL-1β (green signal) (Fig. 6A). Immunoreactivity of the inflammatory cytokine IL-1β was significantly detected in the hippocampus of HFD mice, but not in the hippocampus of wild-type mice. The signals of IL-1β expression co-localized with the immunoactivity of microglia (white arrows) in the three-part dentate gyrus (DG), cornu ammonis 2 (CA2), and cornu ammonis 3 (CA3) in the hippocampus of ApoE-deficient mice. We also observed signals of released IL-1β in hippocampal tissue (Supplementary Fig. 2). In addition, MHC II-positive activated microglia (white arrows) were observed in the brains of ApoE-deficient mice (Fig. 6B). These results suggest that the consumption of high cholesterol leads to microglial activation and IL-1β expression in the hippocampus.

It has been suggested that, besides being most widely used to study atherosclerosis, ApoE-deficient mice could serve as a murine model for studying the progression of AD [16, 17]. ApoE is a ligand for lipoprotein receptors involved in lipoprotein recognition and clearance of chylomicrons, very-low-density lipoproteins, and their remnants [18]. Therefore, the lack of apoE leads to the delayed clearance of lipoproteins and severe hypercholesterolemia. ApoE-deficient mice showed high plasma cholesterol levels even on a chow diet, which increased after a Western-type diet [19, 20]. Since oxysterols increase in proportion to cholesterol levels [21], much higher amounts of 25OHChol and 27OHChol will be formed after consumption of a high-cholesterol diet, compared to the chow diet. Moreover, 27OHChol is able to cross the blood-brain barrier and flow into the brain; thus, it is possible that immunosterols accumulate in the brain of mice. ApoE is also primarily responsible for cholesterol transport in the CNS [22], thus, the lack of apoE leads to dysregulated cholesterol metabolism in the brain. Taken together, our results suggest that ApoE-deficient mice are an appropriate murine model for investigating the mechanisms of microglial activation and neuroinflammation caused by hypercholesterolemia.

Dysregulated cholesterol metabolism is associated with neurodegenerative diseases such as AD, Parkinson’s disease, and Huntington’s disease [23, 24]. High cholesterol is a risk factor for AD; elevated total cholesterol levels in middle age can raise late-life AD risk independent of the ApoE E4 allele and high systolic blood pressure [23, 25]. Although the exact mechanism is unknown, by using high fat/cholesterol dieted mice, hypercholesterolemia leads to neuroinflammation characterized by pro-inflammatory cytokine expression of TNF-α, IL-1β, and IL-6, as well as glial activation, which was determined by CD45 and GFAP immunostaining, in the hippocampus with loss of working memory [26]. Proinflammatory cytokines in microglia also induce amyloid precursor protein (APP) expression, which progresses to Aβ [27]. We also demonstrated microglial activation and IL-1β expression in the hippocampus of ApoE-deficient mice, which is in line with the idea that high cholesterol levels induce neuroinflammation [28]. Moreover, our in vitro results provide new evidence that oxidized cholesterol metabolites are responsible for the neuroinflammatory response under hypercholesterolemic conditions.

Previous studies have suggested that 24sOHChol, 25OHChol, and 27OHChol have distinct and overlapping roles in cholesterol metabolism. Therefore, we attempted to determine a novel pathophysiological role of oxysterols in the brain by investigating their effects on microglial activation. Excess cholesterol is oxidized to 24sOHChol by cholesterol 24-hydroxylase (CYP46A1) in neurons. 24sOHChol, the dominant oxysterol in the brain, inhibits cholesterol synthesis, promotes cholesterol efflux by activating LXRs in astrocytes, and is capable of crossing the blood–brain barrier to the bloodstream [29]. Almost all 27OHChol in the brain comes from the circulation that travels across the blood-brain barrier [30]. 27OHChol enhances cholesterol efflux from astrocytes by inducing expression of the cholesterol transporter ABCA1 [31]. It is converted to 7α-hydroxy-3-oxo-4-cholestenoic acid, which flows from the brain into the circulation via reactions catalyzed by 25-hydroxycholesterol 7-alpha-hydroxylase (CYP7B1) and 3 beta-hydroxysteroid dehydrogenase type 7 (HSD3B7) [32]. 25OHChol, which is mainly produced by macrophages including microglia, reduces cholesterol synthesis in astrocytes [33]. We demonstrated differential effects of side-chain oxysterols on microglial activation and IL-1β expression. As 24sOHChol did not activate microglia, we investigated whether it could regulate IL-1β expression. We observed that 24sOHChol did not impair IL-1β expression induced by 25OHChol and 27OHChol (data not shown), suggesting that 24sOHChol does not protect against neuroinflammation caused by the two oxysterols.

Microglia, resident macrophages in the CNS, mediate inflammatory processes in the brain. They become activated following exposure to pathogen-associated molecular patterns (PAMPs) and/or endogenous damage-associated molecular patterns (DAMPs) and removal of immune-suppressive signals [34]. Microglia respond to neuronal damage and damage cells by phagocytosis. However, chronic activation of microglia causes neuronal damage through the release of cytotoxic molecules such as pro-inflammatory cytokines, reactive oxygen intermediates, and proteinases [35]. Inflammatory cytokines secreted by activated microglia induce neuronal cell death [36, 37]. IL-1β, a pro-inflammatory cytokine released by activated microglia, which in turn mediates microglial activation and proliferation, is a key regulator of the local tissue response to injury and disease in the brain [38, 39]. We demonstrated that 25OHChol and 27OHChol induced the production of IL-1β as well as MHC II expression, which are features of activated microglia. Consistent with previous reports that over-expression of IL-1β induces chronic neuroinflammation and AD [40] and that microglial activation and IL-1β expression become almost synonymous with neuroinflammation [41], our results suggest that chronically accumulated extracellular 25OHChol and 27OHChol molecules are likely to function as DAMPs that induce neuroinflammation and are involved in disease progression.

MHC II, which is constitutively expressed on professional antigen-presenting cells, is critical for the initiation of antigen-specific immune responses and its main function is to present processed antigens to CD4⁺ T lymphocytes [42, 43]. Ligation of MHC II also activates intracellular signaling pathways, which cause apoptosis of dendritic cell [44]. The induction of MHC II expression is a common feature of microglial activation. Microglia lack MHC II or express low, if any, levels of MHC II protein in steady state, and its expression on the cell surface is induced under conditions of inflammation [45]. However, the functional significance of surface MHC II in microglia and its role in the neuroinflammatory response remain unclear [46]. We considered that protein markers, besides MHC II, expressed by microglia after activation in the presence of 25OHChol or 27OHChol would be useful for the early diagnosis of AD. Therefore, we attempted to identify other markers specifically expressed in oxysterol-activated microglia after confirming the expression of MHC II on the surface. We observed by RT-PCR that CD137 transcripts appeared to increase following treatment with 27OHChol (Supplementary Fig. 3). However, we were unable to obtain solid data on the increase in CD137 protein by microglia, as investigated by immunofluorescence and western blotting (data not shown).

Signaling pathways transduce extracellular stimuli into intracellular signals, thereby regulate gene expression. As signaling transduction pathways are involved in the production of cytokines by immune cells, they have become important and attractive targets for therapeutic intervention in inflammatory diseases [47, 48]. Microglia are also a source and target of cytokines including IL-β and IL-6 [49]. Aβ induces IL-β processing via ROS, while LPS induces neuroinflammation in microglia by activating the mTOR pathway [50, 51]. MAPKs (p38, ERK1/2, and JNK) are involved in IL-β expression induced by Aβ and LPS [52]. These previous studies suggest that various pathways mediate microglias’ production of cytokines. Our results also suggest that the PI3K, ERK, and Src pathways mediate 25OHChol- and 27OHChol-induced microglial activation and IL-1β expression, which is in line with a previous report on the involvement of multiple kinases in immune cell differentiation by oxysterol [53]. Since the PI3K, ERK, and Src pathways play important roles in cell growth, proliferation, survival, migration, secretion, and differentiation, the dysregulated activity of these kinases affects several cellular responses [54–56]. Therefore, it is imperative to identify the upstream signaling molecules responsible for immunosterol-induced activation of kinases to target neuroinflammation.

Elevated levels of oxidized cholesterol metabolites are associated with an increased risk of AD. Treatment of microglia with 25OHChol and 27OHChol, whose levels are elevated in AD, results in microglial activation and IL-1β expression, markers of the neuroinflammatory response. Since IL-1β is a key cytokine and chronic neuroinflammation plays an important role in the progression of AD, we suggest that the suppression of 25OHchol- and/or 27OHChol-induced IL-1β expression is a promising strategy for AD therapy.

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and materials

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Competing interests

We have no conflicts of interest to disclose.

Funding

This work was supported by grants from the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2019R1I1A3A0105534414, NRF-2020R1A2C109961213, and NRF-2022R1I1A1A0105300711).

Authors' contributions

In Jun Yeo and Yonghae Son performed experiments. Koanhoi Kim designed the study. Yonghae Son, In Jun Yeo, Jin Tae Hong, Seong-Kug Eo,and Koanhoi Kimanalyzed and interpreted the data, and drafted the manuscript. All authors have reviewed the manuscript.

Acknowledgements

We would like to thank Editage (www.editage.co.kr) for English language editing.

Bjorkhem I, Diczfalusy U. Oxysterols: friends, foes, or just fellow passengers? Arterioscler Thromb Vasc Biol. 2002,22(5):734-42, doi: 10.1161/01.atv.0000013312.32196.49.
Bjorkhem I, Meaney S. Brain cholesterol: long secret life behind a barrier. Arterioscler Thromb Vasc Biol. 2004,24(5):806-15, doi: 10.1161/01.ATV.0000120374.59826.1b.
Loera-Valencia R, Goikolea J, Parrado-Fernandez C, Merino-Serrais P, Maioli S. Alterations in cholesterol metabolism as a risk factor for developing Alzheimer's disease: Potential novel targets for treatment. J Steroid Biochem Mol Biol. 2019,190:104-14, doi: 10.1016/j.jsbmb.2019.03.003.
Testa G, Staurenghi E, Zerbinati C, Gargiulo S, Iuliano L, Giaccone G, et al. Changes in brain oxysterols at different stages of Alzheimer's disease: Their involvement in neuroinflammation. Redox Biol. 2016,10:24-33, doi: 10.1016/j.redox.2016.09.001.
Gold ES, Diercks AH, Podolsky I, Podyminogin RL, Askovich PS, Treuting PM, et al. 25-Hydroxycholesterol acts as an amplifier of inflammatory signaling. Proc Natl Acad Sci U S A. 2014,111(29):10666-71, doi: 10.1073/pnas.1404271111.
Kim SM, Kim BY, Lee SA, Eo SK, Yun Y, Kim CD, et al. 27-Hydroxycholesterol and 7alpha-hydroxycholesterol trigger a sequence of events leading to migration of CCR5-expressing Th1 lymphocytes. Toxicology and applied pharmacology. 2014,274(3):462-70.
Kim SM, Lee SA, Kim BY, Bae SS, Eo SK, Kim K. 27-Hydroxycholesterol induces recruitment of monocytic cells by enhancing CCL2 production. Biochem Biophys Res Commun. 2013,442(3-4):159-64, doi: 10.1016/j.bbrc.2013.11.052.
Aloisi F, De Simone R, Columba-Cabezas S, Penna G, Adorini L. Functional maturation of adult mouse resting microglia into an APC is promoted by granulocyte-macrophage colony-stimulating factor and interaction with Th1 cells. J Immunol. 2000,164(4):1705-12.
Tambuyzer BR, Ponsaerts P, Nouwen EJ. Microglia: gatekeepers of central nervous system immunology. J Leukoc Biol. 2009,85(3):352-70, doi: 10.1189/jlb.0608385.
Hayes GM, Woodroofe MN, Cuzner ML. Microglia are the major cell type expressing MHC class II in human white matter. J Neurol Sci. 1987,80(1):25-37, doi: 10.1016/0022-510x(87)90218-8.
March CJ, Mosley B, Larsen A, Cerretti DP, Braedt G, Price V, et al. Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 1985,315(6021):641-7, doi: 10.1038/315641a0.
Dinarello CA. Biology of interleukin 1. FASEB J. 1988,2(2):108-15.
Roche PA, Furuta K. The ins and outs of MHC class II-mediated antigen processing and presentation. Nat Rev Immunol. 2015,15(4):203-16, doi: 10.1038/nri3818.
Feringa FM, van der Kant R. Cholesterol and Alzheimer's Disease, From Risk Genes to Pathological Effects. Front Aging Neurosci. 2021,13:690372, doi: 10.3389/fnagi.2021.690372.
Son Y, Choi J, Kim B, Park YC, Eo SK, Cho HR, et al. Cyclosporin A inhibits differentiation and activation of monocytic cells induced by 27-hydroxycholesterol. Int Immunopharmacol. 2019,69:358-67, doi: 10.1016/j.intimp.2019.01.045.
Choi J, Forster MJ, McDonald SR, Weintraub ST, Carroll CA, Gracy RW. Proteomic identification of specific oxidized proteins in ApoE-knockout mice: relevance to Alzheimer's disease. Free Radic Biol Med. 2004,36(9):1155-62, doi: 10.1016/j.freeradbiomed.2004.02.002.
Crisby M, Rahman SM, Sylven C, Winblad B, Schultzberg M. Effects of high cholesterol diet on gliosis in apolipoprotein E knockout mice. Implications for Alzheimer's disease and stroke. Neurosci Lett. 2004,369(2):87-92, doi: 10.1016/j.neulet.2004.05.057.
Getz GS, Reardon CA. Apoprotein E as a lipid transport and signaling protein in the blood, liver, and artery wall. J Lipid Res. 2009,50 Suppl(Suppl):S156-61, doi: 10.1194/jlr.R800058-JLR200.
Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb. 1994,14(1):133-40, doi: 10.1161/01.atv.14.1.133.
Reddick RL, Zhang SH, Maeda N. Atherosclerosis in mice lacking apo E. Evaluation of lesional development and progression. Arterioscler Thromb. 1994,14(1):141-7, doi: 10.1161/01.atv.14.1.141.
Schroepfer GJ, Jr. Oxysterols: modulators of cholesterol metabolism and other processes. Physiol Rev. 2000,80(1):361-554, doi: 10.1152/physrev.2000.80.1.361.
Mahley RW. Central Nervous System Lipoproteins: ApoE and Regulation of Cholesterol Metabolism. Arterioscler Thromb Vasc Biol. 2016,36(7):1305-15, doi: 10.1161/ATVBAHA.116.307023.
Dai L, Zou L, Meng L, Qiang G, Yan M, Zhang Z. Cholesterol Metabolism in Neurodegenerative Diseases: Molecular Mechanisms and Therapeutic Targets. Mol Neurobiol. 2021,58(5):2183-201, doi: 10.1007/s12035-020-02232-6.
Popa-Wagner A, Dumitrascu DI, Capitanescu B, Petcu EB, Surugiu R, Fang WH, et al. Dietary habits, lifestyle factors and neurodegenerative diseases. Neural Regen Res. 2020,15(3):394-400, doi: 10.4103/1673-5374.266045.
Kivipelto M, Helkala EL, Laakso MP, Hanninen T, Hallikainen M, Alhainen K, et al. Apolipoprotein E epsilon4 allele, elevated midlife total cholesterol level, and high midlife systolic blood pressure are independent risk factors for late-life Alzheimer disease. Ann Intern Med. 2002,137(3):149-55, doi: 10.7326/0003-4819-137-3-200208060-00006.
Thirumangalakudi L, Prakasam A, Zhang R, Bimonte-Nelson H, Sambamurti K, Kindy MS, et al. High cholesterol-induced neuroinflammation and amyloid precursor protein processing correlate with loss of working memory in mice. J Neurochem. 2008,106(1):475-85, doi: 10.1111/j.1471-4159.2008.05415.x.
Rawji KS, Mishra MK, Yong VW. Regenerative Capacity of Macrophages for Remyelination. Front Cell Dev Biol. 2016,4:47, doi: 10.3389/fcell.2016.00047.
Wang ZY, Miki T, Ding Y, Wang SJ, Gao YH, Wang XL, et al. A high cholesterol diet given to apolipoprotein E-knockout mice has a differential effect on the various neurotrophin systems in the hippocampus. Metab Brain Dis. 2011,26(3):185-94, doi: 10.1007/s11011-011-9252-z.
Gamba P, Giannelli S, Staurenghi E, Testa G, Sottero B, Biasi F, et al. The Controversial Role of 24-S-Hydroxycholesterol in Alzheimer's Disease. Antioxidants (Basel). 2021,10(5), doi: 10.3390/antiox10050740.
Heverin M, Meaney S, Lutjohann D, Diczfalusy U, Wahren J, Bjorkhem I. Crossing the barrier: net flux of 27-hydroxycholesterol into the human brain. J Lipid Res. 2005,46(5):1047-52, doi: 10.1194/jlr.M500024-JLR200.
Weigel TK, Kulas JA, Ferris HA. Oxidized cholesterol species as signaling molecules in the brain: diabetes and Alzheimer's disease. Neuronal Signal. 2019,3(4):NS20190068, doi: 10.1042/NS20190068.
Saeed A, Floris F, Andersson U, Pikuleva I, Lovgren-Sandblom A, Bjerke M, et al. 7alpha-hydroxy-3-oxo-4-cholestenoic acid in cerebrospinal fluid reflects the integrity of the blood-brain barrier. J Lipid Res. 2014,55(2):313-8, doi: 10.1194/jlr.P044982.
Odnoshivkina UG, Kuznetsova EA, Petrov AM. 25-Hydroxycholesterol as a Signaling Molecule of the Nervous System. Biochemistry (Mosc). 2022,87(6):524-37, doi: 10.1134/S0006297922060049.
Woodburn SC, Bollinger JL, Wohleb ES. The semantics of microglia activation: neuroinflammation, homeostasis, and stress. J Neuroinflammation. 2021,18(1):258, doi: 10.1186/s12974-021-02309-6.
Dheen ST, Kaur C, Ling EA. Microglial activation and its implications in the brain diseases. Curr Med Chem. 2007,14(11):1189-97, doi: 10.2174/092986707780597961.
Giulian D, Haverkamp LJ, Yu JH, Karshin W, Tom D, Li J, et al. Specific domains of beta-amyloid from Alzheimer plaque elicit neuron killing in human microglia. J Neurosci. 1996,16(19):6021-37.
Walker DG, Lue LF. Investigations with cultured human microglia on pathogenic mechanisms of Alzheimer's disease and other neurodegenerative diseases. J Neurosci Res. 2005,81(3):412-25, doi: 10.1002/jnr.20484.
Shaftel SS, Griffin WS, O'Banion MK. The role of interleukin-1 in neuroinflammation and Alzheimer disease: an evolving perspective. J Neuroinflammation. 2008,5:7, doi: 10.1186/1742-2094-5-7.
Zhu L, Liu X, Nemeth DP, DiSabato DJ, Witcher KG, McKim DB, et al. Interleukin-1 causes CNS inflammatory cytokine expression via endothelia-microglia bi-cellular signaling. Brain Behav Immun. 2019,81:292-304, doi: 10.1016/j.bbi.2019.06.026.
Shaftel SS, Kyrkanides S, Olschowka JA, Miller JN, Johnson RE, O'Banion MK. Sustained hippocampal IL-1 beta overexpression mediates chronic neuroinflammation and ameliorates Alzheimer plaque pathology. J Clin Invest. 2007,117(6):1595-604, doi: 10.1172/JCI31450.
Liu X, Quan N. Microglia and CNS Interleukin-1: Beyond Immunological Concepts. Front Neurol. 2018,9:8, doi: 10.3389/fneur.2018.00008.
Holling TM, Schooten E, van Den Elsen PJ. Function and regulation of MHC class II molecules in T-lymphocytes: of mice and men. Hum Immunol. 2004,65(4):282-90, doi: 10.1016/j.humimm.2004.01.005.
Kambayashi T, Laufer TM. Atypical MHC class II-expressing antigen-presenting cells: can anything replace a dendritic cell? Nat Rev Immunol. 2014,14(11):719-30, doi: 10.1038/nri3754.
Leverkus M, McLellan AD, Heldmann M, Eggert AO, Brocker EB, Koch N, et al. MHC class II-mediated apoptosis in dendritic cells: a role for membrane-associated and mitochondrial signaling pathways. Int Immunol. 2003,15(8):993-1006, doi: 10.1093/intimm/dxg099.
Almolda B, Gonzalez B, Castellano B. Antigen presentation in EAE: role of microglia, macrophages and dendritic cells. Front Biosci (Landmark Ed). 2011,16(3):1157-71, doi: 10.2741/3781.
Wolf Y, Shemer A, Levy-Efrati L, Gross M, Kim JS, Engel A, et al. Microglial MHC class II is dispensable for experimental autoimmune encephalomyelitis and cuprizone-induced demyelination. Eur J Immunol. 2018,48(8):1308-18, doi: 10.1002/eji.201847540.
Banerjee S, Biehl A, Gadina M, Hasni S, Schwartz DM. JAK-STAT Signaling as a Target for Inflammatory and Autoimmune Diseases: Current and Future Prospects. Drugs. 2017,77(5):521-46, doi: 10.1007/s40265-017-0701-9.
Jridi I, Cante-Barrett K, Pike-Overzet K, Staal FJT. Inflammation and Wnt Signaling: Target for Immunomodulatory Therapy? Front Cell Dev Biol. 2020,8:615131, doi: 10.3389/fcell.2020.615131.
Hanisch UK. Microglia as a source and target of cytokines. Glia. 2002,40(2):140-55, doi: 10.1002/glia.10161.
Parajuli B, Sonobe Y, Horiuchi H, Takeuchi H, Mizuno T, Suzumura A. Oligomeric amyloid beta induces IL-1beta processing via production of ROS: implication in Alzheimer's disease. Cell Death Dis. 2013,4:e975, doi: 10.1038/cddis.2013.503.
Ye X, Zhu M, Che X, Wang H, Liang XJ, Wu C, et al. Lipopolysaccharide induces neuroinflammation in microglia by activating the MTOR pathway and downregulating Vps34 to inhibit autophagosome formation. J Neuroinflammation. 2020,17(1):18, doi: 10.1186/s12974-019-1644-8.
Kim SH, Smith CJ, Van Eldik LJ. Importance of MAPK pathways for microglial pro-inflammatory cytokine IL-1 beta production. Neurobiol Aging. 2004,25(4):431-9, doi: 10.1016/S0197-4580(03)00126-X.
Son Y, Kim BY, Park YC, Eo SK, Cho HR, Kim K. PI3K and ERK signaling pathways are involved in differentiation of monocytic cells induced by 27-hydroxycholesterol. Korean J Physiol Pharmacol. 2017,21(3):301-8, doi: 10.4196/kjpp.2017.21.3.301.
Byeon SE, Yi YS, Oh J, Yoo BC, Hong S, Cho JY. The role of Src kinase in macrophage-mediated inflammatory responses. Mediators Inflamm. 2012,2012:512926, doi: 10.1155/2012/512926.
Koyasu S. The role of PI3K in immune cells. Nat Immunol. 2003,4(4):313-9, doi: 10.1038/ni0403-313.
Shaul YD, Seger R. The MEK/ERK cascade: from signaling specificity to diverse functions. Biochim Biophys Acta. 2007,1773(8):1213-26, doi: 10.1016/j.bbamcr.2006.10.005.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

25-Hydroxycholesterol and 27-hydroxycholesterol induce neuroinflammation by activating microglia

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Cell culture and reagents

Reverse transcriptase and real-time polymerase chain reaction (RT and real-time PCR)

Western blot analysis

Enzyme-linked immunosorbent assay

Immunofluorescence of MHC II

Murine brain tissue immunofluorescence staining

Statistical analysis

Results

Upregulation of IL-1β in microglia following treatment with 25OHChol and 27OHChol

Concentration and time-course effects of 25OHChol and 27OHChol

Induction of IL-1β expression via patterns or mechanisms different from those of Aβ and lipopolysaccharide

Involvement of multiple signaling pathways in 25OHChol-and 27OHChol-induced expression of IL-1β

Upregulation of MHC II on cell surface following exposure to 25OHChol and 27OHChol

Increased microglial expression of IL-1β and MHC II of ApoE deficient mice

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1