Evaluating of HERV-K genes expression in sperm samples collected from infertile men compared to fertile individuals: A case control study

doi:10.21203/rs.3.rs-2582705/v1

Download PDF

Short Report

Evaluating of HERV-K genes expression in sperm samples collected from infertile men compared to fertile individuals: A case control study

https://doi.org/10.21203/rs.3.rs-2582705/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Having detrimental effects on health-care system, infertility can be related to some risk factors, especially different kinds of viruses. Human Endogenous Retrovirus-k (HERV-K) env, gag, np9 and rec can be considered as one of these viral agents which is likely to cause male infertility, and we attempted to evaluate it. This case-control study was conducted on sperm samples of 96 participants in Imam Hossein Hospital, Tehran, Iran from January 2020 to December 2021. After extracting the RNA of these samples, we evaluated the expression of HERV-K env, np9, rec, gag using Quantitative Real-Time PCR (QRT-PCR). Our data revealed that HERV-K, rec, np9 and env in abnormal samples were higher than normal ones. However, the opposite trend was true for gag expression since a meaningful reduction can be observed in abnormal samples. The results of our study suggested that there is a plausible correlation between the expression level of this virus’s genes, and the progression of infertility. We proposed this marker as a promising biomarker to diagnose infertility. However, further studies are required to support these results.

Human Endogenous Retrovirus (HERV)

sperm

Quantitative real-time PCR (qRT-PCR)

Infertility is one of the reproductive system diseases in all around the world, which can cause serious health problems in one-sixth couples. It is defined as an inability of couples to get pregnant during a year; moreover, women who are not able to maintain their pregnancy are considered infertile. (1)It is reported that this disease can involve 8–12% of couples in the childbearing age, putting pressure on health-care system. Infertility has been seen in more than 186 million individuals in numerous countries, especially developed ones. Indeed, from an infertility point of view, we are living in a marvelous age as the prevalence of it has been reported 7.88% approximately in Iran. (2, 3) It is the reason why the outbreak of this disease is one out of every seven couples and three out of every ten couples in developed and developing countries, respectively. (4) Moreover, researchers in a study reported that 20–30% of infertility cases are attributed to males in more regions of the world. (5)

The primary cause of infertility is not clear, but there are a number of factors which may be related to this problem. Alcohol consumption, changing sexual behaviors, smoking, obesity, stress and diet may be able to accelerate the prevalence of male infertility. (6–8) Microbial risk factors, such as chlamydia, gonorrhea, Human Papilloma Virus (HPV), Herpes Simplex Virus (HSV) and Human Endogenous Retrovirus (HERV), are other items which can cause Sexually Transmitted Disease (STD). (9, 10)

Since 1980s, studies have revealed that HERV are able to integrate into the host genome stimulating some destructive mutations, ranging from frame-shifts to deletions. (9) These mutations can cause different types of cancers, and it is supposed that there are tangible relations between infertility and this virus as well. (11) From 30–40 million years ago, HERV has compromised about 8% of the human genome, and it can be transmitted vertically. (12) By changing the expression of HERV genes, this virus can cause serious problems in numerous tissues, especially placenta, epididymis and testis.(9) This virus is classified into three classes, such as class I (gammaretrovirus- and epsilonretrovirus-like), class II (betaretrovirus-like) and class III (spumaretrovirus-like). It is assumed that HERV-K has entered into human genome more than other HERV families. (13) Some structural genes of this virus, especially HERV-K gag, env, np9 and rec genes, are regulated by two long terminal repeat (LTR) sequences which may be related to infertility. (14)

Given the fact that the relation between HERV-K env, np9, rec, gag genes expression and infertility has not been confirmed, in this study, we evaluated the expression of these genes in sperm samples.

Preparation of samples:

This case-control study was conducted on sperm samples of 96 participants in Imam Hossein Hospital, Tehran, Iran from January 2020 to December 2021 to evaluate the expression level of HERV-K env, np9, rec, gag genes. We assessed samples after 3–5 days sexual abstinence; furthermore, sperm motility, sperm concentration (× 10⁶ sperm/ml) and sperm morphology were analyzed according to the World Health Organization guidelines. In this study, samples were collected from participants with Body Mass Index between 18 and 25 kg/m2, who were not exposed radiation therapy, or chemotherapy. Moreover, patients with varicocele, experiencing previous testicular surgery, endocrine disorders or cancer and infected samples with bacteria were excluded. (15)

Extraction of RNA:

To remove protein, chloroform and 1ml RNX-plus solution reagent (Cinnagen, Tehran, Iran) were added to sperm samples. Then, RNA can be precipitated from the supernatant by adding isopropanol, and finally, the RNA was diluted with 50 ul of DEPC-treated water. Agarose gel electrophoresis was utilized in order to observe 5S, 18S and 28S.

Reverse Transcription (cDNA synthesis):

To produce cDNA from an RNA template, we performed the reverse transcription reaction by Bio fact cDNA kit (Daejeon, South Korea). A 20 µl reaction volume was contained random hexamer (1 µl), master mix (9 µl) and RNA samples (10 µl). Then the reaction was incubated for 40 min at 50 ℃ and 10 min at 95 ℃ in Bio Intellectica PCR. The cDNA was diluted by adding sterile water for two times.

Quantitative real-time PCR:

Real-time PCR technique was performed to evaluate HERV-K genes expression. We mixed BIOFACTTM 2X real-time PCR master mix (for SYBR Green I; BIOFACT, South Korea) (10 µl), sterile water (6 µl), forward primer 10 pmol (1 µl), reverse primer 10 pmol (1 µl) and cDNA of a final 20 µl volume (2 µl). The incubation was conducted in one cycle an initial denaturation at 95°C for 10 min, forty cycles of 30 sec denaturation at 95°C, the annealing step at 55°C for 30 sec then at 72°C for 30 sec in Rotor-gene 6000 (Corbett life sciences, Sydney, Australia) in 36-well Gene Discs. The temperature of constructed melting curves was accessed from 60°C to 95°C.

Commonly used GAPDH housekeeping gene as an internal control. For quantitative real-time PCR data, the 2-∆∆CT method was used; furthermore, negative controls confirmed that there was no contamination. List of primers was used in the present study are in Table 1.

Table 1

Primers used for every genes in real-time PCR
Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
GAPDH	ATGTTCGTCATGGGTGTGAA	GGTGCTAAGCAGTTGGTGGT
rec	ATCGAGCACCGTTGACTCACAAGA	GGTACACCTGCAGACACCATTGAT
np9	AGATGTCTGCAGGTGTACCCA	CTCTTGCTTTTCCCCACATTTC
env	TAACCCTGTCACTTGGATT	ATGTCACTGTCTCTTCGG
gag	AGCAGGTCAGGTGACCGTAAC	GGTGCCATAGCATTGTCTCCT

Ethical Consideration

School of medicine research department Shahid Beheshti university of medical sciences supported the present study, financially;” (IR.SBMU.RETECH.REC.1400, 692), grant no 29252

Statistical analysis:

Graph-PadPrism software was used for analyzing the result of mRNA expression. Experimental data are expressed by mean ± standard deviation of three independent assays. Statistical significance was calculated using t tests. The differences were determined based on p-value less than (P < 0.05).

Samples

We were able to extract RNA, synthetizing cDNA of 94 sperm samples from Imam Hossein Hospital, Tehran, Iran from January 2020 to December 2021. Our samples (53 teratospermia samples and 41 normal ones) were analyzed to evaluate HERV-K env, gag, np9 and rec. All samples were confirmed through the World Health Organization guidelines, and we did not find a concrete relation between age, sex and changes of HERV-K gene expressions. We will provide some same characters after collecting data from the university.

Evaluating the expression level of HERV-K rec gene in sperm samples

For assessing the expression level of HERV-K rec gene, we extracted RNA from the sperm samples. Quantitative real-time PCR analysis showed that there was no difference in the mRNA expression level of rec in infertile samples in comparison with the normal ones. Figure 1. A.

Increase in the HERV-K np9 gene expression in sperm samples

Our results revealed that a climb in mRNA expression level of np9 in abnormal samples can be observed; however, it was not statistically significant. Figure 1. B.

Evaluating the expression level of HERV-K env genes in sperm samples

Similarly, env expressions illustrated a growth in abnormal samples, but with higher intensive trend. Figure 1. C.

Reduction in HERV-K gag in abnormal samples

Our data revealed that HERV-K gag had a meaningful changes in expression in abnormal samples in comparison with the normal ones. Figure 1. D.

According to previous reports, about 9% of men between the ages of 15 and 44 have suffered from infertility which is the reason why this disease can be considered as a significant problem in all around the world. Scientists have published that many risk factors can play a crucial role to play in bringing reproductive problems; however, further studies are required to approve their effects. Take, for example, HPV18 which is able to down-express p53, having the ability for the low rate of sperms.(16)

This study evaluated the gene expression of one of these possible risk factors called Human Endogenous Retrovirus (HERV). It is likely to cause some mutations in the host genome leading to a variety of health problems, ranging from different kinds of cancers to infertility. The molecular mechanisms of HERV activations in spermatogenesis have not been found, but DNA methylation and histone modification maybe the most important items related to this virus. (16) In fact, changing the expression of numerous genes by some viral agents, especially HERV-K env, gag, rec and np9, can cause infertility. (9) To illustrate, Chan and colleagues demonstrated that there is a concrete relation between HERV-K and testicular cancer. (17)

Due to mentioned reasons, we evaluated the expression of HERV-K env, np9, rec, gag using Quantitative real-time PCR (qRT-PCR). Our data revealed that HERV-K, rec, np9 and env in abnormal samples were higher than normal ones. However, the opposite trend was true for gag expression since a meaningful reduction can be observed in abnormal samples. It is suggested that further studies should be performed to evaluate the role of this virus on infertility since the limitation of this study was low number of samples.

Few researchers have evaluated the role of this virus on infertility causing difficult to confirm it, for example, high concentration of HERV-w env (syncytin 1) can accelerate fusion process between gametes increasing the chance of embryo development. However, HERV-H-pol, HERV-K-pol, HERV-W-pol, and Syn2 gene expressions were lower in spermatozoa in comparison with white blood cells (WBCs).(18) Herbst and colleagues found that HERV-K gag and env are expressed in ovarian germ cell tumors and in their testicular precursor lesions (teratomas, mature and immature, and spermatocytic seminomas are exceptions). Moreover, gestational trophoblastic disease (GTD) shows the expression of this virus but not in benign GTD (noninvasive molar pregnancy). In this study, there was no differences between embryonal and adult tissues’ HERV-K expression. (19) Roelofs and colleagues assessed the expression of HERV-K gag, env and prt genes in Testicular germ cell tumors (TGCTs) of adolescents and adults with and without carcinoma by reverse transcription-polymerase chain reaction. All these samples illustrated the expressions of gag and prt while env genes was detected in normal testicular parenchyma sample, but not in Testicular germ cell tumors (TGCTs). (20) In another study, Larsson reported that ERV3 (HERV-R) can be identified in certain cells in spermatogenesis and placenta, but the opposite trend is true for Sertoli or Leydig cells. (21) Homologous recombination between many copies of HERV placed at different loci causing destructive mutations in the human genome. For example, the elimination of the azoospermia factor a (AZFa) region from male-specific region of Y chromosome (MSY) disrupts spermatogenesis through recombination between HERV15 proviruses. The prior study suggested that HERVs are potentially diverse genetics through integrated to genome and created maiden variants. (22) HERV-K14C transcripts were only found in human testis, and placed on between P1 and P4 region. The omission of HERV-K14C causes to disorder spermatogenesis. In other words, normal spermatogenesis was related to the expression of HERV-K14C transcripts. (23)Analyzing of human oocyte showed that HERV-K10 L1 and SVA retrotransposons are transcriptionally expressed resulting in suggesting HERV ROLE IN oocyte development. (24) Scientists detected ERV3 env-like antigens on spermatogenic cells in mature baboon testes and on epididymal spermatozoa. Moreover, ejaculate spermatozoa, seminal fluid and epididymal spermatozoa had reverse transcriptase activities. (25) It seems that the expression of different kinds of HERV can be higher than 18 other human tissues, concluding that these viruses can help develop placenta. Indeed, HERV-W (syncytin-1) (26–28), HERV-FRD (syncytin-2) (29), of ERV-3, HERV-R and HERV-W (30–32) have been reported in this tissue. In another study, L1 and HERV-W are assumed to progress human ovarian carcinomas. (33)

The results of our study suggested that there is a plausible correlation between the expression level of this virus’s genes, and the progression of infertility. We proposed this marker as a promising biomarker to diagnose infertility. However, it is suggested that further studies should be performed to evaluate the role of this virus on infertility since the limitation of this study was low number of samples.

Conflicts of interest: The authors declare no conflicts of interests.

Ethical consideration: School of medicine research department Shahid Beheshti university of medical sciences supported the present study, financially;” (IR.SBMU.RETECH.REC.1400, 692), grant no 29252

-Ethics approval and consent to participate: School of medicine research department Shahid Beheshti university of medical sciences supported the present study, financially;” (IR.SBMU.RETECH.REC.1400, 692), grant no 29252

We confirm that all methods were carried out in accordance with relevant guidelines and regulations.

We confirm that all experimental protocols were approved by Shahid Beheshti University of Medical Sciences.

We confirm that informed consent was obtained from all patients.

- Consent for publication: Not Applicable.

- Availability of data and materials: Please contact author for data requests

- Funding: The present study is financially supported (The funding body had influenced on the design of the study and collection, analysis, and interpretation of data and in writing the manuscript) by the Research Department of the School of Medicine Shahid Beheshti University of Medical Sciences.

- Authors' contributions: Shaian Tavakolian analyzed the tests, Zahra Rafiei Atani wrote the text, Amir Zarei, Hossein Goudarzi, Amir Reza Abedi and Ebrahim Faghihloo analyzed the data.

Brugo-Olmedo, S., Chillik, C., Kopelman, S. Definition and causes of infertility. Reprod Biomed Online 2021; 2:173–185.
Saei Ghare Naz M, Ozgoli G, Sayehmiri K. Prevalence of Infertility In Iran: A Systematic Review And Meta-Analysis. Urol J 2020 23; 17:338-45.
Boivin, J., Bunting, L., Collins, J. A., Nygren, K. G. International estimates of infertility prevalence and treatment-seeking: potential need and demand for infertility medical care. Hum Reprod 2007; 22:1506–12.
Vander Borght M, Wyns C. Fertility and infertility: Definition and epidemiology. Clin Biochem 2018; 62:2-10.
Agarwal A, Baskaran S, Parekh N, Cho CL, Henkel R, Vij S, et al. Male infertility. Lancet 2021; 23:319-33.
Schuppe HC, Pilatz A, Hossain H, Diemer T, Wagenlehner F, Weidner W. Urogenital Infection as a Risk Factor for Male Infertility. Dtsch Arztebl Int 2017; 114:339-346.
Boeri L, Capogrosso P, Ventimiglia E, Pederzoli F, Cazzaniga W, Chierigo F, et al. Heavy cigarette smoking and alcohol consumption are associated with impaired sperm parameters in primary infertile men. Asian J Androl 2019; 21:478-485.
Pourentezari M, Talebi AR, Mangoli E, Anvari M, Rahimipour M. Additional deleterious effects of alcohol consumption on sperm parameters and DNA integrity in diabetic mice. Andrologia. 2016; 48:564-9.
Crowell RC, Kiessling AA. Endogenous retrovirus expression in testis and epididymis. Biochem Soc Trans 2007; 35:629-33.
Manju Ohri Pai SV, Pratima Gupta. The role of infections in infertility: A review. IJAM 2020; 6:189-96.
Sin HS, Koh E, Taya M, Iijima M, Sugimoto K, Maeda Y, et al. A novel Y chromosome microdeletion with the loss of an endogenous retrovirus related, testis specific transcript in AZFb region. J Urol 2011; 186:1545-52.
Rakoff-Nahoum S, Kuebler PJ, Heymann JJ, M ES, Ortiz GM, G SO, et al. Detection of T lymphocytes specific for human endogenous retrovirus K (HERV-K) in patients with seminoma. AIDS Res Hum Retroviruses. 2006; 22:52-6.
Rivas SR, Valdez MJM, Govindarajan V, Seetharam D, Doucet-O'Hare TT, Heiss JD, et al. The Role of HERV-K in Cancer Stemness. Viruses 2022; 14:2019.
AM Ragheb, RM Ibrahima, AM Elbatanouny, AS Moussa, AM Abdelbary, OM Sayed, et al. Role of sequential semen samples in infertile men candidates for assisted reproduction: A prospective study. AFJU 2018; 24:363-7.
Björndahl, L. Methods for sperm concentration determination. Methods Mol Biol 2013; 927:3-12.
Smallwood SA, Kelsey G. De novo DNA methylation: a germ cell perspective. Trends in genetics : TIG. 2012; 28:33-42.
Chan SM, Sapir T, Park SS, Rual JF, Contreras-Galindo R, Reiner O, Markovitz DM. The HERV-K accessory protein Np9 controls viability and migration of teratocarcinoma cells. PLoS One 2019 ;14:e0212970.
Bergallo M, Canosa S, Galliano I, Dapra V, Montanari P, Sestero M, et al. Impaired transcription of human endogenous retroviruses in the sperm with exception of syncytin 1: short communication Mol Biol Rep 2021; 48:5803-8.
Herbst H, Sauter M, Mueller-Lantzsch N. Expression of human endogenous retrovirus K elements in germ cell and trophoblastic tumors. Am J Pathol 1996; 149:1727-35.
Roelofs H, van Gurp RJ, Oosterhuis JW, Looijenga LH. Detection of human endogenous retrovirus type K-specific transcripts in testicular parenchyma and testicular germ cell tumors of adolescents and adults: clinical and biological implications. Am J Pathol 1998; 153:1277-82.
Larsson E, Andersson AC, Nilsson BO. Expression of an endogenous retrovirus (ERV3 HERV-R) in human reproductive and embryonic tissues--evidence for a function for envelope gene products. Ups J Med Sci 1994; 99:113-20.
Sun C, Skaletsky H, Rozen S, Gromoll J, Nieschlag E, Oates R, et al. Deletion of azoospermia factor a (AZFa) region of human Y chromosome caused by recombination between HERV15 proviruses. Hum Mol Genet 2000; 9:2291-6.
Sin HS, Koh E, Kim DS, Murayama M, Sugimoto K, Maeda Y, et al. Human endogenous retrovirus K14C drove genomic diversification of the Y chromosome during primate evolution. J Hum Genet 2010; 55:717-25.
Georgiou I, Noutsopoulos D, Dimitriadou E, Markopoulos G, Apergi A, Lazaros L, et al. Retrotransposon RNA expression and evidence for retrotransposition events in human oocytes. Hum Mol Genet 2009; 18:1221-8.
25. Mwenda JM, Sichangi MW, Oduor-Okello D, Wango EO, Langat DK. Human endogenous retrovirus-R (ERV 3) env-like antigens expressed in baboon testes and epididymides. East Afr Med J 2003 ;80:264-70.
Blond L, Beseme F, Duret L, Bouton O, Bedin F, Perron H, et al. Molecular characterization and placental expression of HERV-W, a new human endogenous retrovirus family. J Virol 1999; 73: 1175– 85.
Blond L, Lavillette D, Cheynet V, Bouton O, Oriol G, Chapel-Fernandes S, et al. An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. J Virol 2000; 74: 3321– 9.
Mi S, Lee X, Li X, Veldman M, Finnerty H, Racie L, et al. Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 2000; 403: 785– 9.
Malassiné A, Frendo L, Blaise S, Handschuh K, Gerbaud P, Tsatsaris V, et al. Human endogenous retrovirus-FRD envelope protein (syncytin 2) expression in normal and trisomy 21-affected placenta. Retrovirology 2008; 5: 6.
Kato N, Pfeiffer-Ohlson S, Kato M, Larsson E, Rydnert J, Ohlsson R, et al. Tissue specific expression of human provirus ERV3 mRNA in human placenta: two of the three ERV3 mRNAs contain human cellular sequences J Virol 1987; 61: 2182– 91.
Boyd T, Bax CMR, Bax BE, Bloxam DL, Weiss RA. The human endogenous retrovirus ERV-3 is upregulated in differentiating placental trophoblast cells. Virology 1993; 196: 905– 90.
Yi M, Kim S. Molecular phylogenetic analysis of the human endogenous retrovirus E (HERV-E) family in human tissues and human cancers. Genes Genet Syst 2007; 82: 89– 98.
Menendez L, Benigno BB, McDonald JF. L1 and HERV-W retrotransposons are hypomethylated in human ovarian carcinomas. Mol Cancer 2004; 3:12.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Evaluating of HERV-K genes expression in sperm samples collected from infertile men compared to fertile individuals: A case control study

Status:

Version 1

Abstract

Figures

Introduction:

Materials & Methods:

Preparation of samples:

Extraction of RNA:

Reverse Transcription (cDNA synthesis):

Quantitative real-time PCR:

Ethical Consideration

Statistical analysis:

Results:

Discussion:

Conclusion:

Declarations:

References:

Additional Declarations

Status:

Version 1