Chemicals
All chemicals and reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated.
Synthesis And Characterization Of Go-agnps
GO-AgNPs nanocomposites were synthesized using the biomolecule quercetin as described previously [39]. Briefly, 50 mg GO was dispersed in 30 mL water and sonicated for 60 min. One mM AgNO3 were dissolved in 15 mL water in a 500 mL round-bottom flask. 30 mL of the GO dispersion was added, followed by addition of 5 mL of aqueous 1 mM quercetin, and then stirred at 60 °C for 12 h. The resultant mixture was washed and centrifugated three times with water. The size and shape were observed under a transmission electron microscope (TEM; HT7800, Hitachi High-Technologies Corporation, Tokyo, Japan).
Cell Culture
Caprine fetal fibroblast cells were isolated from 70-day old fetuses that were recovered surgically from a Boer goats as previously described [51]. After removal of the head and internal organs, the remaining tissues were dissociated into small pieces using scissors and digested with 0.25% trypsin (Thermo Fisher Scientifc, Waltham, MA, USA). Then cells were washed three times, centrifuged to recover the cells, and cultured in Dulbecco’s Modifed Eagle’s Medium/F12 (DMEM/F12; Thermo Fisher Scientifc, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Hangzhou Sijiqing Hangzhou, China) at 37℃ in a humidified atmosphere of 5% CO2. The cells were used at passage 3–10.
Cell Viability Assay
The cell viability was assessed by using an in vitro cell-counting assay kit (CCK-8; Rockville, MD, USA) as described previously [40]. Caprine fetal fibroblast cells were seeded on 96-well or 6-well plate and cultured for 24 h to allow adherence and stabilization. Then the GO-AgNPs suspension was dispersed in DMEM/F12 for different concentrations (1, 4, 8, 12 and 16 µg/mL) for 24 h at 37℃. After culture, 10 µL CCK-8 was added into each well and were incubated for 30 min at 37℃ in the dark. The absorbance at 450 nm was measured using a microplate reader (BioTek Synergy 2, USA).
Cell Morphology
Caprine fetal fibroblast cells were seeded into a 24-well plate for 24 h, and then treated with the different concentrations of GO-AgNPs (0, 4 and 8 µg/mL) for 24 h. The cell morphology was observed using an Olympus BX-UCB microscope (Tokyo, Japan).
Annexin V-fitc/pi Staining Assay
Caprine fetal fibroblast cells were seeded in a 75 mm culture plate and treated with different concentrations of GO-AgNPs (0, 4 and 8 µg/mL) for 24 h. Cell apoptosis of caprine fetal fibroblast cells was detedted by Annexin V-FITC and Propidium iodide (PI) staining assay according to manufacturer’s instructions (Bipec Biopharma Corporation, USA). The cells were harvested, centrifuged for 5 min, rinsed with phosphate buffered saline (PBS) twice and resuspended in 500 µL binding buffer containing 5 µL PI and 5 µL V-FITC, and then incubated for 15 min at the room temperature in dark. The cell suspension was determined by flow cytometry to analyze the apoptotic rate.
Measurement Of Ros Production
Dichlorodihydroflfluorescein diacetate (DCFH-DA) was used to detect intracellular ROS induced by different concentrations (0, 4 and 8 µg/mL) of GO-AgNPs [40]. Caprine fetal fibroblast cells were incubated in 10 µM DCFH-DA for 30 min at 37℃. The cells were rinsed with PBS twice, and then the intracellular accumulation of ROS was measured by flow cytometry (Beckman-Coulter, USA).
Measurement Of Total Sod Enzyme Activity
The SOD activity in caprine fetal fibroblast cells was detected following the the SOD assay kit (Beijing Solarbio Science & Technology, beijin, China) [40]. Cells were treated with 0, 4 and 8 µg/mL of GO-AgNPs for 24 h. Cells were washed with PBS twice, and lysed with lysis buffer on the ice. The lysates were then centrifuged for 15 min. Then, the supernatant was analsysed with a U-vis spectrophotometer (Nanodrop, Thermo, USA) at 550 nm.
Measurement Of Mda Production
MDA, a convenient index for detecting the extent of lipid peroxidation reactions, was performed using the MDA assay kit (Beijing Solarbio Science & Technology, beijin, China) according to the manufacturer’s instructions [52]. Cells were plated into 6-well plates at a density of 1.0 × 105 cells per well and cultured for 24 h to allow adherence before exposure to different concentrations (0, 4 and 8 µg/mL) of GO-AgNPs for 24 h. Then the cells were washed with PBS twice and MDA activities were quantitated by reading optical densities using Synergy 2 multi-mode microplate reader (BioTek, USA) at 532 nm.
Measurement Of Ldh Production
Caprine fetal fibroblast cells were seeded in a 24-well culture plate, and treated with 0, 4 and 8 µg/mL of GO-AgNPs for 24 h. LDH level of cells in culture medium were quantified with LDH-cytotoxicity assay Kit (Beijing Solarbio Science & Technology, Beijin, China) [52]. The LDH activities were quantitated by reading optical densities at 490 nm using Synergy 2 multi-mode microplate reader (BioTek, USA).
Measurement Of Caspase-3 Activity
Measurement of caspase-3 activity was analyzed with a caspase-3 activity kit (Beijing Solarbio Science & Technology, beijin, China) according to manufacturer’s instructions. Briefly, caprine fetal fibroblast cells were seeded in a 24-well culture plate, and treated with 0, 4 and 8 µg/mL GO-AgNPs for 24 h. Then the cells were washed twice in PBS, lysed using lysis buffer, centrifuged at 16,000 x g at 4˚C for 10 min, and the supernatant was incubated with 10 µL of caspase3 substrate for 7 h at 37˚C. Substrate cleavage was measured at 405 nm using Synergy 2 multi-mode microplate reader (BioTek, USA).
Quantitative Reverse Transcription Pcr (rt-qpcr) Analysis
Total RNA was extracted from caprine fetal fibroblast cells using a RNA Isolation Kit (Thermo Scientifific, Waltham, MA, USA) according to the manufacturer`s instructions. RNA samples were stored at -80℃ until used. The mRNA samples were reverse-transcribed into first-strand cDNA using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer's instructions. Quantitative analysis of the cDNA samples was performed using a CFX98 instrument (Bio-Rad Laboratories) using SYBR Green (Vazyme). Primers were designed based on the mRNA sequences of selected genes available in GenBank (Table 1). The PCR cycle was as follows: initial denaturation at 95 °C for 30 s, followed by 41 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s, and extension at 72 °C for 30 s. RT-qPCR was performed independently four times. The target genes were quantified by the delta-delta Ct method using CFX manager V1.1 software (Bio-Rad Laboratories). Normalization was performed using β-actin as the reference gene.
Table 1
Primers used for quantitative reverse transcription PCR analysis
Gene | Primer sequence (5`--3`) | Accession no. | Product size (bp) |
caspase-3 | F: CCATGGTGAAGAAGGAATCATTT R: TCCCCTCTGAAGAAACTTGCTAA | AF068837.1 | 78 |
Cyt-C | F: CAGTGCCATACTGTGGAAAAGG R: TGACCTGTCTTTCGTCCAAACA | DQ176429.1 | 81 |
BAX | F: GCATCCACCAAGAAGCTGAG R: CCGCCACTCGGAAAAAGAC | XM_002701934.1 | 130 |
Smac | F: TGTTCCAGTCGTGGCTAACTT R: AAAGACACAGCCCTCCTCATT | NM_001045882.1 | 171 |
BCL2 | F: ATGTGTGTGGAGAGCGTCA R: AGAGACAGCCAGGAGAAATC | NM_001166486.1 | 182 |
β-actin | F: TCACGGAGCGTGGCTACAG R: CCTTGATGTCACGGACGATTT | U39357.1.1 | 63 |
Abbreviations: F, forward; R, reverse |
Statistical analysis
All results were expressed as mean ± S.D. and analyzed by Origin 8.0 and SPSS 18.0 (IBM Corp., Armonk, NY, USA). The statistical significance of the changes between tested groups and control group were analyzed by one-way ANOVA followed Dunnett’s multiple comparison. The level of statistical significance was set at P < 0.05. All experiments were performed at least three times.