Dysregulation of long non-coding RNA Rian expression in the brain of memory-impaired diabetic mice

doi:10.21203/rs.3.rs-2580684/v1

Download PDF

Research Article

Dysregulation of long non-coding RNA Rian expression in the brain of memory-impaired diabetic mice

https://doi.org/10.21203/rs.3.rs-2580684/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Type 1 diabetes mellitus (DM) is a metabolic disease caused by complications in the body. One of these complications is memory deficit and learning disability. The hippocampus (HP) and prefrontal cortex (PFC) are the main regions of the brain involved in memory and learning. HP and PFC regions have specific long noncoding RNA (lncRNA) signature that possibly regulate their functions. In this study, we aimed to evaluate highly-expressed lncRNAs level change in the brain of diabetic mice. The diabetic mice were divided into memory loss and normal memory groups. The lncRNA expression changes were measured in HP and PFC regions. The expression level of several lncRNAs was changed in HP and PFC. Most importantly lncRNA Rian was increased in PFC and HP regions post-diabetes. The lncRNA Rian protects neuronal cells from injuries through GATA3 regulation. It is possible that overexpression of Rian is a protective response to diabetes-related injuries. In conclusion, our data demonstrated that several lncRNAs expressions have changed in the HP and PFC of diabetic mice suggesting the potential therapeutic targets for the alleviation of diabetes-induced neuronal toxicity.

Diabetes mellitus

Hippocampus

Prefrontal cortex

LncRNA

Rian

Diabetes Mellitus (DM) is a complex and heterogeneous metabolic disorder in humans that is characterized by hyperglycemia (Kodl and Seaquist 2008). The worldwide prevalence of diabetes is about 9.3% which is estimated to increase to 10.2% by 2030 (Saeedi et al. 2019). DM is an autoimmune disorder diagnosed by the destruction of pancreatic beta cells and insulin-deficient Hyperglycemia (Michitsuji et al, 2017; Irvin et al. 2018; Enhamre et al. 2012 ). The central nervous system is one of the major organs affected by DM. Therefore, DM is accompanied by impairment in learning, memory, and cognitive skills (Martínez-Tellez et al. 2005; Baydas et al. 2003; Ho et al. 2013; Northam et al. 2009).

The hippocampus (HP) and the prefrontal cortex (PFC) are the main regions involved in learning and memory (Ho et al. 2013). Nevertheless, the mechanisms underlying those impairments created by DM, are poorly understood (Baptista et al. 2013). The long non-coding RNAs (lncRNA) participate in gene regulatory networks of numerous biological processes and are associated with a wide range of human diseases (Wang and Chang 2011; Qing 2016; Hitzemann et al. 2015; Briggs et al. 2015; Roberts et al 2014). Several lncRNAs including MALAT1, Meg3, Gas5, Rian, and Pantr1 are expressed in the hippocampus and prefrontal cortex (PFC) (Enhamre et al. 2012). Aberrant expression of lncRNAs is associated with neurological disorders, suggesting that lncRNAs may be related to the regulation of brain development, neuronal plasticity, and cognitive functions (Qing 2016; Briggs et al. 2015).

In this study, we aimed to investigate the effect of chronic hypoglycemia on memory and the expression of highly- expressed lncRNAs in HP and PFC. We have found that several lncRNAs expression, especially Rian, changes in HP and PFC.

2.1. Animals

All animal experiments were approved by the institutional animal care and use committee of the Golestan University of Medical Sciences. Nine adult, male C57BL mice (approximate weight 18–22 gr) were obtained from the animal laboratory of Royan Institute. Mice were housed under controlled laboratory conditions that were included: the usual circadian rhythm (12h light and 12h night), an average temperature of 25^oc, access to an adequate amount of food and water. The mice were divided into control (n = 6) and diabetic (n = 12) groups. The age of mice used in this study was 6–8 Weeks. The experimental procedures were conducted following international legislation. The ethical committee of the Zabol University (Iran) approved all animal experiments (Ethical Code: IR.UOZ.REC.1401.009).

2.2. Induction of diabetes

Type 1 diabetes was induced in mice by administration of intraperitoneal streptozotocin (STZ) injection (150 mg/kg body weight) (Hayashi et al. 2006). Blood sugar levels were measured 72 hours following STZ injection. Hyperglycemia was determined by an Accu-Chek Active system (Roche, Mannheim, Germany) (Baptista et al. 2013). The blood samples were obtained from the tail vein. Mice with glycemia levels higher than 250 mg/dl were considered as diabetic (Soleymaninejad et al. 2017; Hokama et al. 2013). Body weight was measured every week after diabetes.

2.3. Morris Water Maze Test

Morris water maze (MWM) test was performed before STZ injection to test the normal memory of mice. Then the test was repeated 49 days after STZ injection to evaluate the memory changes (Wang and Jia 2014). The experiment consisted of a circular black pool (120×50 cm) with a submerged platform. Four quadrants were determined and the platform was placed in one of the quadrants. At first, the mouse rests on the platform and then the mice get used to the water, and were allowed to swim freely (Irvin et al. 2018; Verbitsky et al. 2004). The mice have trained in four acquisition trials per day for five consecutive days to find an escape to the hidden platform. The mouse has 60 seconds to reach the platform. After finding the platform, mice are allowed to stay on the platform for 30 seconds and then start again. The mice were returned to the cage to grow hot after each trial. On the final day of training, mice have tested without a platform (Baptista et al. 2013; Wang and Jia 2014).

2.4. Tissue Harvesting

Animals were euthanized with cervical vertebrae fractures, without anesthetizing. The brains were removed from the cranium. Tissues were fixed to evaluate the histological changes. The hippocampus and prefrontal cortex were dissected and the remaining were stored at − 80°C for RNA extraction (Briggs et al. 2015). Whole-brain tissues were quickly removed, washed with phosphate-buffered saline (PBS), and fixed with 10% formalin. Then brains were embedded in paraffin for tissue processing, sliced to 5µm thick coronary sections with a microtome, and stained with cresol violet (Tanioka et al. 2020).

2.5. Quantitative real-time PCR

Total RNA was extracted from the HP and PFC by homogenization using Trizol (GeneAll, South Korea), according to the manufacturer's instructions. RNA integrity and purity were appraised with standard agarose gel electrophoresis and Nano Drop ND-1000 Spectrophotometer (NanoDrop Technologies, USA). DNA contamination was removed by DNase1 treatment. Then, 1µl of total RNA was reverse-transcribed using the Reverted Aid first-strand cDNA synthesis kit (Thermo Scientific, USA). Real-time PCR was performed using SYBER green 2X master mix (Yekta Tajhiz Azma, Tehran, Iran). The sequence of primers is presented in Table 1.

Table 1

The sequence of primers.
lncRNA	Sequence
Malat1	F	GAAGACAGGAGCGGCAGACA
Malat1	R	GCTTCACCACCACATCCGTATG
Meg3	F	GTGCCATTTGCTGTTGTGCT
Meg3	R	ATCCTGGGGTCCTCAGTCTT
Gas5	F	GGATAACAGAGCGAGCGCAAT
Gas5	R	CCAGCCAAATGAACAAGCATG
Pantr1	F	AACGCCGTTCAACAGTATGC
Pantr1	R	CCATGGCTCGTAGCTTCCAA
Rian	F	CACTAGTGTGCCTTGGAGCA
Rian	R	CTGTCCTCGGTCAGAAACCC
Gm20417	F	GAAAAGGGCGAGGGATGAGA
Gm20417	R	AGTGTGGGCAATTTTGGGGG
1700020114Rik	F	AGTACTTGTGCTGGACCGTG
1700020114Rik	R	TCGTGCCAAGTCCTGAGTTC
6330403k07Rik	F	TTCGATAAGCCTCCCCTGGA
6330403k07Rik	R	ACTCAAACGCCGACCAGATT
Gm15567	F	GAAAAGGGCGAGGGATGAGA
Gm15567	R	CCAAGCCAGAGAAGGGGATT
Gm20463	F	CACCTGTCTGTCTGTCCGTC
Gm20463	R	TGAGCTCTGTCTCCTCCCTG
Beta-Actin	F	CATCCGTAAAGACCTCTATGCCAAC
Beta-Actin	R	ATGGAGCCACCGATCCACA

2.6. Statistical Analysis

All of the statistical analyses are executed using SPSS and Graphpad prism 9.1.2 (GraphPad Software, San Diego, CA, USA). For analysis of body weight and blood sugar, statistical comparisons between diabetic animals and controls were performed using the unpaired student's t-test. The behavioral test was evaluated with repeated measures two-way ANOVA test for learning.

3.1. Blood composition, memory, and learning change in DM mice

The blood glucose level was significantly changed in diabetic mice (P ≤ 0.001, Fig. 1a). The weight of mice was decreased after diabetes (p < 0.01, Fig. 1b). The result of five day learning test has shown that accessing time to the platform significantly increased (P ≤ 0.05) in diabetic mice. There was no significant difference in swimming speed among the groups across the four training days. The results of the MWM test demonstrated that diabetic mice spent less time on the target quarter to find the platform (Fig. 1c). Also, the displacement latency was different between DM and control groups (Fig. 1d).

The number of neurons decreased in HP and PFC after diabetes (P < 0.01). The number of neuron cells per 50ρ50ρ5µm2 area of the hippocampus was significantly decreased from 100.00 to 67.833 in diabetic mice (Fig. 2a, b, e). The number of pyramidal neurons in the prefrontal cortex was reduced as well (Fig. 2c, d, e).

3.2. The expression levels of lncRNAs have changed after diabetes

We compared the diabetic mice with normal memory to diabetic mice with memory loss. The changes in both groups compared to healthy control. Significant changes have been observed in the expression of lncRNAs in HP and PFC (Fig. 3). In HP the Rian lncRNA was increased in DM with memory loss compared. However, Gas5, Gm20417, 6330403k07Rik, and Gm20463 expression were decreased. In PFC, all lncRNA (except Meg3) was increased in DM with memory loss group compared to DM with normal memory. Although the expression of lncRNAs were changed in both tissues, but the direction of changes was different. The Rian is the sole lncRNA with similar expression change in HP and PFC in diabetic mice with memory loss.

The hippocampus and prefrontal cortex are the main region of brain that involve in memory and learning. In the brain, hyperglycemia give rise to reduction or extension of oxidative stress, reactive oxygen species (ROS), inflammation and TAU phosphorylation which are major risk factors for neurodegenerative disease (Hokama et al. 2013; Zhao et al. 2012; Prasad et al. 2014; Caberlotto et al. 2019; Zhao et al. 2016; Revsin et al. 2005; Amin et al. 2013; Matsuura et al. 2018; Pamidi and Satheesha 2012). These factors affects the expression level of lncRNAs (Jacob 2006; Krishnan 2011; Jonathan 2013; Ghasemi 2016; Lin et al. 2018; Sami 2009). In this study, we evaluated the effect of diabetes on physiological parameters and expression level of lncRNAs with highest expression in HP and PFC of diabetic mice.

Our results showed that the expression of lncRNAs in mouse brain changes after diabetes induction. In general, the change in the expression level of the lncRNAs were more significant in PFC than HP. In HP the expression levels of Gas5, Gm20417, 6330403k07Rik, and Gm20463 were decreased. In contrast, the expression of these lncRNAs were significantly increased in PFC. However, the Rian was the sole lncRNA that its expression in both tissues of DM with memory loss was increased compared to DM with normal memory and healthy mice.

It is possible that overexpression of Rian protects neuronal cells from further injuries of diabetes. The Rian (RNA imprinted and accumulated in nucleus) is a maternally-expressed imprinted lncRNA that highly expresses in brain, heart and ovary. Rian negatively regulates nearby genes such as Dlk1 and Mirg in the brain (Han et al. 2014). It has been reported that lncRNA Rian protects neuronal cells from injuries through GATA3 regulation (Wolska et al. 2020). For example, overexpression of Rian protects hippocampal neurons against anesthesia induced cognitive dysfunction (Yu et al. 2021). Also, Rian improves neurological score and inhibits cell apoptosis induced by cerebral ischemia–reperfusion injury (Yao et al. 2020).

Our results showed that Rian expression dramatically increases in HP and PFC of diabetic mice.

In conclusion, our data demonstrated that several lncRNAs expression have changed in HP and PFC of diabetic mice suggesting the potential therapeutic targets for alleviation of diabetes-induced neuronal toxicity.

This research was done in Medical University of Gorgan, Iran, as an MSc thesis and the authors declare that no funds and/or grants were received during the preparation of this manuscript.

- Competing Interests:

The authors have no relevant financial or non-financial interests to disclose.

- Author Contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by [Razieh Safari] and [Masoud Golalipour]. The first draft of the manuscript was written by [Razieh Safari] and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

- Ethics approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of University of Zabol, Iran (Ethical Code: IR.UOZ.REC.1401.009).

- Consent to participate

Informed consent was obtained from all individual participants included in the study.

Amin SN, Younan SM, Youssef MF, Rashed LA, Mohamady I. A histological and functional study on hippocampal formation of normal and diabetic rats. F1000Res. 2013 Jul 9; 2:151. doi: 10.12688/f1000research.2-151.v1. PMID: 24555069; PMCID: PMC3901513
Baptista FI, Pinto MJ, Elvas F, Almeida RD, Ambrósio AF. Diabetes alters KIF1A and KIF5B motor proteins in the hippocampus. PLoS One. 2013 Jun 12;8(6):e65515. doi: 10.1371/journal.pone.0065515. PMID: 23776493; PMCID: PMC3680435
Baydas G, Nedzvetskii VS, Nerush PA, Kirichenko SV, Yoldas T. Altered expression of NCAM in hippocampus and cortex may underlie memory and learning deficits in rats with streptozotocin-induced diabetes mellitus. Life Sci. 2003 Aug 29;73(15):1907-16. doi: 10.1016/s0024-3205(03)00561-7. PMID: 12899916
Briggs JA, Wolvetang EJ, Mattick JS, Rinn JL, Barry G. Mechanisms of Long Non-coding RNAs in Mammalian Nervous System Development, Plasticity, Disease, and Evolution. Neuron. 2015 Dec 2;88(5):861–877. doi: 10.1016/j.neuron.2015.09.045. PMID: 26637795
Caberlotto L, Nguyen TP, Lauria M, Priami C, Rimondini R, Maioli S, Cedazo-Minguez A, Sita G, Morroni F, Corsi M, Carboni L. Cross-disease analysis of Alzheimer's disease and type-2 Diabetes highlights the role of autophagy in the pathophysiology of two highly comorbid diseases. Sci Rep. 2019 Mar 8;9(1):3965. doi: 10.1038/s41598-019-39828-5. PMID: 30850634; PMCID: PMC6408545
Enhamre E, Carlsson A, Grönbladh A, Watanabe H, Hallberg M, Nyberg F. The expression of growth hormone receptor gene transcript in the prefrontal cortex is affected in male mice with diabetes-induced learning impairments. Neurosci Lett. 2012 Aug 8;523(1):82 – 6. doi: 10.1016/j.neulet.2012.06.050. Epub 2012 Jun 27. PMID: 22750159
Ghasemi M, Zendehbad B, Zabihi H, Hosseini M, Hadjzadeh MAR, Hayatdavoudi P (2016) Beneficial Effect of Leptin on Spatial Learning and Memory in Streptozotocin-Induced Diabetic Rats. Balk Med J 33(1):102–107
Han J, Zhang J, Chen L, Shen B, Zhou J, Hu B, Du Y, Tate PH, Huang X, Zhang W. (2014) Efficient in vivo deletion of a large imprinted lncRNA by CRISPR/Cas9. RNA Biol 11(7):829–35. http://doi.org/10.4161/rna.29624. PMID: 25137067; PMCID: PMC4179957
Hayashi K, Kojima R, Ito M. Strain differences in the diabetogenic activity of streptozotocin in mice. Biol Pharm Bull. 2006 Jun;29(6):1110-9. doi: 10.1248/bpb.29.1110. PMID: 16755002
Hitzemann R, Iancu OD, Reed C, Baba H, Lockwood DR, Phillips TJ. Regional Analysis of the Brain Transcriptome in Mice Bred for High and Low Methamphetamine Consumption. Brain Sci. 2019 Jun 30;9(7):155. doi: 10.3390/brainsci9070155. PMID: 31262025; PMCID: PMC6681006.
Ho N, Sommers MS, Lucki I. Effects of diabetes on hippocampal neurogenesis: links to cognition and depression. Neurosci Biobehav Rev. 2013 Sep;37(8):1346–62. doi: 10.1016/j.neubiorev.2013.03.010. Epub 2013 May 13. PMID: 23680701; PMCID: PMC3788092
Hokama M, Oka S, Leon J, Ninomiya T, Honda H, Sasaki K, Iwaki T, Ohara T, Sasaki T, LaFerla FM, Kiyohara Y, Nakabeppu Y. Altered expression of diabetes-related genes in Alzheimer's disease brains: the Hisayama study. Cereb Cortex. 2014 Sep;24(9):2476–88. doi: 10.1093/cercor/bht101. Epub 2013 Apr 17. PMID: 23595620; PMCID: PMC4128707.
Irvin AE, Jhala G, Zhao Y, Blackwell TS, Krishnamurthy B, Thomas HE, Kay TWH. NF-κB is weakly activated in the NOD mouse model of type 1 diabetes. Sci Rep. 2018 Mar 9;8(1):4217. doi: 10.1038/s41598-018-22738-3. PMID: 29523846; PMCID: PMC5844878.
Jacob AN, Salinas K, Adams-Huet B, Raskin P. Potential causes of weight gain in type 1 diabetes mellitus. Diabetes Obes Metab. 2006 Jul;8(4):404 – 11. doi: 10.1111/j.1463-1326.2005.00515.x. Erratum in: Diabetes Obes Metab. 2006 Jul;8(4):472. PMID: 16776747
Jian-ping JIA SW (2014) Oxymatrine attenuates diabetes-associated cognitive deficits in rats. Acta Pharmacologica Sinica Wang SB, Jia JP. Oxymatrine attenuates diabetes-associated cognitive deficits in rats. Acta Pharmacol Sin. 2014 Mar;35(3):331-8. doi: 10.1038/aps.2013.158. Epub 2014 Jan 20. PMID: 24442148; PMCID: PMC4647892
Kodl CT, Seaquist ER. Cognitive dysfunction and diabetes mellitus. Endocr Rev. 2008 Jun;29(4):494–511. doi: 10.1210/er.2007-0034. Epub 2008 Apr 24. PMID: 18436709; PMCID: PMC2528851.
Krishnan S, Copeland KC, Bright BC, Gardner AW, Blackett PR, Fields DA. Impact of type 1 diabetes and body weight status on cardiovascular risk factors in adolescent children. J Clin Hypertens (Greenwich). 2011 May;13(5):351–6. doi: 10.1111/j.1751-7176.2010.00395.x. Epub 2010 Dec 10. PMID: 21545396; PMCID: PMC3089739
Li Qing SM (2016) Expression Profiles of Long Noncoding RNAs and Messenger RNAs in Mn-Exposed Hippocampal Neurons of Sprague–Dawley Rats Ascertained by Microarray: Implications for Mn-Induced Neurotoxicity
Lin LW, et al (2018) Differential change in cortical and hippocampal monoamines, and behavioral patterns in streptozotocin-induced type 1 diabetes rats. Iran J Basic Med Sci 21(10):1026–1034
Martínez-Tellez M, Gómez-Villalobos DJ, Flores G (2005) Alteration in dendritic morphology of cortical neurons in rats with diabetes mellitus induced by streptozotocin. Brain Res 1048(1): 108–115
Matsuura K, Otani M, Takano M, Kadoyama K, Matsuyama S. Proteomic Analysis of Hippocampus and Cortex in Streptozotocin-Induced Diabetic Model Mice Showing Dementia. J Diabetes Res. 2018 Apr 5;2018:8953015. doi: 10.1155/2018/8953015. PMID: 29850612; PMCID: PMC5907478
Michitsuji T, Horai Y, Sako A, Asano T, Iwanaga N, Izumi Y, Kawakami A. [A case of mixed connective tissue disease positive for proteinase 3 antineutrophil cytoplasmic antibody in a patient with slowly progressive type 1 diabetes mellitus and chronic thyroiditis]. Nihon Rinsho Meneki Gakkai Kaishi. 2017;40(6):467–470. Japanese. doi: 10.2177/jsci.40.467. PMID: 29367532
Northam EA, Rankins D, Lin A, Wellard RM, Pell GS, Finch SJ, Werther GA, Cameron FJ. Central nervous system function in youth with type 1 diabetes 12 years after disease onset. Diabetes Care. 2009 Mar;32(3):445–50. doi: 10.2337/dc08-1657. Epub 2009 Jan 16. PMID: 19151204; PMCID: PMC2646026
Pamidi N, Satheesha Nayak BN. Effect of streptozotocin induced diabetes on rat hippocampus. Bratisl Lek Listy. 2012;113(10):583-8. doi: 10.4149/bll_2012_130. PMID: 23094894
Prasad S, Sajja RK, Naik P, Cucullo L. Diabetes Mellitus and Blood-Brain Barrier Dysfunction: An Overview. J Pharmacovigil. 2014 Jun;2(2):125. doi: 10.4172/2329-6887.1000125. PMID: 25632404; PMCID: PMC4306190
Purnell Jonathan Q, Zinman Bernard, Brunzell John D (2013) The Effect of Excess Weight Gain with Intensive Diabetes Mellitus Treatment on Cardiovascular Disease Risk Factors and Atherosclerosis in Type 1 Diabetes Mellitus. Circulation 127(2):180–187
Rafah Sami (2009) Effect of exercise on spatial learning and memory in male diabetic rats | Request PDF. International Journal of Diabetes and Metabolism. DOI:10.1159/000497679
Revsin Y, Saravia F, Roig P, Lima A, de Kloet ER, Homo-Delarche F, De Nicola AF. Neuronal and astroglial alterations in the hippocampus of a mouse model for type 1 diabetes. Brain Res. 2005 Mar 15;1038(1):22–31. doi: 10.1016/j.brainres.2004.12.032. PMID: 15748869.
Saeedi P, et al (2019) Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res Clin Pract 157. http://doi.org/10.1016/j.diabres.2019.107843
Soleymaninejad M, Joursaraei SG, Feizi F, Jafari Anarkooli I (2017) The Effects of Lycopene and Insulin on Histological Changes and the Expression Level of Bcl-2 Family Genes in the Hippocampus of Streptozotocin-Induced Diabetic Rats. J Diabetes Res 2017
Tanioka M, Park WK, Shim I, Kim K, Choi S, Kim UJ, Lee KH, Hong SK, Lee BH. Neuroprotection from Excitotoxic Injury by Local Administration of Lipid Emulsion into the Brain of Rats. Int J Mol Sci. 2020 Apr 14;21(8):2706. doi: 10.3390/ijms21082706. PMID: 32295117; PMCID: PMC7215821
Verbitsky M, Yonan AL, Malleret G, Kandel ER, Gilliam TC, Pavlidis P. Altered hippocampal transcript profile accompanies an age-related spatial memory deficit in mice. Learn Mem. 2004 May-Jun;11(3):253–60. doi: 10.1101/lm.68204. PMID: 15169854; PMCID: PMC419727
Wang KC, Chang HY. Molecular mechanisms of long noncoding RNAs. Mol Cell. 2011 Sep 16;43(6):904 – 14. doi: 10.1016/j.molcel.2011.08.018. PMID: 21925379; PMCID: PMC3199020
Wolska M, Jarosz-Popek J, Junger E, Wicik Z, Porshoor T, Sharif L, Czajka P, Postula M, Mirowska-Guzel D, Czlonkowska A, Eyileten C (2021) Long Non-coding RNAs as Promising Therapeutic Approach in Ischemic Stroke: a Comprehensive Review. Mol Neurobiol 58(4):1664–1682. http://doi.org/10.1007/s12035-020-02206-8. PMID: 33236327; PMCID: PMC7932985.
Roberts TC, Morris KV, Wood MJ. The role of long non-coding RNAs in neurodevelopment, brain function and neurological disease. Philos Trans R Soc Lond B Biol Sci. 2014 Sep 26;369(1652):20130507. doi: 10.1098/rstb.2013.0507. PMID: 25135968; PMCID: PMC4142028.
Yao P, Li YL, Chen Y, Shen W, Wu KY, Xu WH (2022) Corrigendum to "Overexpression of long non-coding RNA Rian attenuates cell apoptosis from cerebral ischemia-reperfusion injury via Rian/miR-144-3p/GATA3 signaling. [Gene 737 (2020) 144411]. 810:146087. http://doi.org/10.1016/j.gene.2021.146087. Epub 2021 Dec 4. Erratum for: Gene. 2020 May 5; 737:144411. PMID: 34876309.
Yu Y, Zhang W, Zhu D, Wang H, Shao H, Zhang Y (2021) LncRNA Rian ameliorates sevoflurane anesthesia-induced cognitive dysfunction through regulation of miR-143-3p/LIMK1 axis. Hum Cell 34(3):808–818. http://doi.org/10.1007/s13577-021-00502-6. PMID: 33616869.
Zhao Z, Loane DJ, Murray MG, Stoica BA, Faden AI (2012) Comparing the Predictive Value of Multiple Cognitive, Affective, and Motor Tasks after Rodent Traumatic Brain Injury. J. Neurotrauma 29(15):2475–2489. http://doi.org/10.1089/neu.2012.2511
Zhao F, et al (2016) Changes in Neurons and Synapses in Hippocampus of Streptozotocin-Induced Type 1 Diabetes Rats: A Stereological Investigation. Anat Rec Hoboken NJ 2007 299(9): 1174–1183,

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Dysregulation of long non-coding RNA Rian expression in the brain of memory-impaired diabetic mice

Status:

Version 1

Abstract

Figures

1. Introduction

2. Material And Method

2.1. Animals

2.2. Induction of diabetes

2.3. Morris Water Maze Test

2.4. Tissue Harvesting

2.5. Quantitative real-time PCR

2.6. Statistical Analysis

3. Results

3.1. Blood composition, memory, and learning change in DM mice

3.2. The expression levels of lncRNAs have changed after diabetes

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1