Prevalence and characterization of virulence-associated genes and antimicrobial resistance in Aeromonas hydrophila from freshwater finfish farms in Andhra Pradesh, India

doi:10.21203/rs.3.rs-2586276/v1

Download PDF

Research Article

Prevalence and characterization of virulence-associated genes and antimicrobial resistance in Aeromonas hydrophila from freshwater finfish farms in Andhra Pradesh, India

https://doi.org/10.21203/rs.3.rs-2586276/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Aeromonas hydrophila, a natural inhabitant of aquatic environments and known to become pathogenic in fishes under favourable conditions, have also been reported to cause broad spectrum of infections in humans and animals. The prevalence, virulence- associated genes and antimicrobial resistance in 57 A. hydrophila isolates from 100 freshwater fish farms (253 fishes) of Andhra Pradesh, India was studied. The isolates showed resistance to trimethoprim (35.9%), co-trimoxazole (21.1%), oxytetracycline (19.3%), doxycycline (17.5%), and enrofloxacin (8.93%), while they were completely sensitive to ciprofloxacin. Majority of the A. hydrophila isolates were strong (33%), moderate (50%) and weak (17%) biofilm formers, having role in virulence and colonization in host. The virulence gene distribution in representative A. hydrophila isolates was very high for enolase (enol, 96.4%), followed by flagellin (fla, 94.7%), cytotonic enterotoxins (alt, 91.2%), cytotoxic enterotoxins (act, 84.2%), lipase (lip, 77.1%), serine protease (ahp, 54.3%), aerolysin (aerA, 50.8%), and elastase (ahyB, 43.8%), respectively. 80% of the isolates carried a maximum of four virulence genes, whereas none carried the DNAase (exu) or haemolysin (hly) genes. Hemolytic assays on blood agar demonstrated that β-hemolysis was present in 70% of the isolates. These findings will create awareness among aquaculturists on the potential risk of spread of the isolates and the virulence associated genes across other sectors and the need for practicing best management practices in aquaculture.

Aquaculture

Aeromonas hydrophila

Virulence genes

Antibiotics

Biofilm

Freshwater fish farming contributes significantly to the aquaculture industry, notably in Asian countries providing food, employment, and economic benefits (Buentello et al. 2007). A large diversity of fish species has been cultivated in various geographical regions, contributing to worldwide aquaculture fish production (Cai et al. 2019). Labeo rohita, Catla catla, Cirrhinus mrigala, Cyprinus carpio, Pangasianodon hypophthalmus, and Channa spp. are the most cultivable fishes in Andhra Pradesh, India, due to their fast growth, consumer preference, and good market prices, which have facilitated the rapid expansion of the culture area and made them candidate species for aquaculture (Katiha et al. 2005; Mishra et al. 2017a, b). In response to this rising demand for fish protein, culture systems have shifted from traditional to intensive culture methods (Van Boeckel et al. 2015; Mishra et al. 2017a; Mzula et al. 2020; Patil et al. 2021). Modern farming systems are distinguished by high stocking densities and high organic matter, which create stress conditions that eventually, result in disease outbreaks (Mitra et al. 2019, Nhinh et al. 2021). Disease outbreaks are seen as significant constraints to aquaculture production and sustainability, contributing about 10–15 percent of total production costs (Tavares-Dias et al. 2017). Disease-causing Aeromonas spp. in finfish include A. caviae, A. veronii, A. hydrophila, A. salmonicida, A. sobria, and A. bestiarum in a variety of fish species (Esteve et al. 2012; Thomas et al. 2013; Long et al. 2016; Liu et al. 2016; Chandrarathna et al. 2018; Yao et al. 2018; Hoai et al. 2019). A. hydrophila which comes under family Aeromonadaceae, is an opportunistic bacterial pathogen, causing Motile Aeromonas Septicemia (MAS) in freshwater finfish, displaying signs of ulceration, abdominal distension, exophthalmia, hemorrhage, and fin erosion, which leads to cumulative mortalities (Janda and Abbott 2010; Awan et al. 2018). More critically, due to its zoonotic nature, the infected fish with A. hydrophila have been proposed as a potential threat to human and animal health via foodborne contamination (Palu et al. 2006).

The pathogenicity and toxicity of bacterial pathogens are determined by virulence factors (Gao et al. 2018). The virulence factors in A. hydrophila include aerolysins (aer), cytotoxic enterotoxins (act, ast), cytotonic enterotoxins (alt), polar flagella (fla), serine protease (ser, ahp), elastase (ahyB), enolase (enol), lipase (lip), hemolysisn (hlyA), DNases (exu), glycerophospholipid cholesterol acyltransferase (gcaT), and type III secretion system (ascV), which plays a prominent role in bacterial pathogenesis (Nawaz et al. 2010). Furthermore, biofilms create bacterial resistance against antimicrobial agents, making the pathogen difficult to treat (Lynch and Wiener-Kronish 2008; Cai et al. 2019). Aeromonas spp. has evolved numerous regulatory mechanisms for biofilm formation that are intimately coupled to virulence factors (Rasmussen-Ivey et al. 2016b). Antibiotics and other chemical compounds are commonly used in aquaculture to prevent and control bacterial diseases, either through medicated feed or direct addition into the culture water (Mishra et al. 2017b). High levels of antibiotic usage in animal food production jeopardize the aquatic environment by allowing antimicrobial resistance (AMR) and antibiotic resistance genes (ARGs) to enter the environment (Kummerer 2001; Sawyer et al. 2015; Liu et al. 2017; Lulijwa et al. 2020). Antibiotic-resistant bacteria accumulate in water, sediment, farmed animals, wild stock, and in and around farms, limiting effective treatment options and threatening aquatic food supply and animal welfare (Mishra et al. 2017b; Patil et al. 2021).

To address the challenges that the freshwater aquaculture sector would confront, a study was designed to investigate the prevalence, distribution of the virulence genes, and antibiotic resistance in A. hydrophila isolated from freshwater fish farms in Andhra Pradesh, India.

2.1. Sample collection

Indian Major Carps (IMC) are being cultivated as a composite fish culture representing C. catla, L. rohita, and C. mrigala, while P. hypophthalmus is being cultivated alone as a monoculture in this area. Data regarding farming activities, disease incidence, chemical usage, preventive strategies, and other relevant information have been collected using an approved questionnaire. Fish samples from 100 finfish farms were collected from IMC (n = 73) and Pangasius fish farms (n = 27), including healthy and diseased fishes. From each farm, an average of 2–3 fish had been collected for bacterial isolation and identification. Then, the fish samples were transported to the laboratory within 2–3 h in sterile, sealed bags under iced conditions for clinical examination. Clinical signs and gross features of all fishes were observed and recorded as per the standard protocols (Austin and Austin 2007).

2.2. Isolation and identification of A. hydrophila

Gill and intestinal swabs from fishes were collected; samples were pooled and transferred into tryptic soy broth for enrichment. After the enrichment, the culture was streaked onto Aeromonas selective agar and followed by incubation at 32°C for 18- 24 h. The presumptive colonies of round, reddish orange-colored and clear to slightly opalescent were selected and re-isolated three times for its purity, followed by determination of colony and bacterial morphology (M1890, Himedia). Furthermore, isolates were tested for Gram's reaction, motility, oxidase, catalase, Voges-Proskauer (VP), sensitivity to 0/129 (150 µg), indole production, citrate utilization, glucose fermentation, H₂S production, urease production, arginine di-hydrolase, lysine decarboxylase, ornithine decarboxylase, arabinose fermentation, inositol fermentation, mannitol fermentation, gelatin hydrolysis according to Bergey’s Manual of Determinative Bacteriology according to Holt et al (1994). For molecular identification of representative isolates, crude DNA from isolates was extracted according to the method of Kpoda et al. (2018). Young bacterial cultures were suspended in 200µL of TE buffer and incubated at 95°C for 10 minutes in a dry bath (IKA^®, Dry block heater, India). The cell culture suspension was centrifuged at 12000 rpm for 10 minutes, and the supernatant was collected and used as a template for the polymerase chain reaction (PCR). All the suspected isolates were subjected to PCR, targeting 16S ribosomal RNA universal primers listed in Table 1. The PCR reaction mixture of 25µL reaction consisted of 12.5µL of EmeraldAmp GT PCR Master Mix (Takara, Japan), 1 µL of specific primers (25µM of forward and reverse primer), 2 µL of DNA template, and 8.5 µL of nuclease-free water. PCR reaction performed in Applied Biosystems™ Proflex™ (Thermo Fisher Scientific, USA) consisted of initial denaturation at 94°C for 2 min followed by 35 cycles of denaturation at 94°C for 30s, annealing for 40s at (table 2), extension at 72°C for 45s, and a final extension at 72 °C for 7 min. The amplified products were analyzed using 1% agarose in an electrophoresis system. The gel images were captured digitally using a gel image system (Biorad, USA). The PCR products were purified, and sequencing was performed with an automated ABI 3100 genetic analyzer using the ABI BigDye terminator method at the Central Aquaculture Genetics Laboratory, Rajiv Gandhi Centre for Aquaculture, Sirkazhi, Tamilnadu. The nucleotide sequence was analyzed using the BLAST algorithm and submitted to NCBI (https://www.ncbi.nlm.nih.gov).

2.3. Antimicrobial susceptibility testing (AST)

Antimicrobial susceptibility testing (AST) for A. hydrophila was carried out following the disc diffusion method (Bauer 1966), and zone of inhibition were interpreted in accordance with the Clinical and Laboratory Standard Institute (CLSI M100, 2022) standards. All the antibiotic discs were procured from Himedia, India, and maintained at -20^oC until use. Overnight grown bacterial cultures were adjusted to 0.5 McFarland standard, and 100 µL of bacterial culture was transferred onto Muller-Hinton agar plates and incubated at 28°C for 18-24 h. The antibiotic panel used for AST included oxytetracycline (30µg), doxycycline (30µg), ciprofloxacin (5µg), enrofloxacin (10µg), trimethoprim (30µg), and co-trimoxazole (25µg). The zones of inhibition were recorded and categorized as susceptible, intermediate, and resistant according to the zone diameter interpretation standard described in the CLSI M100, 2022.

2.4. Biofilm formation assay

The biofilm formation assay was performed using the tissue culture plate (TCP) method described by Mathur et al. (2006). Briefly, individual colonies of isolates were inoculated into Brain Heart Infusion (BHI) broth supplemented with 2% sucrose (Himedia, India), and 200 µL of bacterial suspension were added into a 96-well microtitre plate. 200 µL of sterile BHI broth were poured into a well and maintained as a negative control. Plates were incubated at 37°C for 24 h, and the wells were washed three times with sterile deionized water to remove non-adherent bacteria. After 45 minutes of air drying, each well was filled with 200 µL of 0.2% (v/v) crystal violet solution (HiMedia, India) and incubated for 45 minutes at room temperature. The wells were then washed four times with sterile deionized water. The dye was solubilized in each well with 200 µL of 33% glacial acetic acid (HiMedia, India), and the optical density (OD) was measured at 650 nm using the iMark™ Microplate reader (Biorad, USA). Hassan et al. (2011) classified mean OD values greater than 0.108 as strong biofilm formers, 0.108-0.083 as moderate biofilm formers, and 0.083 as weak biofilm formers.

2.5. Hemolytic activity

A. hydrophila strains were examined for hemolytic activity on blood agar plates (Himedia, India) supplemented with 5% sheep blood. Aliquots (5 µL) of the overnight cultures were streaked onto the plates and incubated at 37°C for 18 h, following a previously established method (Rahim et al. 2004).

2.6. Screening of virulence genes

A total of 57 isolates were screened for 10 potential virulence genes, namely aerA coding for aerolysins, act coding for cytotoxic enterotoxins, alt coding for cytotonic enterotoxins, ahp coding for serine protease, ahyB coding for elastase, enol coding for enolase, fla coding for polar flagella, exu coding for DNases, lip coding for lipase, and hlyA coding for hemolysin using PCR. The primers used for target gene amplification, amplicon size, and annealing temperatures are shown in Table 1. The PCR amplification of virulence genes were carried out in Applied Biosystems™ Proflex™ (Thermo Fisher Scientific, USA), which consisted of an initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 40s, annealing for 40s (Table 2), extension at 72°C for 1 min, and a final extension at 72°C for 7 min. The PCR products run on 1.5% agarose (80 volts for 40 minutes) in an electrophoresis unit were captured digitally using a gel image system (Biorad, USA).

2.7. Statistical analysis

Data analysis was performed with Microsoft Excel (Microsoft Cooperation, 2013). The Chi-square test was used to analyze the data using R software version 15.0 at level of significance P <0.05.

3.1. Identification of A. hydrophila

The infected fish showed hemorrhages, abdominal distension, fin rot, tail rot, and exophthalmia (Figure 1). All of the presumptive bacterial isolates grown on Aeromonas selective agar, exhibiting round, reddish orange-colored, clear to slightly opalescent colonies of Gram-negative, rod-shaped, and motile bacilli, oxidase-positive, catalase-positive, and O/129-resistant bacteria were tentatively identified as Aeromonas spp. The results of 16S rRNA gene sequencing showed 97% similarity with other A. hydrophila (GenBank accession no: OP896992). Based on the 16S rRNA sequencing, the suspected isolates were definitively identified as A. hydrophila.

3.2. Distribution of A. hydrophila

A total of 100 samples were collected from fish farms in Andhra Pradesh, India, across Krishna and West Godavari districts. The total prevalence of A. hydrophila in this investigation was found to be 27%, encompassing IMC (C. catla and L. rohita) and Pangasius fish farms (P. hypophthalmus), as shown in Table 1. The incidence of A. hydrophila was higher in IMC (C. catla and L. rohita) than P. hypophthalmus. Regardless of farm-wise distribution, a total of 57 strains were collected from 253 fish (100 fish farms), including L. rohita (n = 24), C. catla (n = 18), and P. hypophthalmus (n = 15). Clinical examination of infected fishes revealed pale gills, dark skin, abdominal distension, exophthalmia, hemorrhages on the body surface and internal organs, and an enlarged liver (Fig 1).

3.3. Antimicrobial susceptibility

The antimicrobial resistance profiles of A. hydrophila (n = 57) isolates against six different antibiotics are shown in Table 3. The findings demonstrated that all isolates recovered from L. rohita, C. catla, and P. hypophthalmus exhibited varying degrees of susceptibility, intermediate resistance, and total resistance to all the antibiotics tested. The highest of resistance for A. hydrophila was found against trimethoprim (35.9%), followed by co-trimoxazole (21.1%), oxytetracycline (19.3%), doxycycline (17.5%), and enrofloxacin (8.9%), respectively. None of the isolates were found resistant to ciprofloxacin. The isolates from P. hypophthalmus showed high resistance in comparison to the isolates from IMC (C. catla and L. rohita).

3.4. Biofilm formation capabilities in A. hydrophila

A. hydrophila isolates were categorized as strong biofilm formers (SBF), moderate biofilm formers (MBF), and weak biofilm formers (WBF). 33%, 50% and 17% of the isolates were categorized as strong, moderate and weak biofilm formers, respectively. In the present study, all strong and moderate biofilm formers harbored the fla gene, which is responsible for virulence and biofilm formation in many Aeromonas spp.

3.5. β- Hemolysis

A. hydrophila strain interestingly demonstrated a very clear β-hemolysis in the form of clearance zone along the streak on blood agar plate within 24 h of incubation at room temperature (Fig 2). 70% of the strains were β- hemolytic in nature and remaining had no hemolytic activity.

3.5. Distribution of virulence-associated genes

Among the ten virulence genes examined, eight genes, namely aerA, act, alt, ahp, ahyB, enol, fla, and lip, were harbored in A. hydrophila (Fig 3-10; Table 4 and 5). The virulence gene distribution in representative A. hydrophila isolates was very high for enolase (enol, 96.4%), followed by flagellin (fla, 94.7%), cytotonic enterotoxins (alt, 91.2%), cytotoxic enterotoxins (act, 84.2%), lipase (lip, 77.1%), serine protease (ahp, 54.3%), aerolysin (aerA, 50.8%), and elastase (ahyB, 43.8%), respectively. 80% of the isolates possessed at least four virulence gene profiles (Table 5). None of the A. hydrophila isolates were found positive for hemolysin (hlyA) and DNases (exu) virulence genes. The statistical analysis revealed a significant variation in the prevalence of several virulence related genes among the tested isolates (p<0.000001).

The transition from extensive to intensive farming has aided the rapid development in animal food production, which has historically been accompanied by a rising trend of diseases in farmed animals (Van Boeckel et al. 2015, 2017; Schar et al. 2020). The genus Aeromonas contains a number of opportunistic pathogens causing diseases in human beings and aquatic animals (Schar et al. 2021), of which, A. hydrophila has been described as a significant pathogen of both humans and aquatic animals (Cui et al. 2007). There is evidence that Aeromonas infections exist and that the correlation between virulence-associated factors and virulence increases in fish and other animals (Li et al. 2011; Wang et al. 2021). The present study found that 27% of A. hydrophila isolates were prevalent in freshwater fish culture farms in Andhra Pradesh, India, revealing an opportunistic distribution of bacterial pathogens. A similar study was done by Nhing et al (2021), who reported that A. hydrophila prevalence was found to be 46.4% in different freshwater fishes in Vietnam, posing high potential pathogenicity to fish mortality. Hence, the present study validates the presence of A. hydrophila in freshwater fish species with obvious clinical signs and noticeable gross lesions, which may lead to mortalities. The presence of A. hydrophila isolates in healthy fish suggests that stress-related infections can be brought on by opportunistic bacterial pathogens in the aquatic environment.

Antimicrobial compounds are unrestrictedly used in intensive fish farming to prevent infectious diseases. As a result, reservoirs of antimicrobial-resistant bacteria have developed in fish and other aquatic species as well as in the aquatic environment (Akinbowale et al. 2006; Heuer et al. 2009). According to earlier reports, A. hydrophila isolates from freshwater fishes showed varying degrees of resistance to a wide range of antibiotics used to treat bacterial infections (Chang et al. 2007; Jacobs and Chenia 2007; Nawaz et al. 2010; Stratev et al. 2015; Aiyahya et al. 2018; Zhang et al. 2019; Dubey et al. 2022). Plasmids, transposons, and integrases, which are important in the acquisition and transmission of AMR and virulence genes among other bacteria, have been implicated in the development of antibiotic resistance in Aeromonas spp. (Sorum et al. 2003; Palu et al. 2006; Dubey et al. 2022). In this study, A. hydrophila isolates from IMC (C. catla and L. rohita) and P. hypophthalmus displayed varying degree of antimicrobial resistance to trimethoprim (35.9%), co-trimoxazole (21.1%), oxytetracycline (19.3%), doxycycline (17.5%) and enrofloxacin (8.9%). The higher levels of antibiotic resistance in A. hydrophila from P. hypophthalmus compared to IMC could indicate that antimicrobial drugs are used more frequently in Pangasius fish farming. It was observed that high stocking densities (n = 8000–10,000/acre) without proper farm management are major potential problems resulting in excessive use of chemicals in order to maintain the fish health. The dissimilarity in resistance patterns of A. hydrophila isolates among fish species may indicate historical variations in the frequency, quantity, method of application, and drug species used in fish production systems (Yuan et al. 2019).

The pathogenicity of A. hydrophila is linked to the expression of virulence factors (Kumar et al. 2022). There is evidence that greater pathogenicity in fish and other hosts is strongly correlated with the presence of virulence-associated components (Oliveira et al. 2012). In the current study, 80% of A. hydrophila isolates had a minimum of four virulence genes. Aerolysins, cytotoxic enterotoxins, cytotonic enterotoxins, serine proteases, elastases, enolases, polar flagella, DNases, lipases, and hemolysins, among other virulence factors, were found in A. hydrophila isolates from fishes, indicating that these bacteria may be extremely pathogenic (Jiravanichpaisal et al. 2009; Nawaz et al. 2010). These virulence genes have been extensively utilized to investigate the potential pathogenicity of Aeromonas spp. (Nawaz et al. 2010; Nhinh et al. 2021). In the present study, the virulence gene distribution in representative A. hydrophila isolates was very high for enolase (enol, 96.4%), followed by flagellin (fla, 94.7%), cytotonic enterotoxins (alt, 91.2%), cytotoxic enterotoxins (act, 84.2%), lipase (lip, 77.1%), serine protease (ahp, 54.3%), aerolysin (aerA, 50.8%), and elastase (ahyB, 43.8%), respectively. Enolases were found to be the most common virulent gene in this investigation, accounting for 96.4% of A. hydrophila strains. It was observed that these secreted and surface-expressed glycolytic enzymes work as transcriptional regulators in A. hydrophila and A. dhakensis by binding to host structures and breaking down blood plasma, both of which are required for survival in the host environment (Fernandez-Bravo and Figueras 2020). Similarly, fla gene plays a vital role in the development of biofilms by Aeromonas spp. and could be an important factor that may contribute to the pathogenicity to the host (Ibrahim et al. 2020; Kumar et al. 2022). In this study, fla virulent genes were detected in 94.7% of the isolates examined, which is almost similar to the study reported by Hayati et al. (2018), where 96.3% of isolates recovered from farmed and wild tilapia, climbing perch, and catfish in Malaysia harboured the fla gene. This demonstrates a close relationship between flagellum roles in Aeromonas spp. biofilm formation, which is important for disease development and conferring resistance to bactericidal drugs (Cai and Arias 2017; Rasmussen-Ivey et al. 2016b). It was discovered that all A. hydrophila strains can form strong (33%), moderate (50%), and weak (17%) biofilms, and that 100% of the strong and moderate biofilm formers carried the fla gene in this study. Cytotonic enterotoxins (alt), cytotoxic enterotoxins (act) and aerolysins (aerA) promotes tissue damage and fluid buildup in fish intestinal epithelial cells, responsible for enterotoxic, hemolytic, and cytotoxic effects (Sha et al. 2002). The incidence of the alt, act and aerA genes in A. hydrophila has also been linked to disease outbreaks in freshwater aquaculture (EI- Bahar et al, 2019; Nhinh et al, 2021). Herein, our study represents the 91.2%, 84.2%, and 50.8% of A. hydrophila isolates harboring alt, act, and aerA genes, respectively. Hemolysis and cytotoxicity are caused by aerolysin (aerA) and hemolysins (hlyA), which are important virulence factors in a variety of species and cell types (Elbahnaswy & Elshopakey 2020). However, in our study, hemolysin (hlyA) gene was not found in all the A. hydrophila isolates tested. Previous studies have found a relationship between the ability of the aerA, hly, and act genes to induce hemolytic activity and the pathogenic potential of Aeromonas spp. (Singh and Sanyal 1992). In the present study, 70% of the A. hydrophila strains were possessed β- hemolytic activity on blood agar supplemented with sheep blood. These findings are in line with earlier findings made by Messi et al. (2003) reported that A. hydrophila infections in fish are frequently associated with hemolytic and cytotoxic activities. Similarly, the extracellular lipases secreted by Aeromonas spp. (lip, lipH, pla, and plc) actively contribute to the alteration of the host plasma membrane, increasing the severity of infection. In the current investigation, the lip gene was present in 77.1% of the isolates. Extracellular serine protease (ahp) and elastase (ahyB) secretions promote the availability of nutrients and resistance to the host immune response, and they are associated with host tissue damage (Mzula et al. 2020). In the current study, serine protease (ahp) and elastase (ahyB) prevalence were 54.3% and 43.8%, respectively. These genes involved in the regulation and secretion of extracellular serine proteases (ahp) and lipases (lip) play a coherent, integrated function in the pathogenicity of the furunculosis disease caused by A. salmonicida in coldwater fishes (Falco et al. 2012). Additionally, it has been suggested that serine protease may change the virulence of aeromonads by activating aerolysin (aerA) and other extracellular enzymes (Cahill 1990). Concerning public health hazards, aerolysins, cytotoxic enterotoxins, cytotonic enterotoxins, enolases, flagellins, elastases, serine proteases, DNases, lipases, and hemolysins are the key contributors to the virulence of pathogenic Aeromonas strains in humans and animals causing gastroenteritis and skin and soft-tissue infections, followed by bacteremia and sepsis, as well as other infections that affect the hepatobiliary system, respiratory tract, bones, and joints (Nawaz et al. 2010; Hu et al. 2012; Chen et al. 2013; Figueras and Beaz-Hidalgo 2015; Fernandez-Bravo and Figueras 2020; Roges et al. 2020). Hence, care must be taken in all cases while handling fish for routine health monitoring and disease diagnosis. It was observed that, none of the interviewed farmers and farm workers used gloves or face masks when handling the infected fish and chemical and biological products. Few farm workers who handled infected animals and chemicals reported nausea, burns, rashes, or eye irritation. This may potentially affect the fish handlers, leading to severe health issues. This is primarily due to lack of awareness of the risks involved in handling fish pathogens and the use of chemical and biological products in aquaculture practices to prevent disease.

The prevalence of A. hydrophila has been determined at 27% in healthy and diseased freshwater fishes. Most of the isolates harboured a maximum of four virulence genes that posed a high potential for pathogenicity in fish. The presence of numerous virulent genes detected in A. hydrophila isolates in this investigation may confer synergistic effects due to a combination of such genes. The AMR prevalence was found to be low in this study; however, these findings may serve as a caution to farmers and aquaculture entrepreneurs in terms of reducing the incidence of pathogenic A. hydrophila in fish culture systems by implementing best management practices.

Acknowledgment

The authors would like to express their gratitude to the Vice -chancellor and Dean, faculty of fisheries science at the Kerala University of Fisheries and Ocean Studies in Kochi, Kerala, India, for providing all necessary facilities and support for this research.

Financial support

No specific funds were received for this work. This study was part of the Ph.D. programme of the first author at the Kerala University of Fisheries and Ocean Studies, Kochi, India, for which University fellowship was received.

Conflicts of Interest

The authors declare no conflicts of interest.

Author contribution

Kummari Suresh is responsible for data and sample collection, planning and designing the study, analysis, result interpretation, and the drafting of the original manuscript. Devika Pillai was responsible for the planning of the study, the analysis and interpretation of results, and the critical evaluation and editing of the manuscript.

Availability of data and material

The authors declare that there are no objections to the data availability and materials.

Ethical approval

The present was approved by the department of Aquatic Animal Health Management, Faculty of Fisheries Science, Kerala University of Fisheries and Ocean Studies, Kochi, India. All methods were carried out in accordance with applicable guidelines and regulations for the handling of fish and AMR pathogens.

Aiyahya SA, Ameen F, Al-Niaeem K S, Al-Saadi BA, Hadi S, Mostafa AA (2018) Histopathological studies of experimental Aeromonas hydrophila infection in blue tilapia, Oreochromis aureus. Saudi Journal of Biological Sciences 25(1): 182-185. https://doi.org/10.1016/j.sjbs.2017.10.019
Akinbowale OL, Peng H, Barton MD (2006) Antimicrobial resistance in bacteria isolated from aquaculture sources in Australia. Journal of applied microbiology 100(5): 1103-1113. https://doi.org/10.1111/j.1365-2672.2006.02812.x
Austin B, Austin DA, Munn CB (2007) Bacterial fish pathogens: disease of farmed and wild fish (Vol. 26, p. 552). Chichester: Springer
Awan F, Dong Y, Wang N, Liu J, Ma K, Liu Y (2018) The fight for invincibility: environmental stress response mechanisms and Aeromonas hydrophila. Microbial pathogenesis 116: 135-145. https://doi.org/10.1016/j.micpath.2018.01.023
Bauer AW (1966) Antibiotic susceptibility testing by a standardized single disc method. Am J clin pathol 45: 149-158
Buentello JA, Reyes-Becerril M, de Jesus Romero-Geraldo M, de Jesus Ascencio-Valle F (2007) Effects of dietary arginine on hematological parameters and innate immune function of channel catfish. Journal of Aquatic Animal Health 19(3): 195-203. https://doi.org/10.1577/H07-004.1
Cahill MM (1990) Bacterial flora of fishes: a review. Microbial ecology 19(1): 21-41. https://doi.org/10.1007/BF02015051
Cai W, Arias CR (2017) Biofilm formation on aquaculture substrates by selected bacterial fish pathogens. Journal of Aquatic Animal Health 29(2): 95-104. https://doi.org/10.1080/08997659.2017.1290711
Cai W Willmon E, Burgos FA, Ray CL, Hanson T, Arias CR (2019) Biofilm and Sediment are Major Reservoirs of Virulent Aeromonas hydrophila (vAh) in Catfish Production Ponds. Journal of aquatic animal health 31(1): 112-120. https://doi.org/10.1002/aah.10056
Chandrarathna HPSU, Nikapitiya C, Dananjaya SHS, Wijerathne CUB et al (2018) Outcome of co-infection with opportunistic and multidrug resistant Aeromonas hydrophila and A. veronii in zebrafish: Identification, characterization, pathogenicity and immune responses. Fish & shellfish immunology 80: 573-581. https://doi.org/10.1016/j.fsi.2018.06.049
Chang YC, Shih DYC, Wang JY, Yang SS (2007) Molecular characterization of class 1 integrons and antimicrobial resistance in Aeromonas strains from foodborne outbreak-suspect samples and environmental sources in Taiwan. Diagnostic microbiology and infectious disease 59(2): 191-197. https://doi.org/ 10.1016/j.diagmicrobio.2007.04.007
Chen J, Zhu N, Kong L, Bei Y, Zheng T, Ding X, He Z (2013) First case of soft shell disease in Chinese soft-shelled turtle (Trionyx sinens) associated with Aeromonas sobria–A. veronii complex. Aquaculture 406: 62-67
Chirapongsatonkul N, Srichanun M (2018) Virulence factor gene profiles of Aeromonas veronii isolated from diseased Nile tilapia (Oreochromis niloticus) in Nakhon Si Thammarat province and its expression towards diurnal water temperature changes. International Journal of Agricultural Technology 14(7): 1115-1128
CLSI (2022) Performance standards for antimicrobial susceptibility testing. 32^nd edition. CLSI supplement M100. Clinical and Laboratory Standards Institute; 2022
Cui H, Hao S, Arous E (2007) A distinct cause of necrotizing fasciitis: Aeromonas veronii biovar sobria. Surgical infections 8(5): 523-528. https://doi.org/10.1089/sur.2006.046
Dubey S, Ager-Wick E, Kumar J, Karunasagar I, Karunasagar I et al (2022) Aeromonas species isolated from aquatic organisms, insects, chicken, and humans in India show similar antimicrobial resistance profiles. Frontiers in Microbiology 13. https://doi.org/10.3389/fmicb.2022.1008870
El-Bahar HM, Ali NG, Aboyadak IM, Khalil SAES, Ibrahim MS (2019) Virulence genes contributing to Aeromonas hydrophila pathogenicity in Oreochromis niloticus. International Microbiology 22(4): 479-490. https://doi.org/10.1007/s10123-019-00075-3
Elbahnaswy S, Elshopakey GE (2020) Differential gene expression and immune response of Nile tilapia (Oreochromis niloticus) challenged intra-peritoneally with Photobacterium damselae and Aeromonas hydrophila demonstrating immunosuppression. Aquaculture 526: 735364. https://doi.org/10.1016/j.aquaculture.2020.735364
Esteve C, Alcaide E, Blasco MD (2012) Aeromonas hydrophila subsp. dhakensis isolated from feces, water and fish in Mediterranean Spain. Microbes and environments 27(4): 367-373. https://doi.org/10.1264/jsme2.ME12009
Falco A, Frost P, Miest J, Pionnier N, Irnazarow I, Hoole D (2012) Reduced inflammatory response to Aeromonas salmonicida infection in common carp (Cyprinus carpio L.) fed with β-glucan supplements. Fish & shellfish immunology 32(6): 1051-1057. https://doi.org/10.1016/j.fsi.2012.02.028
Fernandez-Bravo A, Figueras MJ (2020) An update on the genus Aeromonas: Taxonomy, epidemiology, and pathogenicity. Microorganisms 8(1): 129. https://doi.org/10.3390/microorganisms8010129
Figueras MJ, Beaz-Hidalgo R (2015) Aeromonas infections in humans. In Aeromonas; Academic Press: Norfolk, UK, pp. 65–108
Gao X, Tao Y, Lamas V, Huang M, Yeh WH, Pan B et al (2018) Treatment of autosomal dominant hearing loss by in vivo delivery of genome editing agents. Nature 553(7687): 217-221. https://doi.org/10.1038/nature25164
Hassan A, Usman J, Kaleem F, Omair M, Khalid A: Iqbal M (2011) Evaluation of different detection methods of biofilm formation in the clinical isolates. Brazilian journal of infectious diseases 15: 305-311. https://doi.org/10.1016/S1413-8670(11)70197-0
Hayati, HR, Hassan MD, Lee OB, Hidayahanum HN, Faten A, Raina MS et al (2018) Detection of class 1 integron and antibiotic resistance genes in Aeromonas hydrophila isolated from freshwater fish. In Proceedings of the Second International Conference on the Future of ASEAN (ICoFA) 2017–Volume 2 (pp. 705-717). Springer, Singapore
Heuer OE, Kruse H, Grave K, Collignon P, Karunasagar I, Angulo FJ (2009) Human health consequences of use of antimicrobial agents in aquaculture. Clinical Infectious Diseases 49(8): 1248-1253. https://doi.org/10.1086/605667
Hoai TD, Trang TT, Van Tuyen N, Giang NTH, Van Van K (2019) Aeromonas veronii caused disease and mortality in channel catfish in Vietnam. Aquaculture 513: 734425
Holt JG, Krieg NR, Sneath PH, Staley JT, Williams ST (1994) Bergey's Manual of determinate bacteriology. Lippincott Williams and Wilkins, Baltimore.
Hu M, Wang N, Pan ZH, Lu CP, Liu YJ (2012) Identity and virulence properties of Aeromonas isolates from diseased fish, healthy controls and water environment in China. Letters in Applied Microbiology 55(3): 224-233. https://doi.org/ 10.1111/j.1472-765X.2012.03281.x
Ibrahim IR, Abdullah SMA, Abdulkarim Yasin Karim AY (2020) Determination of the optimal conditions of cloning Aerolysin gene from the common carp pathogen Aeromonas hydrophila in Escherichia coli BL21. Iranian Journal of Fisheries Sciences 19(5): 2258-2273
Jacobs L, Chenia HY (2007) Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. isolated from South African aquaculture systems. International journal of food microbiology 114(3): 295-306. https://doi.org/10.1016/j.ijfoodmicro.2006.09.030
Janda JM, Abbott SL (2010) The genus Aeromonas: taxonomy, pathogenicity, and infection. Clinical microbiology reviews 23(1): 35-73. https://doi.org/10.1128/CMR.00039-09
Jiravanichpaisal P, Roos S, Edsman L, Liu H, Soderhall K (2009) A highly virulent pathogen, Aeromonas hydrophila, from the freshwater crayfish Pacifastacus leniusculus. Journal of Invertebrate Pathology 101(1): 56-66. https://doi.org/10.1016/j.jip.2009.02.002
Katiha PK, Jena JK, Pillai NGK, Chakraborty C, Dey MM (2005) Inland aquaculture in India: past trend, present status and future prospects. Aquaculture Economics & Management 9(1-2): 237-264. https://doi.org/10.1080/13657300590961573
Kingombe CIB, Huys G, Tonolla M, Albert MJ, Swings J, Peduzzi R, Jemmi T (1999) PCR detection, characterization, and distribution of virulence genes in Aeromonas spp. Applied and Environmental Microbiology 65(12): 5293-5302
Kpoda DS, Ajayi A, Somda M, Traore O et al (2018) Distribution of resistance genes encoding ESBLs in Enterobacteriaceae isolated from biological samples in health centers in Ouagadougou, Burkina Faso. BMC research notes 11(1): 1-5. https://doi.org/10.1186/s13104-018-3581-5
Kumar V, Das BK, Swain HS, Chowdhury H et al (2022) Outbreak of Ichthyophthirius multifiliis associated with Aeromonas hydrophila in Pangasianodon hypophthalmus: The role of turmeric oil in enhancing immunity and inducing resistance against co-infection. Frontiers in immunology 13: 956478. https://doi.org/10.3389/fimmu.2022.956478
Kummerer K (2001) Drugs in the environment: emission of drugs, diagnostic aids and disinfectants into wastewater by hospitals in relation to other sources–a review. Chemosphere 45(6-7): 957-969. https://doi.org/10.1016/s0045-6535(01)00144-8
Li J, Ni XD, Liu YJ, Lu CP (2011) Detection of three virulence genes alt, ahp and aerA in Aeromonas hydrophila and their relationship with actual virulence to zebrafish. Journal of Applied Microbiology 110(3): 823-830. https://doi.org/10.1111/j.1365-2672.2011.04944.x
Liu L, Gong Y X, Liu GL, Zhu B, Wang GX (2016) Protective immunity of grass carp immunized with DNA vaccine against Aeromonas hydrophila by using carbon nanotubes as a carrier molecule. Fish & shellfish immunology 55: 516-522. https://doi.org/10.1016/j.fsi.2016.06.026
Liu X, Steele J C, Meng X Z (2017) Usage, residue, and human health risk of antibiotics in Chinese aquaculture: a review. Environmental Pollution, 223: 161-169. https://doi.org/10.1016/j.envpol.2017.01.003
Long M, Nielsen TK, Leisner JJ, Hansen LH, Shen ZX, Zhang QQ, Li A (2016) Aeromonas salmonicida subsp. salmonicida strains isolated from Chinese freshwater fish contain a novel genomic island and possible regional-specific mobile genetic elements profiles. FEMS Microbiology Letters 363(17): 190. https://doi.org/10.1093/femsle/fnw190
Lulijwa R, Rupia EJ, Alfaro AC (2020) Antibiotic use in aquaculture, policies and regulation, health and environmental risks: a review of the top 15 major producers. Reviews in Aquaculture 12(2): 640-663. https://doi.org/10.1111/raq.12344
Lynch, SV, Wiener-Kronish JP (2008) Novel strategies to combat bacterial virulence. Current opinion in critical care 14(5): 593. https://doi.org/10.1097/MCC.0b013e32830f1dd5
Mansour A, Mahfouz NB, Husien M M, El-Magd MA (2019) Molecular identification of Aeromonas hydrophila strains recovered from Kafrelsheikh fish farms. Slovenian Veterinary Research 56(22): 201-208. https://doi.org/10.26873/SVR-758-2019
Martino ME, Fasolato L, Montemurro F, Rosteghin M, Manfrin A, Patarnello T, Cardazzo B (2011) Determination of microbial diversity of Aeromonas strains on the basis of multilocus sequence typing, phenotype, and presence of putative virulence genes. Applied and environmental microbiology 77(14): 4986-5000. https://doi.org/10.1128/AEM.00708-11
Mathur T, Singhal S, Khan S, Upadhyay DJ, Fatma T, Rattan A (2006) Detection of biofilm formation among the clinical isolates of staphylococci: an evaluation of three different screening methods. Indian journal of medical microbiology 24(1): 25-29. https://doi.org/10.4103/0255-0857.19890
Messi P, Guerrieri E, Bondi M (2003) Bacteriocin-like substance (BLS) production in Aeromonas hydrophila water isolates. FEMS Microbiology letters 220(1): 121-125. https://doi.org/10.1016/S0378-1097(03)00092-2
Mishra SS, Rakesh D, Dhiman M, Choudhary P, Debbarma J, Sahoo SN, Mishra CK (2017a) Present status of fish disease management in freshwater aquaculture in India: state-of-the-art-review. Journal of Aquaculture & Fisheries 1(003): 14. https://doi.org/10.24966/AAF-5523/100003
Mishra SS, Das R, Das B K, Choudhary P, Rathod R, Giri BS, Swain P (2017b) Status of Aqua-medicines, drugs and chemicals use in India: A Survey Re-port. J Aquac Fisheries 1(004). http://dx.doi.org/10.24966/AAF-5523/100004
Mitra S, Khan MA, Nielsen R (2019) Credit constraints and aquaculture productivity. Aquaculture Economics & Management 23(4): 410-427. https://doi.org/10.1080/13657305.2019.1641571
Mzula A, Wambura PN, Mdegela RH, Shirima GM (2020) Virulence pattern of circulating aeromonads isolated from farmed Nile tilapia in Tanzania and novel antibiotic free attenuation of Aeromonas hydrophila strain TZR7-2018. Aquaculture Reports 17: 100-300. https://doi.org/10.1016/j.aqrep.2020.100300
Nawaz M, Khan SA, Khan AA, Sung K, Tran Q, Kerdahi K, Steele R (2010) Detection and characterization of virulence genes and integrons in Aeromonas veronii isolated from catfish. Food microbiology 27(3): 327-331. https://doi.org/10.1016/j.fm.2009.11.007
Nhinh DT, Le DV, Van KV, Huong Giang NT, Dang LT, Hoai TD (2021) Prevalence, virulence gene distribution and alarming the multidrug resistance of Aeromonas hydrophila associated with disease outbreaks in freshwater aquaculture. Antibiotics 10(5): 532. https://doi.org/10.3390/antibiotics10050532
Oliveira ST, Veneroni-Gouveia G, Costa MM (2012) Molecular characterization of virulence factors in Aeromonas hydrophila obtained from fish. Pesquisa Veterinária Brasileira 32: 701-706. doi: 10.3390/antibiotics10050532
Palu AP, Gomes LM, Miguel MAL, Balassiano IT, Queiroz MLP, Freitas-Almeida AC & de Oliveira SS (2006) Antimicrobial resistance in food and clinical Aeromonas isolates. Food microbiology 23(5), 504-509. https://doi.org/10.1016/j.fm.2005.07.002
Patil PK, Geetha R, Bhuvaneswari T, Saraswathi R et al (2022) Use of chemicals and veterinary medicinal products (VMPs) in Pacific whiteleg shrimp, P. vannamei farming in India. Aquaculture 546: 737285. https://doi.org/10.1016/j.aquaculture.2021.737285
Rahim Z, Khan SI, Chopra AK (2004) Biological characterization of Aeromonas spp. isolated from the environment. Epidemiology & Infection 132(4): 627-636. https://doi.org/10.1017%2Fs0950268804002298
Rasmussen-Ivey CR, Figueras MJ, McGarey D, Liles MR (2016a) Virulence factors of Aeromonas hydrophila: in the wake of reclassification. Frontiers in Microbiology 7: 1337. https://doi.org/10.3389/fmicb.2016.01337
Rasmussen-Ivey CR, Hossain MJ, Odom SE et al (2016b) Classification of a hypervirulent Aeromonas hydrophila pathotype responsible for epidemic outbreaks in warm-water fishes. Frontiers in microbiology 7: 1615. https://doi.org/10.3389/fmicb.2016.01615
Roges EM, Gonçalves VD, Cardoso MD et al (2020) Virulence-associated genes and antimicrobial resistance of Aeromonas hydrophila isolates from animal, food, and human sources in Brazil. BioMed Research International 1-8. https://doi.org/10.1155/2020/1052607
Sawyer RG, Claridge JA, Nathens AB, Rotstein OD et al (2015) Trial of short-course antimicrobial therapy for intra-abdominal infection. New England Journal of Medicine 372(21): 1996-2005. https://doi.org/10.1056/NEJMoa1411162
Schar D, Klein EY, Laxminarayan R, Gilbert M, Van Boeckel TP (2020) Global trends in antimicrobial use in aquaculture. Scientific reports 10(1): 1-9. https://doi.org/10.1038/s41598-020-78849-3
Schar D, Zhao C, Wang Y, Larsson DG, Gilbert M, Van Boeckel TP (2021) Twenty-year trends in antimicrobial resistance from aquaculture and fisheries in Asia. Nature communications 12(1): 1-10. https://doi.org/10.1038/s41467-021-25655-8
Sha J, Kozlova EV, Chopra AK (2002) Role of various enterotoxins in Aeromonas hydrophila-induced gastroenteritis: generation of enterotoxin gene-deficient mutants and evaluation of their enterotoxic activity. Infection and Immunity 70(4): 1924-1935. https://doi.org/10.1128/IAI.70.4.1924-1935.2002
Singh DV, Sanyal SC (1992) Production of haemolysis and its correlation with enterotoxicity in Aeromonas spp. Journal of medical microbiology 37(4): 262-267. https://doi.org/10.1099/00222615-37-4-262
Sorum H, LAbee-Lund TM, Solberg A, Wold A (2003) Integron-containing IncU R plasmids pRAS1 and pAr-3s2 from the fish pathogen Aeromonas salmonicida. Antimicrobial agents and Chemotherapy 47(4): 1285-1290. https://doi.org/10.1128/AAC.47.4.1285-1290.2003
Sreedharan K, Philip R, Singh ISB (2012) Virulence potential and antibiotic susceptibility pattern of motile aeromonads associated with freshwater ornamental fish culture systems: a possible threat to public health. Brazilian Journal of Microbiology 43: 754-765. https://doi.org/10.1590/S1517-83822012000200040
Stratev D, Stoev S, Vashin I, Daskalov H (2015) Some varieties of pathological changes in experimental infection of carps (Cyprinus carpio) with Aeromonas hydrophila. Journal of Aquaculture Engineering and Fisheries Research 1(4): 191-202. https://doi.org/10.3153/JAEFR15019
Tavares-Dias M, Martins ML (2017) An overall estimation of losses caused by diseases in the Brazilian fish farms. Journal of Parasitic Diseases 41(4): 913-918. https://doi.org/10.1007/s12639-017-0938-y
Thomas J, Jerobin J, Seelan TSJ, Thanigaivel S, Vijayakumar S, Mukherjee A, Chandrasekaran N (2013) Studies on pathogenecity of Aeromonas salmonicida in catfish Clarias batrachus and control measures by neem nano-emulsion. Aquaculture 396: 71-75
Van Boeckel TP, Brower C, Gilbert M, Grenfell BT et al (2015) Global trends in antimicrobial use in food animals. Proceedings of the National Academy of Sciences 112(18): 5649-5654. https://doi.org/10.1073/pnas.1503141112
Van Boeckel TP, Glennon EE, Chen D et al (2017) Reducing antimicrobial use in food animals. Science 357(6358): 1350-1352. https://doi.org/10.1126/science.aao1495
Wang G, Sun Q, Wang H, Liu H (2021) Identification and characterization of circRNAs in the liver of blunt snout bream (Megalobrama amblycephala) infected with Aeromonas hydrophila. Developmental & Comparative Immunology 124: 104185. https://doi.org/10.1016/j.dci.2021.104185
Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. Journal of bacteriology 173(2): 697-703. https://doi.org/10.1128/jb.173.2.697-703.1991
Yao Z, Sun L, Wang Y, Lin L, Guo Z, Li D et al (2018) Quantitative proteomics reveals antibiotics resistance function of outer membrane proteins in Aeromonas hydrophila. Frontiers in cellular and infection microbiology 8: 390. https://doi.org/10.3389/fcimb.2018.00390
Yuan J, Ni M, Liu M, Zheng Y, Gu Z (2019) Occurrence of antibiotics and antibiotic resistance genes in a typical estuary aquaculture region of Hangzhou Bay, China. Marine pollution bulletin 138: 376-384. https://doi.org/10.1016/j.marpolbul.2018.11.037
Zhang CN, Zhang JL, Guan WC, et al (2017) Effects of Lactobacillus delbrueckii on immune response, disease resistance against Aeromonas hydrophila, antioxidant capability and growth performance of Cyprinus carpio Huanghe var. Fish & Shellfish Immunology 68: 84-91. https://doi.org/10.1016/j.fsi.2017.07.012
Zhang DX, Kang YH, Song MF, Shu HP et al (2019) Identity and virulence properties of Aeromonas isolates from healthy Northern snakehead (Channa argus) in China. Letters in applied microbiology 69(2): 100-109. https://doi.org/10.1111/lam.13172

Table 1. Prevalence and distribution of A. hydrophila from fish farms

Fish samples	*Prevalence of A. hydrophila* in freshwater fish farms**
Fish samples	No. of farms (n=100)	Number of farms positive with A. hydrophila (n=27)
IMC	73	18
P. hypophthalmus	27	9

Table 2. List of primers, expected amplicon size and their corresponding annealing temperatures used in this study.

Target Gene	Primer sequence (5’-3’)	Product size (bp)	Annealing temperature (°C)	Reference
16S rRNA	F- AGAGTTTGATCCTGGCTCAG R- TACGGCTACCTTGTTACGACTT	1500	60	Weisburg et al. 1991
aerA	F- CAAGAACAAGTTCAAGTGGCCA R- ACGAAGGTGTGGTTCCAGT	309	59	Li et al. 2011
Alt	F- TGACCCAGTCCTGGCACGGC R- GGTGATCGATCACCACCAGC	442
Ahp	F- ATTGGATCCCTGCCTA R- GCTAAGCTTGCATCCG	911
act	F- GAGAAGGTGACCACCAAGAACA R- AACTGACATCGGCCTTGAACTC	232	62	Kingombe et al. 1999
ahyB	F- ACACGGTCAAGGAGATCAAC R- CGCTGGTGTTGGCCAGCAGG	540	53	Mansour et al. 2019
Enol	F- CGCCGACAACAACGTCGACATC R- CTTGATGGCAGCCAGAGTTTCG	598	61	Martino et al. 2011
Fla	F- TCCAACCGTYTGACCTC R- GMYTGGTTGCGRATGGT	608	57	Nawaz et al. 2010
Exu	F- AGGACATGCACAACCTCTTCC R- GATTGGTATTGCCCTTGCAACG	323	59	Nawaz et al. 2010
Lip	F- GACTCCCTCAAGGACAGCAG R- AGAGGCTTTCAGGGCATTG	594	58	Chirapongsatonkul and Srichanun 2018
Hly	F- GGCCGGTGGCCCGAAGATACGGG R- GGCGGCGCCGGACGAGACGGGG	597	62	Sreedharan et al. 2012

Table 3. Antimicrobial susceptibility profile of A. hydrophila to different antibiotics tested.

Antimicrobial agents	Concentration (µg)	Antimicrobial susceptibility profile of A. hydrophila
		Sensitive		Intermediate		Resistant
		No	%	No	%	No	%
Oxytetracycline (OT)	30	14	24.6	32	56.1	11	19.3
Doxycycline (DO)	30	32	56.1	15	26.3	10	17.5
Ciprofloxacin (CIP)	5	45	78.9	12	21.1	-	-
Enrofloxacin (EX)	10	36	64.3	15	26.8	5	8.93
Trimethoprim (TR)	30	22	38.6	15	26.3	20	35.9
Co-trimoxazole (COT)	25	20	35.1	25	43.9	12	21.1
Chi-square value		220.0702		57		0.017544
p-value		0.00000		0.0000		1.00

Table 4. Prevalence of virulence gene distribution in A. hydrophila

Gene function	Gene acronym	Total no. of isolates	Prevalence of A. hydrophila		Statistical analysis
Gene function	Gene acronym	Total no. of isolates	No of isolates	%	Statistical analysis
Virulence genes	aerA	n=57	29	50.8	Chi-square value: 1385.281 p-value: <0.000001
	Act		48	84.2
	Alt		52	91.2
	Ahp		31	54.3
	ahyB		25	43.8
	Enol		55	96.4
	Fla		54	94.7
	Exu		-	-
	Lip		44	77.1
	Hly		-	-

Table 5. Virulence, hemolytic activity and biofilm formation profile of A. hydrophila from fish samples.

Isolate	Source	Virulence profile	Hemolysis
Ah1	Intestinal swab	enol, fla, alt, aerA, act	P
Ah2	Gill swab	enol, fla, alt, aerA, alt	P
Ah3	Gill swab	enol, fla, alt, aerA,	P
Ah4	Intestinal swab	fla, ahyB, ahp, enol, act, alt	A
Ah6	Intestinal swab	enol, fla, ahyB, ahp, act, alt, lip	P
Ah7	Intestinal swab	enol, fla, alt, aerA, lip	P
Ah9	Gill swab	enol, fla, act, alt	A
Ah10	Gill swab	enol, fla, aerA, lip, act, ahp	P
Ah11	Gill swab	enol, fla,lip, act, alt	A
Ah13	Intestinal swab	enol, fla, ahyB, ahp, aerA, act, alt	P
Ah14	Intestinal swab	enol, fla, ahyB, ahp, aerA, act, alt, lip	P
Ah15	Gill swab	enol, fla, ahyB, ahp, aerA, act, alt, lip	P
Ah17	Gill swab	enol, lip, aerA, lip	P
Ah18	Gill swab	enol, fla, ahp, act	A
Ah19	Intestinal swab	enol, fla, ahyB, ahp, enol, act, alt	A
Ah20	Gill swab	ahp, enol, act, alt	P
Ah22	Intestinal swab	act, alt, ahp, alt	P
Ah24	Intestinal swab	ala, aerA, ahp, enol	P
Ah25	Gill swab	ahyB, ahp, act, lip, enol	A
Ah26	Gill swab	ahp, aerA, enol, fla	P
Ah27	Gill swab	enol, fla, ahyB, ahp, alt	A

enol: enolase, fla: flagellin, alt: cytotonic enterotoxins, act: cytotoxic enterotoxins, lip: lipase, ahp: serine protease, aerA: aerolysin, ahyB: elastase, A: absent, P: present.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Prevalence and characterization of virulence-associated genes and antimicrobial resistance in Aeromonas hydrophila from freshwater finfish farms in Andhra Pradesh, India

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Status:

Version 1