Patients and samples
All the clinical specimens in this experiment obtained the donor's informed consent, and the ethnic Ethics Committee of the affiliated Hospital of Youjiang Medical University approved this study (approval number: YYFY-LL-2022-88). This study studied 8 OA patients (2 males and 6 females) with an average age of 65 years old (65 ± 17). In the control group, there were 8 regular patients (6 males and 2 females) whose average age was 41 (41 ± 7) with amputation due to severe trauma. Cartilage specimens were obtained from the tibial plateau. After the samples were fixed and decalcified, tissue sections and saffron O staining were performed, and then the results were scored by the International Association for Osteoarthritis Research (OARSI).
Animals
Forty-eight male 10-week-old C57BL/6 mice were purchased from Changsha Tianqin Biotechnology Co., Ltd. (Changsha, China). The Ethics Committee approved all the experiments. Mice were kept at room temperature (22 ℃) for 12 hours day and night. The Ethics Committee approved all the experiments. OA was caused by the right knee destabilizing medial meniscectomy (DMM) of each mouse. Forty-eight mice were randomly divided into sham operation group (Sham), OA group, OA + intraperitoneal injection 0.5 mg/kg PP2 group and OA + intraperitoneal injection 5 mg/kg PP2 group. From 2 weeks after DMM, the drug was injected intraperitoneally for 6 weeks, three times a week, and then the knee joint was resected for further analysis.
Chondrocytes
The femoral condyle and tibial plateau of 3-day-old mice were cut into pieces, 30min was digested by trypsin at 37 ℃ and then digested overnight in (DMEM) / F12 (Gibco) medium containing 10% fetal bovine serum (FBS) (Gibco) and 0.1% collagenase II (Sigma-Aldrich). The isolated chondrocytes were inoculated into a petri dish, and the complete medium (DMEM) / F12 containing serum was added. Put the petri dish in the cell incubator. The incubation temperature was 37℃ and mass fraction of carbon dioxide 5%. After the cells in the petri dish grew to 90%, they were passed on to the second generation or the third generation and inoculated to a six-well plate for follow-up experiments.
Cell Viability Determination
CCK-8 reagent was added to the treated mouse chondrocytes in each group to detect whether PP2 promoted chondrocyte proliferation. The third generation of mouse chondrocytes was inoculated into 96-well plates with 5000 cells in each well. One 96-well plate was treated with PP2 (0,10,20,40,60 and 80µM). Add IL-1β (10ng/mL) and PP2 into the other 96 well, and treat for 24 hours. On the second day, 10µL CCK-8 solution was added to each well, and the 96-well plate was transferred to a 37℃ incubator for 2 hours. An enzyme labelling instrument measured the absorbance of each well under 450nm, and the cell activity of each group was calculated according to the formula. The calculation formula is as follows: Cell viability = [intervention group λ (450 nm) − blank group λ (450 nm)] / [control group λ (450 nm) − blank group λ (450 nm)] × 100%.
RNA sequence (RNA-seq)
After the third generation of mouse chondrocytes were treated with IL-1 β and different concentrations of PP2 (0, 20 µm) for 24 hours, the total RNA was extracted. IL-1 β and IL-1 β + PP2 samples were sent to Shanghai Majorbio Bio-pharm Technology Co., Ltd (Shanghai, China) to obtain DEGs (differentially expressed genes) between two samples. Use the obtained DEGs for gene ontology (GO) analysis and functional annotation for DEGs. Then the Kyoto Encyclopedia of Gene and Genome (KEGG) enrichment analysis was carried out to analyze the signaling of DEGs.
Assessment Of Knee Degeneration
We use saffron O staining and routine tissue sections (4 µm thickness) to observe knee cartilage changes during OA. Groups were compared using the OARSI scoring system, and osteophyte proliferation in the knee joint was observed by X-ray.
Micro-CT Analysis
Collect mouse knee joints and put them in 4% tissue fixation solution, and then the next day scanned with micro-CT equipment (AT1123, Perkin Elmer, A TOMTEX, Minsk, Republic of Belarus). The scanning area was the whole knee joint, and the analysis area was the subchondral bone of the tibial plateau. Three-dimensional (3D) reconstruction of knee joint structures was performed and were analyzed,
Immunofluorescence (IF) Staining
The routine histological sections (4 µm) were put into a citric acid buffer overnight in a 60 ℃ water bath for tissue antigen repair. The tissue on the section was blocked by donkey serum albumin (Solarbio, Beijing, China) containing TritonX-100 (0.3%) at 22℃ for 30 min. Absorb the sealing fluid from the section, and a specific first antibody was added to transfer it from being incubated overnight in the refrigerator at 4℃. The antibodies used were FAK, p-FAK, COL2A1, aggrecan, MMP9, MMP13, ADAMTS5, COLX, Src, p-Src, β-catenin, p-β-catenin and p-Smad2/3. On the second day, put the tissue section on the slice rack and transfer it to phosphate-buffered saline (PBS) to rinse 3 times, each time 5min. The second antibody is then added to the tissue section at 22℃ for 3 hours. Next, in the dark, tissue sections were counterstained with DAPI for10 min. Finally, an anti-fluorescence quenching tablet was added and the cover was sealed. Fluorescence staining images were obtained using a laser scanning confocal microscope (Leica Microsystems Co., Ltd., Wetzlar, Germany).
Quantitative Reverse-transcription Polymerase Chain Reaction (qRT-PCR)
The second or third-generation mouse chondrocytes were inoculated into a six-well plate and divided into the Control group, IL-1β group, IL-1β + PP2 10µM group, IL-1β + PP2 20µM group and IL-1β + DMSO group. After 24 hours of drug treatment, the total RNA of cells in each group was extracted. The total RNA of each group was reverse transcribed cDNA using a Primescript RT-PCR kit. Then, qRT-PCR was carried out using SYBR-green reagent and appropriate primers. The measured data of each group were calculated by the2−ΔΔCt method, and the β-actin was measured as the internal reference.
The primers used by Q-PCR are as follows:
Genes
|
Forward primer (5′-3′)
|
Reverse primer (5′-3′)
|
Aggrecan
Col2a1
Sox9
ADAMTS5
MMP13
Axin2
Cyclin D1
β-catenin
MMP9
MMP3
MMP2
FAK
SRC
LEF1
β-actin
|
CGCCACTTTCATGACCGAGA
GGGACCTCAAGGCAAAGTCG
TTTCCGAGACGTGGACATCG
GGCATCATTCATGTGACACC
ACCCAGCCCTATCCCTTGAT
GGTTCCGGCTATGTCTTTGC
ACCCTGACACCAATCTCCT
CCTATGCAGGGGTGGTCAAC
AGACGACATAGACGGCATCC
CTCTGGAACCTGAGACATCACC
GCCAAGGTGGAAATCAGAGA
CAATAGTGAGCCAACCACCTG
GCCTACTACTCCAAACACGC
CATTCGGACATTCCCGGAGC
GGAACCGCTCGTTGCCAATAGTGA
|
TCATTCAGACCGATCCACTGGTAG
TTCCAGGCTCACCATTAGCG
GTACCGCTGTAGGTGGTGAC
CGAGTACTCAGGCCCAAATG
TCTCGGGATGGATGCTCGTA
CAGTGCGTCGCTGGATAACTC
CTCCTTCTGCACGCACTT
CGACCTGGAAAACGCCATCA
TGGGACACATAGTGGGAGGT
AGGAGTCCTGAGAGATTTGCGC
GTTGAAGGAAACGAGCGAAG
TCTAGACAACCCAACTTCAAAGC
GTAAATGGGCTCCTCTGAAA
TTTGTTCCCGGCTCGAGTTT
GAGGGGGAATCGTGCGTGACATCAA
|
Western Blotting
The proteins of cartilage tissue and chondrocytes in each group were extracted. The Western blotting test detected the expression level of each target protein, with GAPDH as the internal reference. Pour an appropriate amount of liquid nitrogen into the mortar, put the 30mg cartilage tissue into the mortar, quickly grind the tissue into powder, and then add the RIPA cleavage solution containing protease and phosphatase inhibitors. The sample was put on ice to split 30min, then centrifuged 15min at 12000 rpm. The supernatant was mixed with a 5×loading buffer and boiled for 15min in a metal bath at 100℃. The protein samples of each group were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to a polyvinylidene fluoride (PVDF) membrane. Seal for 1 hour with TBST containing 5% skim milk powder, then put the PVDF membrane into the primary antibodies for testing: Src (1:2000, ab231081, Abcam), p-Src (1:1000, 13940, SAB, Greenbelt, MD, USA), FAK (1:1000, ab40794, Abcam), p-FAK (1:1000, 29070, SAB), β-catenin (1:3000, ab32572, Abcam), p-β-catenin (1;500, p35222, Cell Signaling Technology, Danvers, MA, USA), Smad3 (1:1000, ab202445, Abcam), p-Smad3 (1;1000, D27F4, Cell Signaling Technology), collagen II (1:1000, ab188570, Abcam), SOX9 (1:1000, A19710, ABclonal, Woburn, MA, USA), Aggrecan (1:500, ab36861, Abcam), ADAMTS5 (1:250, ab41037, Abcam), MMP13 (1:2000, 18165-1-Ap, Proteintech, Rosemont, IL, USA), MMP9 (1:2000, ab283575, Abcam), MMP3 (1:1000, ab52915, Abcam), MMP2 (1:2000, ab92536, Abcam), COX2 (1:2000, ab179800, Abcam), COLX (1:2000, A11645, ABclonal), GAPDH (1:10000, ab181602, Abcam). The first antibody was incubated overnight in a shaker at 4 ℃, and the PVDF membrane was incubated in the second antibody for 1 hour. Finally, the results were observed by enhanced chemiluminescence.
Statistical analysis
The data obtained from all experiments are expressed as the means ± SD. The data were statistically analyzed using SPSS (version 25.0;IBM Corporation, Armonk, New York, USA) software. Two independent sample T-tests were used for comparison between the two data groups [18]. Compare using one-way ANOVA between three or more data groups. It is considered that a P ≤ 0.05 is statistically significant.