Preparation of T. spiralis ESP
ICR mice infected with T. spiralis for thirty-five days were sacrificed, ML were collected according to the method of Beiting et al. [19], and adult worms at 6 days post infection (Ad6) were collected according to the method of Sun et al. [20]. The collected ML and Ad6 were washed multiple times with physiological saline containing 500 U/ml mycillin, transferred to RPMI 1640 medium containing 500 U/ml mycillin at a density of 5000 ML/ml and then cultured in a 5% CO2 incubator at 37°C for 24 h. Subsequently, the culture supernatant was collected by centrifugation, filtered using a 0.22-μm filter, concentrated and stored at -80°C.
Construction of tumor-bearing mice and grouping of experimental animals
Cryogenic vials containing H22 cells were removed from liquid nitrogen and placed into warm (37°C) water. After thawing, the cells were transferred into 5 ml of complete RPMI 1640 medium (containing 10% fetal calf serum and a 1% penicillin-streptomycin solution) and centrifuged at 1000 rpm for 5 min. The cells were then resuspended in complete RPMI 1640 medium for culturing. Once the cells had grown to 80% confluence in the culture dish, the cells were removed using 0.25% trypsin. After three generations, cells in the logarithmic phase were collected and subcutaneously injected into the armpit of BALB/c mice (1×105 cells per mouse) to construct a tumor-bearing mouse model. In this study, mice were randomly divided into four groups: the control group, tumor-bearing group, T. spiralis infection group and T. spiralis + tumor group (H22 cells were injected into the mice at 7 days post infection).
Calculation of the tumor inhibition rate
Mice were sacrificed by cervical dislocation on the 27th day after injection of H22 cells, the tumor was harvested, and the size of the solid tumor tissue was compared between the tumor-bearing group and the T. spiralis + tumor group. Then, the tumor tissue was weighed, and the tumor inhibition rate was calculated. Tumor inhibition rate (%) = (average tumor weight of tumor-bearing group- average tumor weight of T. spiralis + tumor group)/average tumor weight of tumor-bearing group × 100%.
CCK-8 assay
H22 cells in the logarithmic phase were seeded at 1000 cells/well in 96-well plates, and then different final concentrations of ML or Ad6 ESP (0.05, 0.1, 0.2, and 0.4 mg/ml) were added to the wells. After 48 hours of incubation, cell proliferation was evaluated by using CCK-8 (Med Chem Express, American). Generally, 10 µl of CCK-8 solution was added to each well, and the samples were incubated for one hour before the absorbance was measured at 450 nm. Each experiment was conducted five times.
Detection of apoptosis
In this study, flow cytometry with Annexin V and PI staining was used to detect apoptosis. Cellular samples were harvested after incubation with ML or Ad6 ESP, and the density was adjusted to 1 × 106 cells/ml. After double staining with Annexin V and PI for 15 min at room temperature with the Annexin V-Alexa Apoptosis Detection Kit (Fcmacs, China), the samples were analyzed on a FACScan flow cytometer equipped with Cell Quest software (BD Biosciences, USA), and the results were used in apoptotic rate analyses.
Western blotting
H22 cells incubated with ML or Ad6 ESP for 48 h and mouse spleen tissue collected at different time points (14, 21, 28, and 35 d) were treated with RIPA lysis buffer. A rabbit anti-mouse Bax polyclonal antibody was used at a 1:2000 dilution, a rabbit anti-mouse Bcl-2 monoclonal antibody was used at a 1:1000 dilution, and a rabbit anti-mouse Caspase 3 polyclonal antibody was used at a 1:500 dilution. A goat secondary antibody conjugated with horseradish peroxidase was used at a 1:2000 dilution. Imaging was performed using an ECL-based system. The protein expression level was normalized to the corresponding β-tubulin level in this study.
qPCR
RNA was extracted from H22 cells after coculturing with ESP for 48 h or from mouse spleen tissue collected at different time points (7, 14, 21, 28, and 35 d) in each experiment group using TRIzol and reverse transcribed using the PrimeScript RT Reagent Kit (Trans, China). The transcriptional levels of IL-2, IFN-γ, IL-4, Bax, Bcl-2, and Caspase-3 were normalized to those of the housekeeping gene GAPDH, and fold changes were determined by relative quantification (2^−ΔΔct). The primers used for qPCR are listed in Table 1.
Table 1
Genes
|
Primer sequence (5’-3’)
|
IL-2
|
Forward: ATGTACAGCATGCAGCTCGCATCCTGTGTCA
|
Reverse: AGTCAAATCCAGAACATGCCGCAGACGTCCA
|
IFN-γ
|
Forward: CTCTTCTTGGATATCTGGAGGAACTGG
|
Reverse: AATGACGCTTATGTTGTTGCTGATGG
|
IL-4
|
Forward: CCTGCTCTTCTTTCTCGAATGT
|
Reverse: CTCTCTGTGGTGTTCTTCGTTG
|
Bax
|
Forward: TTGCCCTCTTCTACTTTGCTAG
|
Reverse: CCATGATGGTTCTGATCAGCTC
|
Bcl-2
|
Forward: ACCCCTGGCATCTTCTCCTTCC
|
Reverse: CTGCGAAGTCACGACGGTAGC
|
Caspase-3
|
Forward: GAAACTCTTCATCATTCAGGCC
|
Reverse: GCGAGTGAGAATGTGCATAAAT
|
GAPDH
|
Forward: ATGACATCAAGAAGGTGGTGAAG
|
Reverse: TCCTTGGAGGCCATGTAGG
|
ELISA
At different time points, the splenocyte culture supernatant of each group was quantitatively analyzed using ELISA kits (R&D Systems, Inc., USA) for pro-inflammatory (IL-2 and IFN-γ) and anti-inflammatory (IL‐4) cytokines.
Statistical analysis
All the data were analyzed with SPSS 20.0 software (SPSS, Inc., USA). All the data are presented as the mean ± SD, and ANOVA or a two-tailed Student’s t-test was used to examine the statistical significance of comparisons of the means of different groups. P < 0.05 was accepted as statistically significant.