Nebulized pH-Responsive Nanospray Combined with Pentoxifylline and Edaravone to Lungs for Efficient Treatments of Acute Respiratory Distress Syndrome

doi:10.21203/rs.3.rs-2571906/v1

Download PDF

Research Article

Nebulized pH-Responsive Nanospray Combined with Pentoxifylline and Edaravone to Lungs for Efficient Treatments of Acute Respiratory Distress Syndrome

https://doi.org/10.21203/rs.3.rs-2571906/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The COVID-19 pandemic has become an unprecedented global medical emergency, resulting in millions of people being infected with the COVID-19 virus and more than 5 million deaths. Acute respiratory distress syndrome (ARDS) caused by COVID-19 is the most common serious complication leading to death. However, no treatment has been proved successful in treating ARDS apart from the low tidal volume mechanical ventilation. Herein, we have constructed a novel nanospray with anti-inflammatory and antioxidant capacity by loading Pentoxifylline (PTX) and Edaravone (Eda) on ZIF-8. This nanospray was endowed with synergetic therapy ability, which could kill two birds with one stone: the loaded PTX played a powerful anti-inflammatory role by inhibiting the activation of inflammatory cells and the synthesis of pro-inflammatory cytokines, meanwhile, Eda was responsible for free radical scavenger in ARDS.

Results

These data showed ZIF8-EP protected RAW264.7 cells from oxidative stress-induced apoptosis by removing excessive ROS in cells. In the mice model of LPS-induced ARDS, ZIF8-EP nanospray appreciably inhibited the inflammatory response and weakened the oxidative stress, and efficiently controlled the damage of ARDS to lung tissue. Subsequently, WB, IHC, RT-qPCR and Elisa experiments verified the main mechanism of ZIF8-EP nanospray inhibiting ARDS inflammation.

Conclusion

Taken together, compared with free PTX and Eda the nanospray was proved to have excellent therapeutic effect on ARDS in vitro and in vivo without hematotoxicity and systemic toxicity.

COVID-19

Edaravone

Pentoxifylline

nanospray

ARDS

COVID-19 also known as SARS-CoV-2 emerged in December 2019 has become a global menace[1–4]. The symptoms of COVID-19 are dry cough, mild fever, and a headache[5–7]. Recent studies have indicated ARDS is a critical complication of COVID-19 in the process of treatment contributing to high mortality[8–10]. However, no treatment has been proved successful in treating ARDS apart from the low tidal volume mechanical ventilation[11].

ARDS is regulated by a complex interaction of multiple inflammatory cells, pro-inflammatory factors, and signaling pathways, such as neutrophils, monocytes/macrophages, cytokines (TNF-α, IL-10), NF-κB signaling, and p38 mitogen-activated protein kinase (p38MAPK) signaling[12]. Inflammatory cells and cytokines jointly regulate the initiation and progression of ARDS inflammatory response[13]. PTX is a non-selective phosphodiesterase inhibitor, which has been widely used in the treatment of peripheral vascular diseases[14]. In addition, PTX can also inhibit the inflammatory response by inhibiting the activation and proliferation of mononuclear cells and the release of inflammatory mediators, such as tumor necrosis factor-α (TNF-α)[15]. TNF-α is one of the most important inflammatory mediators in the inflammatory response, involved in mediating the whole process of ARDS inflammation by activating neutrophils, lymphocytes and related inflammatory pathways (such as NF-κB signaling pathway, p38MAPK signaling pathway and AP-1 signaling pathway)[16, 17].

Moreover, during acute inflammation, activated M1 macrophages or neutrophils produce high levels of reactive oxygen species (ROS) to kill pathogens and damage normal lung tissue [18], which can promote the progression of ARDS by oxidative damage of phospholipid components on the surface of cell membrane and the structure of intracellular proteins [19]. The core pathophysiological changes of ARDS are the imbalance of inflammatory response as well as the damage of pulmonary vascular endothelial and alveolar epithelial cells. Therefore, the protection of normal alveolar epithelial cells and pulmonary vascular endothelial cells, and the elimination of ROS to regulate the intensity of inflammatory response are key strategies in the current drug treatment of ARDS, in which a broad-spectrum of antioxidants and radical scavengers are used [20]. Eda (3-methyl-1-phenyl-2-pyrazoling-5-one) has been considered to be a free radical scavenger which is extensively employed as a therapeutic option for ischemia brain damage for decades [21]. Recent studies have shown that Eda can inhibit lipid peroxidation by scavenging of ROS, thereby reducing oxidative stress caused by an inflammatory cascade [22, 23].

For treating lung diseases, systemic delivery of drugs was a main and traditional way, but it should be pointed out that, in most cases, this treatment method presents a poor efficiency and adverse effects on other organs [24]. To overcome these problems, it is reasonable to deliver drugs directly to the lungs by inhalation. Thereinto, several kinds of drug delivery systems were developed for inhalation delivery, which includes microparticles [25], colloidal dispersions[26] and nanoparticles [27]. However, PTX and Eda display poor solubility, setting a barrier for desired outcome.

In recent years, there was a significant development for nanotechnology, opening a new avenue for improving the efficacy of inhalation therapy of various lung diseases [28–30]. Nanodrug delivery system has achieved great progress, with the advantages in improving the solubility of drugs, co-delivery, targeting delivery of therapeutic drugs and extending drug half-life for better therapeutic effect [31–35]. Among various nanocarriers, ZIF-8, composed of 2-methylimidazolate and Zn²⁺ with minimal cytotoxicity has attracted wide attention [36]. Moreover, ZIF-8 is vulnerable to disintegrate in acid environment, which is advantageous for effective pH-controlled release. It is well known that the inflammation tissue usually becomes acidic with lower pH in comparison with healthy tissues [37, 38]. Therefore, ZIF-8 is an excellent candidate for the treatment of ARDS by carrying PTX and Eda.

In this study, we have constructed a new nanospray system by employing ZIF-8 as a carrier loaded with PTX and Eda (Scheme 1A). The nano spray system endows excellent water solubility, efficient acid response release, remarkable biocompatibility and prominent anti-oxidant and anti-inflammatory ability (Scheme 1B). On a lipopolysaccharide (LPS)-induced mouse model of ARDS, the in vivo anti-inflammatory and ROS-scavenging efficacy of ZIF8-EP were thoroughly evaluated. Furthermore, the anti-inflammatory mechanism of ZIF8-EP nanospray was also verified by the changes of related immune cells and the corresponding signal pathways. This work provided reliable in vivo evidence that the ZIF8-EP nanospray system owned prominent anti-inflammatory and ROS-scavenging ability, which provided an effective and safe strategy for the treatment of ARDS.

2.1. Materials.

Zinc nitrate hexahydrate (Zn(NO₃)₂·6H₂O, 98%), 2-methylimidazole (99%) were purchased from Aladdin. Edaravone (Eda) and pentoxifylline (PTX) were purchased from MedChemExpress (MCE). Phosphate buffered saline (PBS), Dulbecco’s modified Eagle medium (DMEM), penicillin streptomycin solution, and trypsin were ordered from KeyGEN BioTECH. Unless otherwise noted, all chemicals were used without further purification. The following antibodies were used : purified anti-mouse CD16/CD32-Fc block, (101319, Biolegend), APC anti-mouse CD3 (100235 Biolegend), PE anti-mouse CD8a (100707, Biolegend), PerCP Cyanine5.5 anti-mouse CD4 (100539, Biolegend), PE anti-mouse FOXP3 (126403, Biolegend), BV421 anti-mouse F4/80 (123131, Biolegend), PE anti-mouse CD86 (159203, Biolegend), FITC anti-mouse CD206 (MMR) (141703, Biolegend), PE-cy7 anti-mouse CD11b (101215, Biolegend), APC anti-mouse Ly6G (127613, Biolegend), ELISA kits for Mouse IL-6 (431307), TNF-α (430907) IL-1b and IL-10 (431417) were purchased from Biolegend. ELISA kits for Mouse IL-8 (MOFI01258) was purchased from Genie. ELISA kits for IL-1b (1210122) was purchased from Dayou. anti-mouse P-P65 antibody, anti-mouse P-P38 antibody, anti-mouse AP-1 antibody and anti-mouse HMGB1 antibody were purchased from ProMab Biotechnologies (California, USA).

2.2. Characterization.

Scanning electron microscopy (SEM) was carried out on a Hitachi S-4800 scanning electron microscope. Transmission electron microscopic (TEM) images were obtained with a TEOL JEM-2100 transmission electron microscope. The hydrodynamic diameters were detected by dynamic light scattering measurements (Malvern Zetasizer Nano ZS instrument).

2.3. Synthesis of ZIF-8-Eda/PTX (ZIF8-EP).

0.5 mL Eda solution (DMSO, 20 mg/mL) and 0.5 mL PTX solution (DMSO, 5 mg/mL) were added into 0.4 mL Zn(NO₃)₂ solution (250 mg/mL, water) under stirring. After 5 min, 4 mL 2-methylimidazole solution (250 mg/mL, water) was added into above mixture solution, and stirred for 10 min. The product (ZIF8-EP) was collected by centrifugation at 12000 rpm for 10 min and washed with methanol and water for several times. Then, the supernatant was collected to quantify the unloaded Eda and PTX. In detail, Eda was analyzed by high performance liquid chromatography (HPLC) on an Agilent 1260 Infinity LC with Welch Xtimate C18 column (150×4.6 mm, 5µm) by gradient method with the UV detector at 210 nm. Mobile phase A: Weigh 0.77g of NH4Ac into 1000mL of water, filter with 0.45 µm membrane and ultrasonic. Mobile phase B: CAN. PTX was analyzed by high performance liquid chromatography (HPLC) on an Agilent 1260 Infinity LC with SunFire C18 column (4.6×50 mm, 3.5µm A-RP-314) by gradient method with the UV detector at 254 nm. Mobile phase A: H2O (0.01%TFA). Mobile phase B: Acetonitrile (0.01%TFA). Two control groups of ZIF-8-Eda (ZIF8-E) and ZIF-8-PTX (ZIF8-P) were obtained by same method.

2.4. the biodegradation of ZIF8-EP.

Typically, ZIF-Eda/PTX was dispersed in 5 mM PBS buffer (pH 7.4 or pH 5.6) with a concentration of 2 mg mL-1. At given intervals, TEM images were obtained for reaction system.

2.5. Cell culture.

RAW264.7 cell lines were purchased from the Sciencelight Biology Science & Technology Co., Ltd (Shanghai, China). RAW264.7 cells were cultured in DMEM containing 10% fetal bovine serum (FBS) in a humidified atmosphere of 5% CO₂ and 95% air at 37°C.

2.6. Cellular uptake behaviors of ZIF8-EP.

The cellular uptake experiment was carried out using CLSM and flow cytometry, according to different time points. in time-dependent cellular uptake analysis, RAW264.7 cells were incubated in 6-well plates with a density of 2×10⁵ cells per well for 12 h. Then cells were washed with PBS and replaced with ZIF8-EP (10 µg/mL) at different time points (2, 4 and 6 h) at 37°C. Then The cells were harvested and dispersed in PBS for uptake study by flow cytometry.

2.7. Cell viability assay.

RAW264.7 cells were seeded in a 96-well plate at a density of 10⁴ cells per well overnight. Then, the cell was incubated with ZIF-8, Eda, PTX and ZIF8-EP at different concentrations and incubated for 24 hours. After that, the media were replaced by 100 µL of fresh medium containing CCK-8 and incubated for another 1 hours. Cell viability was measured according to the protocol of CCK-8.

2.8. In vitro anti-apoptosis activity of ZIF8-EP in macrophages.

RAW264.7 cells were seeded in a 6-well plate at a density of 2×10⁵ cells/well and incubated overnight. Cells were incubated with ZIF-8, PTX, Eda and ZIF8-EP for 4 h, and then the culture medium was replaced with 1 mL of fresh medium containing 150 µM H₂O₂. After exposure, cells were trypsinized and centrifuged at 2,000 rpm for 5 min, washed with cold PBS 7.4 three times, re-suspended in binding buffer and stained with Annexin V-FITC/PI according to the instructions at room temperature in darkness for 15 min. Then the apoptotic cells were evaluated by flow cytometry.

2.9. Animals.

C57BL/6 mice (6–8 weeks) were purchased from Shanghai Laboratory Animal Center (SLAC, Shanghai, China) and bred in a sterilized, specific pathogen-free (SPF) Lab of Tongji University.

2.10. Therapeutic effects of ZIF8-EP in mice with LPS-induced ARDS.

To induce ARDS in C57BL/6 mice, 50 µL of PBS containing LPS at 5 mg/kg was administered by intratracheal (i.t.) inoculation. Then mice were randomly assigned into six groups (n = 5). At 24 h after stimulation with LPS, PBS was i.v. injected in the model group, while ZIF8-EP at 5.0 mg/kg was administered by i.t. aerosol administration. ZIF-8, Eda and PTX was administered at the same dose by i.v. administration injection in other groups. In another normal control group, healthy mice were treated with saline.

At 48 h after different treatments, mice were euthanized. the severity of pulmonary edema was evaluated by calculating the wet/dry weight ratio of lung tissues. To this end, the lungs were separated and weighed immediately to obtain the wet weight. Then the tissues were dried at 60°C for 48 h to obtain the data of dry weight. Histological sections were also made and stained with H&E. These samples were qualitatively evaluated for several histological features associated with ALI: (1) edema, fibrin deposition, and hemorrhage in three different regions: subpleural, interlobular, and alveolar locations; (2) congestion of alveolar septum; (3) cell infiltration of alveolar septum/lumina either neutrophilic or histiocytic; (4) necrosis/ cellular debris of alveolar septum; and (5) hyaline membrane changes. Histological damage scores were assigned by two individuals blinded to the experimental conditions and averaged. The scoring of the histology slide was based on the following grading scale: 1) no significant lesions; 2) < 25% tissue affected; 3) 25–50% tissue affected; 4) 50–75% tissue affected; and 5) 75–100% tissue affected. The grades were averaged from the medial and lateral sections of each lung specimen to have a score from 1 to 5 for each histological feature.

The lungs was fixed with 4% paraformaldehyde and embedded in paraffin, which was further cut into 5 µm sections for immunohistochemical staining of P-P65, P-P38, AP-1 and HMGB1 to evaluate cellular apoptosis, the tumor section was stained using aterminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling (TUNEL) assay kit (KeyGEN BioTECH, Nanjing) according to the manufacturer’s protocols.

In a separate study, the mouse trachea was exposed and a small horizontal incision was made. Then, 1.0 ml PBS was injected into the lungs, and bronchoalveolar lavage fluid was collected immediately. After three times of lavage, 1 mL of lavage fluid was withdrawn. The levels of IL-6, IL-8, IL-10, TNF-α and IL-1b in the lavage fluid were assessed by ELISA.

The expression levels of several genes were analyzed using RT-qPCR. Briefly, total RNA was extracted from lugs using TRIzol® reagent (Thermo Fisher Scientific, Inc.) and reverse transcribed using the Transcriptor First Stand cDNA Synthesis kit, according to the manufacturer's protocol. The qPCR was performed using the Fast Start Universal SYBR Master (Roche Diagnostics GmbH), and fluorescence qPCR system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The samples were subjected to 40 cycles of amplification at 95°C for 15 sec followed by 64°C for 20 sec and 72°C for 25 sec using specific primers. The threshold number of cycles (Cq) was set within the exponential phase of the PCR reaction. The ∆Cq value for each target gene was calculated by subtracting the Cq value of GAPDH (internal control) from the target gene, while relative gene expression levels were calculated by comparing the 2^−ΔΔCq values between the control and experimental conditions for each target PCR using the following equation: Relative gene expression = 2^{−(∆Cq sample−∆Cq control)}. The primer sequences used to detect the mRNA levels of target genes are listed in Table 1.

2.11. Flow cytometry assay of immune cells population.

To induce ARDS in C57BL/6 mice, 50 µL of PBS containing LPS at 5 mg/kg was administered by intratracheal (i.t.) inoculation. Then mice were randomly assigned into three groups (n = 5). At 24 h after stimulation with LPS, PBS was i.v. injected in the model group, while ZIF8-EP at 5.0 mg/kg was administered by i.t. aerosol administration. Eda + PTX was administered at the same dose by i.v. injection in other groups. Subsequently, The lungs were dispersed into single-cell suspensions. Then the neutrophils, macrophages and lymphocytes were quantitatively analyzed by flow cytometry following by immunofluorescence staining. Briefly, tissues were harvested and dispersed into single-cell suspensions by using 70 µm cell strainers, and then adding 5 mL red blood cell lysis buffer into the suspensions to lysis the red blood cells. After that, cells were collected and dispersed into 200 µL PBS. Before the cells were stained by the addition of a cocktail of fluorescence conjugated antibodies to stain cells for 30 min, 10 µL 1% BSA was added into suspensions to block the non-specific binding. Cells were analyzed via flow cytometric following staining. Data were collected on a flow cytometer (BD LSRFortessa, BD Biosciences) and analyzed using the Flowjo software (FlowJo, LCC, Ashland, OR, USA).

2.12. Statistical Analysis.

All experiments were performed at least three independent experiments. The data were presented as the mean ± standard deviation. One-way single factorial analysis of variance (ANOVA) was performed to determine the statistical significance of the data. The statistical significance of the differences was expressed as p values * < 0.05, ** < 0.01, *** < 0.001.

3.1. Preparation and Characterizations of the ZIF8-EP Nanoparticles.

The synthesis process of ZIF8-EP nanoparticles (NPs) was shown in Scheme 1 by one-pot encapsulation—Eda and PTX were mixed with zinc nitrate, followed by adding 2-methylimidazole solution. The mild and simple method could successfully package Eda and PTX into ZIF-8. Scanning electron microscopy (SEM), transmission electronic microscopy (TEM), and dynamic light scattering (DLS) results indicated that the morphologies of ZIF-8, ZIF8-E, ZIF8-P and ZIF8-EP NPs were uniform with narrow size distribution (Figure S1 and Fig. 1A-E). Compared with pure ZIF-8, X-ray diffractometry patterns of ZIF8-EP presented the similar characteristic diffraction peaks (Fig. 1F), which suggested that the encapsulating Eda and PTX didn’t break the crystallinity of ZIF-8. A characteristic broad peak of PTX at 280 nm appeared in the UV-vis absorption spectra of ZIF8-EP (Fig. 1G and S2a). Although the characteristic peak of Eda was covered by NPs absorption, the characteristic peak of Eda would be observed in the supernatant of NPs dispersion under acid condition (Figure S2b), indicating the successful encapsulating of Eda. The loading capacities of Eda and PTX were calculated about 13.9 wt.% and 6.3 wt.%, respectively by high-performance liquid chromatogr aphy (HPLC) (Figure S3).

Then, the TEM images were obtained to evaluate the changes of NPs’ morphology and degradable bebehavior under different pH conditions. As shown in Fig. 2, in the PBS solutions (5 mM, pH 7.4), the structure of NPs still kept intact after 12 h incubation. In contrast, the structure of NPs collapsed obviously after 1 h incubation under acid condition (5 mM PBS, pH 5.6), and the NPs almost disintegrated completely after 12 h incubation. The acid-unstable property was beneficial to release Eda and PTX under acid environment of pathological tissue.

3.2. Cellular Uptake, Cytotoxicity and in vitro ROS scavenging capacity of ZIF8-EP in Macrophages.

Before evaluating the feasibility of ZIF8-EP for anti-ARDS therapy, firstly, the cellular phagocytosis behavior was evaluated in RAW264.7 cells by laser confocal microscopy (CLSM) and flow cytometry. The cellular uptake efficiency of ZIF8-EP in RAW264.7 cells was monitored via rhodamine (RhB) labelled ZIF8-EP (RhB/ZIF8-EP) with red fluorescence, and cell nucleus was stained with DAPI (blue color). A substantial fluorescence intensity enhancement at the prolonged incubation duration could be observed by laser scanning confocal microscopy, indicating that RhB/ZIF8-EP NPs were internalized in the RAW264.7 cells efficiently (Fig. 3A). At the same time, the cytometric analysis also confirmed that RhB/ZIF8-EP could be endocytosed by macrophages and cellular uptake was positively associated with the incubate time (Fig. 3B-C). To gain further insight into the treatment of ARDS, the cytotoxicity was evaluated by the standard cell counting kit-8 (CCK-8) assay. As depicted in Fig. 3D, free Eda and PTX induced no toxicity toward RAW264.7 cells even at a high concentration of 200 µg/ml. ZIF8-EP exposure also showed no cytotoxicity at the same concentration. The results showed that the nanoparticles do not interfere with the growth of normal cells and have good biocompatibility.

It should be pointed out that regulating the redox homeostasis is an alternative to minimize the death of cells resulting from reactive oxygen species (ROS). The ability of ZIF8-EP to preserve macrophages against ROS-induced apoptosis was evaluated by flow cytometric analysis. To begin with, the inflammatory environment in vitro was simulated by adding hydrogen peroxide into the RAW264.7 cell culture. Then, exposure of RAW264.7 cells to 150 × 10^− 6 M H₂O₂ induced obvious apoptosis when compared with the control group treated with PBS solution via flow cytometric analysis (Fig. 3E). Notably, the group treated by ZIF8-EP significantly attenuated H₂O₂-mediated RAW264.7 cell apoptosis. It is worth mentioning that PTX and Eda also attenuated H₂O₂-mediated apoptosis to a certain extent (Fig. 3F).

3.3. Therapy of Acute Respiratory Distress Syndrome in Mice with ZIF8-EP.

ARDS is strongly associated with both oxidative stress and inflammatory responses. According to a classical approach, ARDS models in mice were successfully established by intratracheal (i.t.) instillation of lipopolysaccharide (LPS) [39]. Further, in vivo therapeutic efficacy of ZIF8-EP was evaluated in mice with ARDS. An increase in lung wet/dry weight ratio and substantive pulmonary edema were observed from the treated mice with LPS (Figure S4). This parameter was remarkably reduced after treatment with ZIF8-EP at 5.0 mg kg^− 1 by i.t. administration. In comparison, treatment with free Eda and PTX at a dose equals to 5.0 mg kg^− 1 of ZIF8-EP exhibited no obvious therapeutic effects. Compared with the LPS-induced ARDS model, ZIF8-EP treated group could significantly improve the weight loss of mice by measuring the body weight of each group for three consecutive days (Figure S5). The hematoxylin and eosin (H&E)-stained sections was also conducted to further estimate the therapeutic effect. Compared to the noninjury baseline (PBS control group), the model group showed a degree of inflammatory cells infiltration and alveolar hemorrhage, which were main feature for ARDS. ZIF8-EP by i.t. administration treatment could notably reduce the edema, fibrin deposition and hemorrhage in the interlobular and alveolar septum. Moreover, it can decrease the congestion, inflammation and necrosis of the alveolar septum (Fig. 4A). On the other hand, the group treated intravenously with PTX or Eda alone showed only partial improvement in lung inflammation. Based on the semiquantitative analysis of the injuries from the 5 histological features, the average score of ZIF8-EP group was 6.4 ± 0.4, which was obviously lower than that of the Eda group (15.8 ± 0.5) and the PTX group (14.6 ± 0.3).

Western blot was used to evaluate the expression of major inflammatory proteins in inflammatory pathways of lung tissues with different treatments (Fig. 4B-F). Compared with the LPS-induced ARDS model, PTX and Eda alone treated group could reduce the expression of inflammatory protein to a certain extent. Exciting, ZIF8-EP treated group could significantly inhibit the expression of inflammatory protein.

The ability of ZIF8-EP to eliminate ROS generated by ARDS was then investigated in animal experiments. As shown in Fig. 5A, compared with other groups, ZIF8-EP exhibited the remarkable ability to reduce ROS. Compared with the LPS induced model group, ZIF8-EP displayed obvious differences in reducing the expression levels of IL-8, IL-6, IL-1b, IL-10 and TNF-α in bronchoalveolar lavage fluid (Fig. 4G-K). Similarly, mRNA expression of IL-8, IL-6, IL-1B, IL-10 and TNF-α in lung was analyzed by RT-qPCR. Compared with the LPS induced model group, ZIF8-EP group could notably reduce the expression of inflammatory factors in lung tissues, while the Eda group and PTX group had modest effect on inflammatory factors (Fig. 4L-P). TUNEL analysis were subsequently carried out, and the results revealed that the nanoplatform attenuated ARDS-mediated cell apoptosis. Furthermore, the low expression of P-P65, P-P38, AP-1and HMGB1 in ZIF8-EP group also confirmed the strong ability to suppress inflammation (Fig. 5B-F).

3.4. ZIF8-EP Regulated Immune Cell in the Lung during ARDS.

Subsequently, the subpopulations of the infiltrated cells in the lung were assessed with focus on neutrophils, macrophages and lymphocytes, suggesting ZIF8-EP treatment by i.t. administration has the potential of lowering the amount of the neutrophil in the lung (Fig. 6A). The ability of Eda + PTX at the same dose by i.v. injection to reduce neutrophils is relatively limited. Regulatory T cells (Tregs) are a subgroup of T lymphocytes which can be used to control the response of the immune system by releasing suppressive cytokines and engaging with other cells. Furthermore, the quantity of Treg in the lung was assessed by using flow cytometry. Considerably enhanced ratio of Tregs in lung could be seen in Fig. 6B and the ratio of Tregs in lung of ZIF8-EP treated mice was almost three times than that in model mice. In comparison to the Eda + PTX treatment group, ZIF8-EP treatment also induced more Tregs in lung. Nonetheless, the number of CD4⁺ T cells in the ZIF8-EP group (42%) were lower than those in Eda + PTX group (48%) and LPS-induce model group (55%) (Fig. 6C). In addition, the M1 / M2 ratio in the ZIF8-EP (0.1) dramatically decreased compared with other groups (Eda + PTX: 1.0; LPS-induced model: 1.6) (Fig. 6D) These results showed that ZIF8-EP could activate and recruit inflammatory inhibitory Tregs and M2 macrophages and reduce pro-inflammatory immune cells, leading to reduced LPS-induced ARDS inflammation.

In conclusion, we constructed a novel nano spray with antioxidant capacity and anti-inflammatory effect by loading PTX and Eda on ZIF-8. Our study successfully proved that inhalation administration of ZIF8-EP nanospray could efficiently treat ARDS, and avoid systemic adverse reactions. In vitro experiments, ZIF8-EP protected RAW264.7 cells from oxidative stress-induced apoptosis by removing excessive ROS in cells. Moreover, ZIF8-EP had no obvious toxicity to RAW264.7 cells. In the mice model of LPS-induced ARDS, ZIF8-EP nanospray appreciably inhibited the inflammatory response and weakened the oxidative stress, and efficiently controlled the damage of ARDS to lung tissue. Our constructed nanospray therapy provided more beneficial results than corresponding control intravenous administration of small molecule drugs. Subsequently, WB, IHC, RT-qPCR and Elisa experiments verified the main mechanism of ZIF8-EP nanospray inhibiting ARDS inflammation. Finally, the regulation of ZIF8-EP on immune cells in lung tissue was demonstrated. Compared with the intravenous PTX + Eda group, the ZIF8-EP nanospray group efficiently reduced oxidative stress and suppressed inflammatory responses in diseased lungs. Furthermore, in vivo experiments showed ZIF8-EP nanospray was safe when administered via i.t. and i.v. routes. Hence, ZIF8-EP nanospray is worth to be further developed as an efficient and safe nano-therapeutic strategy of ARDS and other diseases correlated with inflammation and oxidative stress and provides a new idea for the nanotherapy for treating various inflammatory diseases.

In summary, we constructed a novel nano spray with antioxidant capacity and anti-inflammatory effect by loading PTX and Eda on ZIF-8. Our study successfully proved that inhalation administration of ZIF8-EP nanospray could efficiently treat ARDS, and avoid systemic adverse reactions. In vitro experiments, ZIF8-EP protected RAW264.7 cells from oxidative stress-induced apoptosis by removing excessive ROS in cells. Moreover, ZIF8-EP had no obvious toxicity to RAW264.7 cells. In the mice model of LPS-induced ARDS, ZIF8-EP nanospray appreciably inhibited the inflammatory response and weakened the oxidative stress, and efficiently controlled the damage of ARDS to lung tissue. Our constructed nanospray therapy provided more beneficial results than corresponding control intravenous administration of small molecule drugs. Subsequently, WB, IHC, RT-qPCR and Elisa experiments verified the main mechanism of ZIF8-EP nanospray inhibiting ARDS inflammation. Finally, the regulation of ZIF8-EP on immune cells in lung tissue was demonstrated. Compared with the intravenous PTX + Eda group, the ZIF8-EP nanospray group efficiently reduced oxidative stress and suppressed inflammatory responses in diseased lungs. Furthermore, in vivo experiments showed ZIF8-EP nanospray was safe when administered via i.t. and i.v. routes. Hence, ZIF8-EP nanospray is worth to be further developed as an efficient and safe nano-therapeutic strategy of ARDS and other diseases correlated with inflammation and oxidative stress and provides a new idea for the nanotherapy for treating various inflammatory diseases.

Ethics approval and consent to participate

All animal experiments were carried out with full authorization approved by the ethical committee for animal care of School of Medicine, Tongji University (Approval No. TJBB00722103).

Consent for publication

All authors agree to be published.

Availability of data and materials

The data are available in the main manuscript, supplementary information files, and from the corresponding authors upon reasonable request.

Competing Interest

The authors declare no competing interest.

Funding

This work was supported by the National Nature Science Foundation of China (21877084, 21671150, 81860547), the Science and Technology Commission of Shanghai Municipality (14DZ2261100, 15DZ1940106), the Fundamental Research Funds for the Central Universities (KX0150720173382), and the Foundation of Chinese Society of Clinical Oncology (Y-HR2015126, Y-MX2016018).

Authors' contributions

Ruihao Li and Xiaochun Hu. contributed equally to this work. Chunyan Dong, Shuo Shi, and Yun Lin designed and supervised the experiments and revised the manuscript. Ruihao Li and Xiaochun Hu wrote the manuscript and analyzed the data. Ruihao Li, Wenjing Wu, and Jin Xu performed animal experiments, flow cytometry analysis and analyzed the data. Wenjing Wu performed western blotting assay. Xiaochun Hu and Wenhui Li quantified PTX and EDX by HPLC and analyzed the data.

Acknowledgements

Not applicable.

E. Dong, H. Du, L. Gardner, An interactive web-based dashboard to track COVID-19 in real time, Lancet Infect. Dis. 20(5) (2020) 533-534.
Y. Wang, S. Perlman, COVID-19: Inflammatory Profile, Annu. Rev. Med. 73 (2022) 65-80.
J.C. Ginestra, O.J.L. Mitchell, G.L. Anesi, J.D. Christie, COVID-19 Critical Illness: A Data-Driven Review, Annu. Rev. Med. 73 (2022) 95-111.
F.L. van de Veerdonk, E. Giamarellos-Bourboulis, P. Pickkers, L. Derde, H. Leavis, R. van Crevel, J.J. Engel, W.J. Wiersinga, A.P.J. Vlaar, M. Shankar-Hari, T. van der Poll, M. Bonten, D.C. Angus, J.W.M. van der Meer, M.G. Netea, A Guide to Immunotherapy for COVID-19, Nat. Med. 28(1) (2022) 39-50.
C. Huang, Y. Wang, X. Li, L. Ren, J. Zhao, Y. Hu, L. Zhang, G. Fan, J. Xu, X. Gu, Z. Cheng, T. Yu, J. Xia, Y. Wei, W. Wu, X. Xie, W. Yin, H. Li, M. Liu, Y. Xiao, H. Gao, L. Guo, J. Xie, G. Wang, R. Jiang, Z. Gao, Q. Jin, J. Wang, B. Cao, Clinical Features of Patients Infected with 2019 Novel Coronavirus in Wuhan, China, Lancet 395(10223) (2020) 497-506.
G.U. Kim, M.J. Kim, S.H. Ra, J. Lee, S. Bae, J. Jung, S.H. Kim, Clinical Characteristics of Asymptomatic and Symptomatic Patients with Mild COVID-19, Clin. Microbiol. Infect. 26(7) (2020) 948.e1-948.e3.
K.C. Doerschug, G.A. Schmidt, Pulmonary Aspects of COVID-19, Annu. Rev. Med. 73 (2022) 81-93.
Z. Xu, L. Shi, Y. Wang, J. Zhang, L. Huang, C. Zhang, S. Liu, P. Zhao, H. Liu, L. Zhu, Y. Tai, C. Bai, T. Gao, J. Song, P. Xia, J. Dong, J. Zhao, F.S. Wang, Pathological Findings of COVID-19 Associated with Acute Respiratory Distress Syndrome, Lancet Respir. Med. 8(4) (2020) 420-422.
P. Vetter, D.L. Vu, A.G. L'Huillier, M. Schibler, L. Kaiser, F. Jacquerioz, Clinical Features of COVID-19, BMJ-Brit. Med. J. 369 (2020) m1470.
S. Gupta, S.S. Hayek, W. Wang, L. Chan, K.S. Mathews, M.L. Melamed, S.K. Brenner, A. Leonberg-Yoo, E.J. Schenck, J. Radbel, J. Reiser, A. Bansal, A. Srivastava, Y. Zhou, A. Sutherland, A. Green, A.M. Shehata, N. Goyal, A. Vijayan, J.C.Q. Velez, S. Shaefi, C.R. Parikh, J. Arunthamakun, A.M. Athavale, A.N. Friedman, S.A.P. Short, Z.A. Kibbelaar, S. Abu Omar, A.J. Admon, J.P. Donnelly, H.B. Gershengorn, M.A. Hernán, M.W. Semler, D.E. Leaf, Factors Associated with Death in Critically Ill Patients with Coronavirus Disease 2019 in the US, JAMA Intern. Med. 180(11) (2020) 1436-1447.
E. Fan, D. Brodie, A.S. Slutsky, Acute Respiratory Distress Syndrome: Advances in Diagnosis and Treatment, JAMA 319(7) (2018) 698-710.
M.A. Matthay, R.L. Zemans, G.A. Zimmerman, Y.M. Arabi, J.R. Beitler, A. Mercat, M. Herridge, A.G. Randolph, C.S. Calfee, Acute Respiratory Distress Syndrome, Nat. Rev. Dis. Primers 5(1) (2019) 18.
M.A. Matthay, L.B. Ware, G.A. Zimmerman, the Acute Respiratory Distress Syndrome, J. Clin. Investig. 122(8) (2012) 2731-2740.
J.F. Bermejo Martin, J.L. Jimenez, A. Muńoz-Fernández, Pentoxifylline and Severe Acute Respiratory Syndrome (SARS): a Drug to be Considered, Med. Sci. Monit. 9(6) (2003) Sr29-34.
D. Brie, A. Sahebkar, P.E. Penson, M. Dinca, S. Ursoniu, M.C. Serban, A. Zanchetti, G. Howard, A. Ahmed, W.S. Aronow, P. Muntner, G.Y. Lip, N.D. Wong, J. Rysz, M. Banach, Effects of Pentoxifylline on Inflammatory Markers and Blood Pressure: a Systematic Review and Meta-Analysis of Randomized Controlled Trials, J. Hypertens. 34(12) (2016) 2318-2329.
T. Li, N. Luo, L. Du, J. Zhou, J. Zhang, L. Gong, N. Jiang, Tumor Necrosis Factor-α Plays an Initiating Role in Extracorporeal Circulation-Induced Acute Lung Injury, Lung 191(2) (2013) 207-14.
R.P. Dickson, B.H. Singer, M.W. Newstead, N.R. Falkowski, J.R. Erb-Downward, T.J. Standiford, G.B. Huffnagle, Enrichment of the Lung Microbiome with Gut Bacteria in Sepsis and the Acute Respiratory Distress Syndrome, Nat. Microbiol. 1(10) (2016) 16113.
C.M. Hendrickson, M.A. Matthay, Endothelial Biomarkers in Human Sepsis: Pathogenesis and Prognosis for ARDS, Pulm. Circ. 8(2) (2018) 2045894018769876.
C.D. Barrett, A.T. Hsu, C.D. Ellson, Y.M. B, Y.W. Kong, J.D. Greenwood, S. Dhara, M.D. Neal, J.L. Sperry, M.S. Park, M.J. Cohen, B.S. Zuckerbraun, M.B. Yaffe, Blood Clotting and Traumatic Injury with Shock Mediates Complement-Dependent Neutrophil Priming for Extracellular ROS, ROS-Dependent Organ Injury and Coagulopathy, Clin. Exp. Immunol. 194(1) (2018) 103-117.
H. Yang, H. Lv, H. Li, X. Ci, L. Peng, Oridonin Protects LPS-induced Acute Lung Injury by Modulating Nrf2-mediated OXIDATIVE STRESS and Nrf2-independent NLRP3 and NF-κB Pathways, Cell Commun. Signal. 17(1) (2019) 62.
S. Matsumoto, M. Murozono, M. Kanazawa, T. Nara, T. Ozawa, Y. Watanabe, Edaravone and Cyclosporine A as Neuroprotective Agents for Acute Ischemic Stroke, Acute med. & surg. 5(3) (2018) 213-221.
Q. Zhi, H. Sun, X. Qian, L. Yang, Edaravone, a Novel Antidote Against Lung Injury and Pulmonary Fibrosis Induced by Paraquat?, Int. Immunopharmacol 11(1) (2011) 96-102.
T. Masuda, M. Shimazawa, H. Hara, Retinal Diseases Associated with Oxidative Stress and the Effects of a Free Radical Scavenger (Edaravone), Oxid. Med. Cell. Longev. 2017 (2017) 9208489.
A. Kuzmov, T. Minko, Nanotechnology Approaches for Inhalation Treatment of Lung Diseases, J. Control Release 219 (2015) 500-518.
S. Alipour, H. Montaseri, M. Tafaghodi, Preparation and Characterization of Biodegradable Paclitaxel Loaded Alginate Microparticles for Pulmonary Delivery, Colloids Surf. B. 81(2) (2010) 521-529.
A.B. Watts, J.I. Peters, R.L. Talbert, K.P. O'Donnell, J.J. Coalson, R.O. Williams, 3rd, Preclinical Evaluation of Tacrolimus Colloidal Dispersion for Inhalation, Eur. J. Pharm. Sci. 77(2) (2011) 207-15.
P. Allawadhi, A. Khurana, S. Allwadhi, K. Joshi, G. Packirisamy, K.K. Bharani, Nanoceria as a Possible Agent for the Management of COVID-19, Nano today 35 (2020) 100982.
C.Y. Zhang, W. Lin, J. Gao, X. Shi, M. Davaritouchaee, A.E. Nielsen, R.J. Mancini, Z. Wang, pH-Responsive Nanoparticles Targeted to Lungs for Improved Therapy of Acute Lung Inflammation/Injury, ACS Appl. Mater. Interfaces 11(18) (2019) 16380-16390.
P. Prasanna, S. Rathee, A. Upadhyay, S. Sulakshana, Nanotherapeutics in the Treatment of Acute Respiratory Distress Syndrome, Life Sci. 276 (2021) 119428.
M. Zoulikha, Q. Xiao, G.F. Boafo, M.A. Sallam, Z. Chen, W. He, Pulmonary Delivery of siRNA Against Acute Lung Injury/Acute Respiratory Distress Syndrome, Acta Pharm. Sin. B. 12(2) (2022) 600-620.
H.J. Liu, P. Xu, Smart Mesoporous Silica Nanoparticles for Protein Delivery, Nanomaterials 9(4) (2019) 113-119.
B. Sui, M. Wang, C. Cheng, Q. Zhang, J. Zhang, D. Fan, P. Xu, Nanogel-facilitated Protein Intracellular Specific Degradation through Trim-Away, Adv. Funct. Mater. 31(30) (2021) 112-121.
L. Ding, S. Tang, W. Tang, D.D. Mosley, A. Yu, D. Sil, S. Romanova, K.L. Bailey, D.L. Knoell, T.A. Wyatt, D. Oupický, Perfluorocarbon Nanoemulsions Enhance Therapeutic siRNA Delivery in the Treatment of Pulmonary Fibrosis, Adv. Sci. 9(8) (2022) e2103676.
X. Jing, H. Hu, Y. Sun, B. Yu, H. Cong, Y. Shen, The Intracellular and Extracellular Microenvironment of Tumor Site: The Trigger of Stimuli-Responsive Drug Delivery Systems, Small methods 6(3) (2022) e2101437.
A.R. Afshari, M. Sanati, H. Mollazadeh, P. Kesharwani, T.P. Johnston, A. Sahebkar, Nanoparticle-based Drug Delivery Systems in Cancer: A Focus on Inflammatory Pathways, Semin. Cancer Biol. 86(2) (2022) 860-872.
L. Gao, Q. Chen, T. Gong, J. Liu, C. Li, Recent Advancement of Imidazolate Framework (ZIF-8) Based Nanoformulations for Synergistic Tumor Therapy, Nanoscale 11(44) (2019) 21030-21045.
R. Ricco, P. Wied, B. Nidetzky, H. Amenitsch, P. Falcaro, Magnetically Responsive Horseradish Peroxidase@ZIF-8 for Biocatalysis, Chem. Commun. 56(43) (2020) 5775-5778.
X. Lian, Y. Fang, E. Joseph, Q. Wang, J. Li, S. Banerjee, C. Lollar, X. Wang, H.C. Zhou, Enzyme-MOF (Metal-Organic Framework) Composites, Chem. Soc. Rev. 46(11) (2017) 3386-3401.
J. Guo, H. Tao, Y. Dou, L. Li, X. Xu, Q. Zhang, J. Cheng, S. Han, J. Huang, X. Li, X. Li, J. Zhang, A Myeloperoxidase-Responsive and Biodegradable Luminescent Material for Real-Time Imaging of Inflammatory Diseases, Mater. Today 20(9) (2017) 493-500.

Scheme 1 is available in the Supplementary Files section.

Table 1. Primer sequences.

Primer	Sequence (5′-3′)
mouse IL-1b F-primer	GCCACCTTTTGACAGTGATGAG
mouse IL-1b R-primer	ACGGGAAAGACACAGGTAGC
mouse IL-6 F-primer	CCGGAGAGGAGACTTCACAG
mouse IL-6 R-primer	TCCACGATTTCCCAGAGAAC
mouse IL-8 F-primer	CCATGGGTGAAGGCTACTGT
mouse IL-8 R-primer	TAGAGGTCTCCCGAATTGGA
mouse IL-10 F-primer	CCAAGCCTTATCGGAAATGA
mouse IL-10 R-primer	TTTTCACAGGGGAGAAATCG
mouse TNF-α F-primer	ACGGCATGGATCTCAAAGAC
mouse TNF-α R-primer	GTGGGTGAGGAGCACGTAGT
mouse GAPDH Forward	AGGTCGGTGTGAACGGATTTG
mouse GAPDH Reverse	TGTAGACCATGTAGTTGAGGTCA

No competing interests reported.

SupplementaryFiles.docx
Scheme1.png
Scheme 1. (A) The synthetic route of ZIF8-EP. (B) Schematic illustration of the application of ZIF8-EP nanospray for ARDS therapy.

Download PDF

Version 1

posted

You are reading this latest preprint version

Nebulized pH-Responsive Nanospray Combined with Pentoxifylline and Edaravone to Lungs for Efficient Treatments of Acute Respiratory Distress Syndrome

Status:

Version 1

Abstract

Background

Results

Conclusion

Figures

1. Introduction

2. Experiment Section

2.1. Materials.

2.2. Characterization.

2.3. Synthesis of ZIF-8-Eda/PTX (ZIF8-EP).

2.4. the biodegradation of ZIF8-EP.

2.5. Cell culture.

2.6. Cellular uptake behaviors of ZIF8-EP.

2.7. Cell viability assay.

2.8. In vitro anti-apoptosis activity of ZIF8-EP in macrophages.

2.9. Animals.

2.10. Therapeutic effects of ZIF8-EP in mice with LPS-induced ARDS.

2.11. Flow cytometry assay of immune cells population.

2.12. Statistical Analysis.

3. Results And Discussion

3.1. Preparation and Characterizations of the ZIF8-EP Nanoparticles.

3.2. Cellular Uptake, Cytotoxicity and in vitro ROS scavenging capacity of ZIF8-EP in Macrophages.

3.3. Therapy of Acute Respiratory Distress Syndrome in Mice with ZIF8-EP.

3.4. ZIF8-EP Regulated Immune Cell in the Lung during ARDS.

4. Conclusion

Declarations

References

Scheme 1

Table 1

Additional Declarations

Supplementary Files

Status:

Version 1