Leptin reduces autophagy and improves the survival of human chondrocytes induced by inflammation through the mTOR signaling pathway

doi:10.21203/rs.3.rs-2576503/v1

Download PDF

Research Article

Leptin reduces autophagy and improves the survival of human chondrocytes induced by inflammation through the mTOR signaling pathway

https://doi.org/10.21203/rs.3.rs-2576503/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective: This study aims to investigate the effects of leptin on human chondrocytes in vitro from the autophagy regulated by the mammalian target of rapamycin(mTOR)signaling pathway.

Methods: Human articular chondrocyteswere isolated and cultured. Chondrocytes were identified by Toluidine blue staining and Col II immunocytochemistry staining. Chondrocytes were assigned into the blank group, Interleukin-1β (IL-1β) group, leptin group, leptin+IL-1β group, leptin+leptin antagonistgroup, and leptin+leptin antagonist+IL-1β group. Cell proliferation and apoptosis were detected byCell Counting Kit-8 (CCK8) and flow cytometry respectively. Cell autophagy was detected by Monodansylcadaverine(MDC) staining and mRFP-GFP-LC3fluorescence microscopy was utilized to evaluate autophagy rates.

Results: The result of CCK8 assay presented the cell proliferation rate of had no difference between the leptin group and the blank group, and IL-1β group was lower, leptin+IL-1β group was in the middle. In flow cytometry, the apoptosis rate of the leptin+IL-1β group was the lower than IL-1β group. MDC-positive staining cells and the level of autophagy showed despite the autophagy rate was increased in IL-1β group, but in leptin+IL-1β group, the autophagy rate was decreased. Quantitative real-time PCR(QRT-PCR) and Western blotting showed the mRNA expressions of Atg5 and Atg7 and the protein expressions of LC3B were corresponded with the level of autophagy. But the expressions of mTOR protein was opposite changed.

Conclusions: IL-1β could inhibit human chondrocyte proliferation and up-regulation of the level of autophagy. Leptin could attenuate the effect of IL-1β on chondrocytes and down-regulation the autophagy, the mechanism may be related to the mTOR signaling pathway.

Chondrocytes

Leptin

Autophagy

Mechanism

Osteoarthritis(OA) is known as the most common degenerative joint disease presented in the aged population, which is characterized by cartilage degradation, synovial inflammation, and subchondral bone remodeling^[1]. There are many risk factors such as genetics, gender, trauma, age, and obesity that could provoke articular cartilage degeneration injuries, among which obesity-related cartilage degeneration has attracted much attention. It has been recognized that excessive weight may lead to cartilage degeneration by increasing the mechanical forces across weight-bearing joints^[2]. However, the joint load is not the only cause of obesity-related OA, it can also be seen in non-weight-bearing joints in obese patients, such as fingers and elbows. There is high levels of leptin both in the articular cavity and plasma among patients with obesity-related OA^[3], indicating that leptin may play an important role in the pathophysiology of OA^[4].

Leptin as a small polypeptide composed of 167 amino acids is the first adipocyte-derived hormone to be described in 1994^[5]. It is important for maintaining energy homeostasis and regulating metabolism^[6]. Leptin has been extensively associated with cartilaginous metabolism and OA^[7]. However, contradictory reports exist on the effect of leptin on chondrocyte. On the one hand, Leptin promotes chondrocyte proliferation and protects cartilage by increasing chondrocyte gene expression^[8]. Leptin also could against the death of chondrocytes induced by TNF-α and protect articular cartilage from mechanical load damage^[9]. On the other hand, leptin present in the articular cavity of rats promotes the catabolism of cartilage by increasing the levels of MMP-2, MMP-9, and cathepsin D^[10]. In addition, leptin has been demonstrated to act synergically with IL-1β to promote the expression of pro-inflammatory factors in chondrocytes^[11]. Recently, it was demonstrated that there is a strong correlation between the serum leptin level and obesity-related OA, meanwhile, the high level of leptin in synovial fluid(SF) induces the JAK2-STAT3 signaling pathway, which accelerates the development of OA^[12]. Altogether, according to these findings, it still need more investigation to reveal the mechanism of leptin on chondrocytes under different conditions.

The mTOR is a serine/threonine kinase involved in cell growth, metabolism, survival, and death of organisms^[13]. Suppression of autophagy is another function of mTOR^[14]. Autophagy is important for maintaining normal cellular homeostasis^[15], the imbalance of chondrocyte autophagy and apoptosis contributes to the development of OA^{[16, 17]}. It has been reported that up-regulates autophagy by targeting mTOR could protect mice from OA^[18]. In adition, autophagy can prevent premature apoptosis of mature chondrocytes, it represents a protective mechanism in the development of OA^[19], and activation of autophagy can reduce the severity of osteoarthritis by inhibiting the aging of chondrocytes^[20], and increased autophagy is an adaptive response to protect cartilage from mechanical loading^[21]. mTOR signaling pathway also has an essential role in response to inflammation^[22], and it is a consensus that the inflammation present in the articular cavity has the ability to damage cartilage. Moreover, It has been revealed that leptin-induced mTOR activation may be involved to obesity-related diseases^[23], mTOR signaling is also involved in chondrocyte senescence^[24], and leptin and mTOR are partners in metabolism and inflammation, both in the hypothalamic centers and in peripheral cells^[25].

Now, both leptin and mTOR have been well-studied. However, the interaction between the effects of leptin on articular cartilage and the mTOR signaling pathway is rarely studied. This study was designed to investigate the effects of leptin on human chondrocytes in vitro from autophagy regulated by the mTOR signaling pathway.

2.1. Ethical statement.

Human clinical samples were obtained from patients who underwent total knee arthroplasties because of OA after informed consent and approval from the Ethics Committee of The First Affiliated Hospital of Chongqing Medical University and Chongqing Traditional Chinese Medicine Hospital (Chongqing, China).

2.2. Isolation and culture of human articular chondrocytes.

The cartilage tissue was obtained from OA patients and transfer to the laboratory for primary separation immediately. Briefly, the articular cartilage surface was cut off in sterile conditions. The cartilage was washed three times with PBS(Sangon, China), and then cut into 1mm³ pieces with ophthalmic scissors. All the cartilage tissue was transferred into a centrifuge tube and 0.25% trypsin(Beyotime, China)was added, the mixture was cultured in an incubator at 37℃ for 30min. Subsequently, centrifugation at 1000r/min for 8min was procedure, and the supernatant was discarded. The mixture was washed with PBS, and then incubated at 37℃ for digestion overnight supplemented with 0.2% type II collagenase(Sigma, American). The mixture was sieved with a 200 mesh strainer and centrifuged at 1500r/min for 5min. After that, the supernatant was discarded, and then resuspended in DMEM/F12(Gibco, American) supplemented with 10% FBS(Gibco, American) in a 5% CO₂ cell incubator at 37℃ for 48h. The medium was changed once every three days, cell subculture was carried out when cell fusion reached 80%.

2.3. Identification of human articular chondrocytes.

Toluidine blue staining was utilized for the identification of human articular chondrocytes. Cells were resuspended with a complete medium after the chondrocytes were digested and then inoculated in 12-well plates at a density of 2×10⁴/mL with sterile coverslips. Once cell adherence was completed, cells were washed three times with PBS. Afterward, cells were treated with 4% paraformaldehyde(Sangon, China) for 20min, and washed three times with PBS again. After which, cells were stained with toluidine blue(Leagene, China) dye for 10min. The stained plates were washed with water, and observation under the light microscope was carried out after drying.

Col II immunocytochemistry staining was also utilized for identiﬁcation of chondrocytes. Cells were washed three times with PBS after being fixed in paraformaldehyde for 20min. 3% H₂O₂(Sinopharm, China) was added for cell incubation for 15min, and a PBS wash was performed as before. The first antibody (1:100)(Affinity, American) was added to the culture and incubated at 4℃ overnight, and then washed three times with PBS as before. The second antibody(1:50)(Beyotime, China) was added for incubation at room temperature for 60min, followed by PBS washing three times. Microscopic observation was performed with DAB(Jiancheng, China) solution added. Washed with distilled water two times, the cells were counterstained with hematoxylin(Jiancheng, China) for 5min, and washed with tap water. Finally, cells were sealed with neutral gum(Zsgb, China). The prepared specimens were reserved for microscopic observation.

2.4. Cell groups.

The second generation of human chondrocytes was selected for this experiment. Cells were grouped as follows: blank group(chondrocytes were cultured in blank medium), IL-1β group(chondrocytes were cultured with IL-1β(10ng/ml, MCE, American)), leptin group(chondrocytes were cultured with leptin(200ng/ml, Abcam, British)), leptin+IL-1β group(chondrocytes were cultured with leptin and IL-1β), leptin+leptin antagonist group (chondrocytes were cultured with leptin and leptin antagonist(200ng/ml, ProSpec, Israeli)), leptin+leptin antagonist+IL-1β(chondrocytes were cultured with leptin, leptin antagonist and IL-1β).

2.5. CCK-8 assay.

Human chondrocytes were digested into single-cell suspension with 0.25% trypsin and then inoculated in 96-well plates with 6 multiple wells in each group at a density of 2×10⁴/well in a 5% CO₂ cell incubator at 37℃. Add samples according to cell groups after the adherent cells density reached about 60%, Culture was continued for 24h and 48h. After adding 10μl of CCK-8(Yeasen, China) in each well, the plates were cultured at 37℃ with 5% CO₂ for 4h, and then the value of optical density(OD) of each group was detected at 450nm wavelength. Cells were not treated with any served as the control group. All experiments were performed in triplicate.

2.6. Flow cytometry.

Human chondrocytes with corresponding treatments of each group as before. After 48h for culture, cells were digested with trypsin at 37℃ for 5min, centrifugation at 1000r/min for 5min was procedure, and the supernatant was discarded. The cells were collected and resuspended in DPS. Afterward, suspended cells were centrifuged at 1000r/min for 5min in a 1.5ml EP tube. The supernatant was discarded and resuspended again in DMEM/F12 supplemented with 195μl Annexin V-FITC(Yeasen, China). Another 5μl Annexin V-FITC was added and incubated at room temperature away from light for 10min. Cells were centrifuged as before, the supernatant was discarded and resuspended. Then, 10μl propidium iodide(Yeasen, China) was added and the cell mortality rate was detected by flow cytometer.

2.7. Monodansylcadaverine(MDC) staining.

Cells with corresponding treatments of each group as before. 250μl MDC (Beyotime, China) was added into each group and incubated for 30min at 37℃ away from light. Washed with Assay Buffer three times. Green fluorescence was observed by uv excitation under the fluorescence microscope.

2.8. Cell transfection and mRFP-GFP-LC3 fluorescence microscopy.

Cells were inoculated in 24-well plates at a density of 2×10⁵/well. Transfection was conducted when cells grew to the logarithmic stage, 250ul mRFP- GFP-LC3 adenovirus(Hanbio, China) was added to each well, followed by medium changes after 6h of cell cultured. Cells with corresponding treatments of each group as before and incubated for 48h at 37℃ on the next day. Afterward, cells were fixed in 4% paraformaldehyde for 30min, and LC3 positive punctate pattern was observed under the fluorescence microscope after DAPI was added.

2.9. Quantitative RT-PCR analysis.

The total RNA was extracted from human chondrocytes by using the RNAiso Plus kit(Takara, Japan) according to the manufacturer’s instructions. The quality and concentration of each RNA sample were determined by ultramicro spectrophotometer. The primers used for qRT-PCR were designed in accordance with the nucleotide sequence of Atg5 and Atg7 in NCBI, and the primer pairs were synthesized by ThermoFisher. All the results were shown in Table 1. RNA quantification was performed using the Hifair® Ⅱ 1st Strand cDNA Synthesis Kit (gDNA digester plus)(Yeasen, China). RT-PCR was performed on the AB Step One Plus Real-Time PCR System(Applied Biosystems AB, American) by using Hieff UNICON^® Universal Blue qPCR SYBR Green Master Mix(Yeasen, China). The β-actin gene was used as the reference gene, and the fold increase in PCR was calculated by using the 2^−ΔΔCt method.

2.10. Western blotting.

The total cellular proteins were harvested from cell lysates using RIPA(Beyotime, China), which were placed on ice for several minutes and collected in the centrifuge tube. Followed by oscillating violently for 30sec, and then the mixture was centrifuged at 12,000r/min for 15min at 4℃. The supernatant was collected in an EP tube and quantified by the bicinchoninic acid (BCA)method. The samples were mixed with 5×SDS loading buffer in a ratio of 4:1 and then boiled in boiling water for 10min for SDS–PAGE electrophoresis. After adding enough electrophoresis solution, sample the protein in an equal amounts. Wet transmembrane(PVDF membrane) was performed after transferring 80v electrophoresis to 120v, meantime, the electrophoresis solution was replaced with the transfer solution. Afterward, membranes were blocked at room temperature for 1h with 5% skimmed milk powder and incubated overnight with primary antibodies at 4℃, as follows:mTOR(1:1000, Huabio, China), LC3B(1:1000, CST, American), β-actin(1:1000, Huabio, Chin). After which, the membranes were washed with TBST three times for 5min each and incubated with the second antibody(1:1000, Beyotime, China) at room temperature for 1h, and then the membranes were washed with TBST four times for 5min each. Finally, the membranes were filmed with chemiluminescence. β-actin was selected as the reference and the gray level analysis was measured using Labworks^TM Analysis Software.

2.11. Statistical analysis.

Statistical analysis was performed with a one-way analysis of variance(ANOVA) using the software packages SPSS (version 26.0; IBM Corporation, Armonk, NY, USA) . All data were calculated as the means and standard deviations. All the fluorescent intensities of images were analyzed by using the Image J software. All results were obtained from at least three repeated experiments. p< 0.01 was considered to indicate statistical significance.

3.1. Morphology of human chondrocytes.

Inverted phase contrast microscope was performed to observe the morphology of human chondrocytes. It was shown that cells adherent growth appeared at about 24h, they were triangular or polygonal in shape and slow growing. However, the rapid proliferation stage of cells could be observed after 3d to 5d(Figure 1A). Chondrocytes were stained with toluidine blue and observed under the a light microscope. It was shown that the nuclei were stained with dark blue, while the cytoplasm and extracellular matrix were pale blue(Figure 1B). Col II immunochemical staining demonstrated that the isolated cells were chondrocytes because of specific Col II synthesized and secreted by chondrocyte was dyed brown(Figure 1C).

3.2. Leptin suppressed IL-1β induced chondrocyte death.

CCK-8 assay was utilized to detect the activity of cell proliferation in each group. It showed that the OD value of the IL-1β group was significantly lower than the blank group after being cultured for 24h and 48h (p<0.01), compared with the IL-1β group, the OD value of the leptin+IL-1β group was higher(p<0.01), however, the OD value of the leptin+leptin antagonist+IL-1β group was lower the leptin+IL-1β group(p<0.01). In our study, we found that there was no statistical difference between the blank group and the leptin group, but leptin attenuated the inhibitory effect of IL-1β on chondrocytes(Figure 2A).

The same results were also shown in the flow cytometry. Compared with the blank group, the apoptosis rate of the IL-1β group was increased(p<0.01), while the apoptosis rate of the leptin group and leptin+leptin antagonist group did not change significantly. Compared with IL-1β group, the apoptosis rate of the leptin+IL-1β group was significantly decreased(p<0.01). The apoptosis rate of the leptin+leptin antagonist+IL-1β group was significantly higher than the leptin+IL-1β group(p<0.01). It was still the same as before, there was no effect on the chondrocytes in the presence of leptin only(Figure.2B).

3.3 Leptin inhibited autophagy of chondrocytes.

MDC staining was applied to observe chondrocyte autophagy changes in each group. Compared with the blank group, there was an increasing number of MDC-positive staining cells in the IL-1β group, indicating that the autophagy was enhanced(p<0.01). Meantime, autophagy was decreased in the leptin group compared with the blank group(p<0.01). Compared with the IL-1β group, autophagy was decreased in the leptin+IL-1β group(p<0.01). Cell autophagy was increased in the leptin+leptin antagonist+IL-1β group compared with the leptin+IL-1β group(p<0.01)(Figure.3A).

As shown in Figure.3B, mRFP-GFP-LC3 fluorescence microscopy illustrated the same results, there was a higher level of autophagy in the IL-1β group compared with the blank group(p<0.01), and a lower level of autophagy in the leptin group. Compared with the IL-1β group, there was a decreasing autophagy in the group of leptin+IL-1β group(p<0.01), and the level of autophagy in the group of leptin+leptin antagonist+IL-1β had increased compared with the leptin+IL-1β group(p<0.01).

3.4 Leptin attenuated the mRNA expressions of autophagy-related genes.

Compared with the blank group, the mRNA expressions of autophagy-related genes (Atg5 and Atg7) in the IL-1β group were significantly increased(p<0.01), while the mRNA expressions of Atg5 and Atg7 in the leptin group were decreased(p<0.01). Meanwhile, the mRNA expressions of Atg5 and Atg7 in the group of leptin+IL-1β were decreased compared with the IL-1β group(p<0.01). The mRNA expressions in the leptin+leptin antagonist+IL-1β were increased compared with the leptin+IL-1β group(p<0.01)(Table 2 and Figure.4).

3.5 Leptin attenuated the expression of autophagy-related proteins.

Furthermore, western blot assay was utilized to detect the levels of autophagy-related proteins(LC3B and mTOR). Western blotting analysis illustrated that the protein of LC3B in the IL-1β group was increased compared with the blank group, while the protein of mTOR was decreased(p<0.01). The opposite was true in the leptin group. Compared with the IL-1β group, LC3B protein expression was decreased and mTOR protein expression was increased in the leptin+IL-1β group(p<0.01). Compared with the leptin+IL-1β group, the level of LC3B was increased and mTOR was decreased in the leptin+leptin antagonist+IL-1β group(p<0.01)(Table 3 and Figure.5).

Osteoarthritis(OA) is the most common joint disease in the world, and the main pathological feature is cartilage damage. More than that, it is also a complex disorder condition of the whole joint, cartilage, subchondral bone, synovium, and infrapatellar fat pad(IPFP) probably all have key roles in disease pathogenesis^[26]. However, the current treatment of OA is still not satisfactory although OA had been studied widely and well^[27]. In our study, we found leptin could promote the survival rate of human chondrocytes induced by inflammation through the effect of autophagy, and the mechanism may be related to the mTOR signaling pathway. This founding maybe provide a potential target for the treatment of OA.

Diverse risk factors give rise to OA, local inflammation is the common manifestation. IL-1β, as a kind of cytokine, has strong proinflammatory activity, meanwhile, IL-1β also can lead to cartilage degeneration by up-regulating matrix metalloproteinases (MMPs) and down-regulating extracellular matrix synthesis of chondrogenic^[28]. In our study, it has been demonstrated that human chondrocyte proliferation could be significantly inhibited by IL-1β. Interestingly, we were surprised to find that the effect of autophagy was enhanced in the group that IL-1β presented. Autophagy, as an important mechanism for maintaining cell energy homeostasis, is also critical for the metabolism of chondrocytes^[29]. Previous research has mostly revealed autophagy can repair the function of a damaged chondrocytes, and antagonize the occurrence and development of OA^{[30, 31]}, however, our study showed the opposite, we speculated that it may be related to the following circumstances. First, the cartilage tissue specimen came from the patients of OA, it had reported that autophagic activity was increased in OA patients, meanwhile, autophagy did not lead to the death of young chondrocytes, but it could induce chondrocyte death in OA patients, suggested that autophagy may play a dual role in protecting chondrocyte and promoting chondrocyte death in the pathogenesis of OA^[32]. It had also been found that autophagy could be activated as a mechanism to avoid chondrocyte death in the early stage of OA, while in the late stage of OA, it could be activated together with apoptosis as an alternative pathway of cell death^[33]. Second, our results may come from excessive autophagy, as we know the sustained excessive level of autophagy could damage proteins and intracellular organelles, and eventually causes cell death^[34]. Ma L et al. has reported that fluoride-induced apoptosis of chondrocyte through excessive autophagy^[35]. Therefore, autophagy is a complicated mechanism, we suggest whether autophagy promotes chondrocyte survival or death depends on age, the stage of progression of OA, and the level of autophagy.

Leptin as a kind of adipokine, it had been reported to have a strong positive correlation with both in diagnosis and severity of knee OA^[36], it is also one of the most promising synovial fluid(SF) biomarkers^[37]. That is according with our previous research, there is a higher concentrations of leptin in the knee joint of OA, especially among overweight people. Currently, there are conflicting evidence about the effect of leptin on chondrocyte, it is still unclear whether leptin in the articular cavity is associated with chronic low-grade systemic inflammation caused by obesity or with local inflammatory stimulation. In our study, we found that there was no effect of leptin on chondrocytes, but as the result came from the CCK-8 assay and Flow cytometry, leptin could alleviate the effect of inhibition of IL-1β on chondrocytes obviously. Furthermore, we investigated the effect of autophagy of chondrocytes in the presence of leptin, as described previously, the effect of autophagy decreased in the presence of leptin, and leptin antagonist reversed the effect of leptin. In other words, leptin alleviated the autophagy of IL-1β on chondrocytes.

Moreover, autophagy-related genes(Atg5 and Atg7) and proteins(LC3B and mTOR) were detected. The results showed that the level of autophagy was decreased in the presence of leptin. LC3B as one of the mammalian Atg8 homologs, conjugation with phosphatidylethanolamine is essential for phagophore expansion and autophagosome formation^[38]. LC3B has been accepted as an autophagosome marker and used to detect autophagic activity^[39]. In our experiments, leptin-induced low expression of LC3B represented low autophagic activity, which was consistent with previous results. mTOR is a key regulator of cell growth, proliferation, motility, survival, and autophagy^[13]. mTOR and other proteins can form functionally distinct protein complexes known as mTORC1 and mTORC2. mTORC1 can promote the production of protein, lipid, nucleotide, and ATP, and inhibit autophagy of intracellular. The mechanism of mTORC2 is still unclear, there is evidence that it can synergize with AKT to reinforce the phosphorylation layer that regulates localization and activity^[40]. Down-regulation of mTOR could promote the proliferation of chondrocytes and autophagy, as well as increase extracellular matrix(ECM) synthesis^[41]. However, what we found was the expression of mTOR had been up-regulated by leptin, down-regulated the autophagy, and increased the chondrocyte survival rate, which was contrary to the effect of IL-1β on chondrocytes. Autophagy-related genes Atg5 and Atg7 are important for the formation of autophagosome structures, Atg5 is a part of the ATG12-ATG5 complex, acting as an E3-like enzyme in LC3 lipidation and works with Atg16. Atg7 is involved in the conjugation of LC3 and ATG12^[42]. Decreasing expressions of Atg5 and Atg7 indicated low autophagic activity. In our study, Atg5 and Atg7 were decreased significantly in the presence of leptin, these results also demonstrate that leptin reduced the autophagy of chondrocytes.

In summary, our experiment demonstrated that IL-1β has the ability of inhibiting human chondrocyte proliferation and up-regulation of autophagy level, additionally, leptin could reverse the effect of IL-1β and down-regulation cell autophagy, the mechanism may be related to the mTOR signaling pathway. However, due to limited funding and time, we failed to conduct animal experiments to investigate whether IL-1β and leptin are consistent with in vitro experiments. Therefore, it is necessary to further investigate the effect of leptin on chondrocyte autophagy through the mTOR signaling pathway, which could provide a new strategy for the prevention and treatment of OA.

MDC, Monodansylcadaverine

IL-1β, Interleukin-1β

QRT-PCR, Quantitative real-time PCR

OA, Osteoarthritis

mTOR, mammalian target of rapamycin

Acknowledgments

The authors would like to thank all the members of their department for their contributions.

Funding Sources

Medical research project of Chongqing Talents Program (Grant No. CQYC202010).

Data availability statement

All data and code generated or used during the study appear in the submitted article.

Statement of Ethics

This study was approved according to the ethical guidelines of the First Affiliated Hospital of Chongqing Medical University (institutional review board) and Chongqing Traditional Chinese Medicine Hospital (institutional review board). This study was performed according to the Declaration of Helsinki. Written informed consent was obtained from the patients.

Conflict of interest

The authors declare that there are no conflicts of interest regarding the publication of this paper.

Authors' Contributions

Ping Li designed and performed the study, analyzed and interpreted data, wrote and

revised the manuscript. Junnan Li revised the manuscript. Qiming Yang performed

the study. Yang Lu performed the study. Jian Zhang guided the study and revised the

manuscript. All authors read and approved the final manuscript.

Hunter DJ, Bierma-Zeinstra S. Osteoarthritis. Lancet. 2019. 393(10182): 1745–1759.
Wang T, He C. Pro-inflammatory cytokines: The link between obesity and osteoarthritis. Cytokine Growth Factor Rev. 2018. 44: 38–50.
Jarecki J, Małecka-Massalska T, Polkowska I, et al. Level of Adiponectin, Leptin and Selected Matrix Metalloproteinases in Female Overweight Patients with Primary Gonarthrosis. J Clin Med. 2021. 10(6).
Ait Eldjoudi D, Cordero Barreal A, Gonzalez-Rodríguez M, et al. Leptin in Osteoarthritis and Rheumatoid Arthritis: Player or Bystander. Int J Mol Sci. 2022. 23(5).
Yan M, Zhang J, Yang H, Sun Y. The role of leptin in osteoarthritis. Medicine (Baltimore). 2018. 97(14): e0257.
Perakakis N, Farr OM, Mantzoros CS. Leptin in Leanness and Obesity: JACC State-of-the-Art Review. J Am Coll Cardiol. 2021. 77(6): 745–760.
Cordero-Barreal A, González-Rodríguez M, Ruiz-Fernández C, et al. An Update on the Role of Leptin in the Immuno-Metabolism of Cartilage. Int J Mol Sci. 2021. 22(5).
Fu R, Han F, Liu L, et al. The Effects of Leptin on the Proliferation and Differentiation of Primary Chondrocytes in Vitro and Cartilage Regeneration in Vivo. ACS Biomater Sci Eng. 2019. 5(4): 1907–1919.
Lee SW, Rho JH, Lee SY, et al. Leptin protects rat articular chondrocytes from cytotoxicity induced by TNF-α in the presence of cyclohexamide. Osteoarthritis Cartilage. 2015. 23(12): 2269–2278.
Bao JP, Chen WP, Feng J, Hu PF, Shi ZL, Wu LD. Leptin plays a catabolic role on articular cartilage. Mol Biol Rep. 2010. 37(7): 3265–72.
Gómez R, Scotece M, Conde J, Gómez-Reino JJ, Lago F, Gualillo O. Adiponectin and leptin increase IL–8 production in human chondrocytes. Ann Rheum Dis. 2011. 70(11): 2052–4.
Jiang M, He J, Sun Y, et al. Leptin Induced TLR4 Expression via the JAK2-STAT3 Pathway in Obesity-Related Osteoarthritis. Oxid Med Cell Longev. 2021. 2021: 7385160.
Battaglioni S, Benjamin D, Wälchli M, Maier T, Hall MN. mTOR substrate phosphorylation in growth control. Cell. 2022. 185(11): 1814–1836.
Wang Y, Zhang H. Regulation of Autophagy by mTOR Signaling Pathway. Adv Exp Med Biol. 2019. 1206: 67–83.
Mizushima N, Levine B. Autophagy in Human Diseases. N Engl J Med. 2020. 383(16): 1564–1576.
Yang H, Wen Y, Zhang M, et al. MTORC1 coordinates the autophagy and apoptosis signaling in articular chondrocytes in osteoarthritic temporomandibular joint. Autophagy. 2020. 16(2): 271–288.
Hwang HS, Kim HA. Chondrocyte Apoptosis in the Pathogenesis of Osteoarthritis. Int J Mol Sci. 2015. 16(11): 26035–54.
Zhang Y, Vasheghani F, Li YH, et al. Cartilage-specific deletion of mTOR upregulates autophagy and protects mice from osteoarthritis. Ann Rheum Dis. 2015. 74(7): 1432–40.
Valenti MT, Dalle Carbonare L, Zipeto D, Mottes M. Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic Strategies. Int J Mol Sci. 2021. 22(5).
Caramés B, Hasegawa A, Taniguchi N, Miyaki S, Blanco FJ, Lotz M. Autophagy activation by rapamycin reduces severity of experimental osteoarthritis. Ann Rheum Dis. 2012. 71(4): 575–81.
Zheng W, Li X, Liu D, et al. Mechanical loading mitigates osteoarthritis symptoms by regulating endoplasmic reticulum stress and autophagy. FASEB J. 2019. 33(3): 4077–4088.
Suto T, Karonitsch T. The immunobiology of mTOR in autoimmunity. J Autoimmun. 2020. 110: 102373.
Haissaguerre M, Saucisse N, Cota D. Influence of mTOR in energy and metabolic homeostasis. Mol Cell Endocrinol. 2014. 397(1–2): 67–77.
Zhao X, Huang P, Li G, Lv Z, Hu G, Xu Q. Activation of the leptin pathway by high expression of the long form of the leptin receptor (Ob-Rb) accelerates chondrocyte senescence in osteoarthritis. Bone Joint Res. 2019. 8(9): 425–436.
Maya-Monteiro CM, Bozza PT. Leptin and mTOR: partners in metabolism and inflammation. Cell Cycle. 2008. 7(12): 1713–7.
van den Bosch M. Osteoarthritis year in review 2020: biology. Osteoarthritis Cartilage. 2021. 29(2): 143–150.
Arden NK, Perry TA, Bannuru RR, et al. Non-surgical management of knee osteoarthritis: comparison of ESCEO and OARSI 2019 guidelines. Nat Rev Rheumatol. 2021. 17(1): 59–66.
Jenei-Lanzl Z, Meurer A, Zaucke F. Interleukin–1β signaling in osteoarthritis - chondrocytes in focus. Cell Signal. 2019. 53: 212–223.
Luo P, Gao F, Niu D, et al. The Role of Autophagy in Chondrocyte Metabolism and Osteoarthritis: A Comprehensive Research Review. Biomed Res Int. 2019. 2019: 5171602.
Duan R, Xie H, Liu ZZ. The Role of Autophagy in Osteoarthritis. Front Cell Dev Biol. 2020. 8: 608388.
Wang S, Deng Z, Ma Y, et al. The Role of Autophagy and Mitophagy in Bone Metabolic Disorders. Int J Biol Sci. 2020. 16(14): 2675–2691.
Chang J, Wang W, Zhang H, Hu Y, Wang M, Yin Z. The dual role of autophagy in chondrocyte responses in the pathogenesis of articular cartilage degeneration in osteoarthritis. Int J Mol Med. 2013. 32(6): 1311–8.
Musumeci G, Castrogiovanni P, Trovato FM, et al. Biomarkers of Chondrocyte Apoptosis and Autophagy in Osteoarthritis. Int J Mol Sci. 2015. 16(9): 20560–75.
Jung S, Jeong H, Yu SW. Autophagy as a decisive process for cell death. Exp Mol Med. 2020. 52(6): 921–930.
Ma L, Zhang R, Li D, Qiao T, Guo X. Fluoride regulates chondrocyte proliferation and autophagy via PI3K/AKT/mTOR signaling pathway. Chem Biol Interact. 2021. 349: 109659.
Min S, Shi T, Han X, et al. Serum levels of leptin, osteopontin, and sclerostin in patients with and without knee osteoarthritis. Clin Rheumatol. 2021. 40(1): 287–294.
Boffa A, Merli G, Andriolo L, Lattermann C, Salzmann GM, Filardo G. Synovial Fluid Biomarkers in Knee Osteoarthritis: A Systematic Review and Quantitative Evaluation Using BIPEDs Criteria. Cartilage. 2021. 13(1_suppl): 82S–103S.
Hwang HJ, Kim YK. The role of LC3B in autophagy as an RNA-binding protein. Autophagy. 2022: 1–3.
Schaaf MB, Keulers TG, Vooijs MA, Rouschop KM. LC3/GABARAP family proteins: autophagy-(un)related functions. FASEB J. 2016. 30(12): 3961–3978.
Liu GY, Sabatini DM. mTOR at the nexus of nutrition, growth, ageing and disease. Nat Rev Mol Cell Biol. 2020. 21(4): 183–203.
Zhang T, Liu J, Zheng X, Zhang B, Xia C. Different roles of Akt and mechanistic target of rapamycin in serum–dependent chondroprotection of human osteoarthritic chondrocytes. Int J Mol Med. 2018. 41(2): 977–984.
Li X, He S, Ma B. Autophagy and autophagy-related proteins in cancer. Mol Cancer. 2020. 19(1): 12.

Table 1 Sequences of the primers. According to the nucleotide sequence of Atg5 and Atg7 in NCBI.

PCR primers sequences	Forward (5’-3’)	Reverse (5’-3’)
Atg5	ACCTTCTGCACTGTCCATCT	GAGTTTCCGATTGATGGCCC
Atg7	TGTTTGCTTCCGTGACCGTA	TTGGTCCCATGCCTCCTTTC
β-actin	TGACGTGGACATCCGCAAAG	CTGGAAGGTGGACAGCGAGG

Table 2 The relative mRNA expressions of autophagy-related genes ( Atg5 and Atg7 ) among six groups.

Genes	Blank group	IL-1β group	Leptin group	Leptin+IL-1β group	Leptin+leptin antagonist group	Leptin+leptin antagonist+IL-1β group
Atg5	1.00±0.00	1.77±0.12^*	0.66±0.06^#	1.27±0.03^**	0.84±0.05		1.48±0.09^***
Atg7	1.00±0.00	3.71±0.40^*	0.32±0.05^#	2.15±0.23^**	0.79±0.02		2.92±0.15^***

*, p< 0.01, compared with the blank group; #, p< 0.01, compared with the blank group; **, p< 0.01, compared with the IL-1β group; ***, p< 0.01, compared with the leptin+IL-1β group.

Table 3 Expressions of autophagy-related proteins (LC3B, mTOR) in the six groups.

Protein

Blank group

IL-1β group

Leptin group

Leptin+IL-1β group

Leptin+leptin antagonist group

Leptin+leptin antagonist+IL-1β

group

LC3B

50.41±2.66

65.36±2.15^*

24.92±2.20^#

50.10±2.31^**

27.41±2.31

61.49±2.33^***

mTOR

41.53±2.50

19.25±2.02^*

48.34±1.99^#

31.95±2.05^**

44.29±2.38

22.27±2.08^***

*, p< 0.01, compared with the blank group; #, p< 0.01, compared with the blank group; **, p< 0.01, compared with the IL-1β group; ***, p< 0.01, compared with the leptin+IL-1β group.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Leptin reduces autophagy and improves the survival of human chondrocytes induced by inflammation through the mTOR signaling pathway

Status:

Version 1

Abstract

Figures

1. Introduction.

2. Materials And Methods.

3. Results.

4. Discussion.

5. Conclusions.

Abbreviations.

Declarations.

References.

Tables.

Additional Declarations

Status:

Version 1