Impact of H9N2 Infection on the Pathological and Immunological Effects of the IBD Vaccine in Chicks: A Study of Vaccine Interaction and Immune Response

doi:10.21203/rs.3.rs-2596118/v1

Download PDF

Research Article

Impact of H9N2 Infection on the Pathological and Immunological Effects of the IBD Vaccine in Chicks: A Study of Vaccine Interaction and Immune Response

https://doi.org/10.21203/rs.3.rs-2596118/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background:

This study aimed to investigate the impact of H9N2 infection on the pathological and immunological effects of the IBD vaccine, and how their interaction affects the immune response to other vaccines. The objective was to determine if H9N2 infection before IBD vaccination influences the efficacy of the vaccine and if it impacts other vaccines' immune response. One hundred SPF chicks were divided into four groups in four isolators that were either H9N2 challenged, IBD vaccinated, both, or neither. Blood samples were collected weekly to measure antibody titers against IBDV, ND, H5, and H9. Cloacal swabs were taken on the 4^th and 8^th days post-vaccination to quantify the IBD vaccine shedding. Five chicks per group were euthanized at the 17^th, 21^st, and 25^th days old to calculate immune organ indices and conduct histopathological examinations.

Results:

The study's results revealed that pre-challenge with H9N2 affected many factors. The dual-treated group had a significant decrease in the bursal index compared to the other groups. The bursal microscopical score and renal lesion score of the dual-treated group recorded a significant rise when compared to the other groups. The shedding of the IBD vaccine was negatively affected by pre-infection with H9N2, so the dual-treated group recorded a significant decrease in IBDV shedding in comparison to the IBD-vaccinated group. Additionally, the immune response against the IBD vaccine significantly decreased in the dual-treated group. Finally, there was an increase in the immunosuppressive effect of the IBD vaccine, which reflected a significant decline in the antibody titers against ND and H5 in the dual-treated group.

Conclusion:

The study suggests that early diagnosis of H9N2 before IBD vaccination is crucial. Pre-challenge with H9N2 significantly impacted the pathological and immunological effects of the IBD vaccine. The results showed a decrease in IBD vaccine shedding and immune response against the IBD vaccine in the dual-treated group. The immunosuppressive effect of the IBD vaccine also affected the immune response to other vaccines, as shown by the significant decline in the antibody titers against ND and H5 in the dual-treated group. Therefore, the study highlights the importance of considering H9N2 infection status before administering the IBD vaccine to ensure optimal immune response and protection.

Infectious bursal disease vaccine

228E

H9N2

bursa of Fabricius

ELISA

real-time PCR.

Infectious bursal disease (IBD) is a significant and concerning disease that primarily affects chickens and impairs their immune system. The virus specifically targets the bursa of Fabricius and reproduces in immature B lymphocytes, leading to the immunosuppressive effect. [1]. Consequently, bursal atrophy occurs due to lymphoid depletion especially at the 5th DPC to reach one-third of its weight at the 8th DPC [2].

So, all poultry producers are careful about the IBD vaccination even though the live IBD vaccines can cause varying levels of immunosuppression due to damage to the bursa of Fabricius (B.F), depending on the degree of attenuation of the strain used in the vaccines [3]. A significant drop in the B- cells count was recorded in SPF chicks vaccinated by the intermediate plus IBD vaccines [4]. Also, there were low antibody titers and low B cell count in commercial layer pullets vaccinated by the intermediate plus IBD live vaccine (228E) [5]. In contrast, mild to moderate lymphoid depletion with fairly minimal lesion scores were recorded in the bursae of vaccinated chickens with GM-97 compared to IBDV challenged group [6]. Also, the vaccination with the Winterfield 2512 g-61 strain didn’t cause lymphoid depletion as there is no follicular atrophy or cystic follicles formation in the vaccinated broilers [7].

Avian influenza (AI) H9N2 disease is one of the most prevalent infectious diseases causing greater economic losses to poultry production worldwide due to its wide expansion and coinfection with other pathogens than highly pathogenic H5 or H7 subtypes which are generally more localized [8]. It was isolated for the first time from chickens in Germany in 1949 [9]. It was sporadically isolated from chickens in the Northern USA, and from wild birds and domestic ducks in Eurasia in the following decades [10]. In 1992, the first outbreak of H9N2 subtype LPAIV strain AID93-1 was recorded in the Guangdong province of Southern China [11] then it spread to much of Asia, the Middle East and North and West Africa over the last 15 years [12]. In Egypt, the first report of isolation of AIV-H9N2 was in 2011 from a bobwhite quail (Colinus virginianus) without showing clinical signs or mortalities [13]. The H9N2 is classified as a low pathogenic virus due to having a single amino acid-base (arginine) at its cleavage site of HA antigen so, it can replicate only in limited tissues of respiratory and digestive systems [14]. However, its immunosuppressive effect can’t be overlooked because it has a direct effect on the immune organs and it is capable of induction of early necrosis and depletion in the bursa of Fabricius at 4th to 11th days post-challenge (DPC) [15, 16]. Avian influenza H9N2 infection resulted in lymphocytic necrosis, atrophy and cystic replacement to the lymphoid follicles of the bursa of Fabricius and mild lymphocytic depletion in the medulla of the thymus [17]. Also, severe immunosuppression was recorded in broilers challenged with H9N2 due to degenerative changes in the bursa, thymus and spleen and a significant decline in the relative weight of the immune organ. Consequently, low response to the ND vaccine occurred [18].

To the best of our knowledge, the previous studies focused on the pathological impact of the IBD vaccine but the study of the patho-immunological response of the IBD vaccine in the presence of H9N2 infection and the impact of the interaction between them on the immune response to other vaccines were points of interest. As the H9N2 is a circulating virus in most poultry farms with a silent effect and both H9N2 and IBD vaccine are immunosuppressive factors having a direct effect on the bursa of Fabricius and. So, our study aimed to appraise the pathological, immunological and viral effects of the IBD vaccine throughout the H9N2 infection and the effect of the interaction between them on other vaccines' immune response as well.

Viruses and vaccines:

The avian influenza H9N2 reference strain (OK148893) was kindly provided by Animal Health Research Institute, Dokki, Giza.

The following commercially available vaccines were used in accordance with the manufacturers’ guidelines, A commercially available live IBD vaccine based on strain (228E) (1000 doses) was supplied by INTERVET INTERNATIONAL B.V BOYMEER-HOLLAND, Batch NO. A206AJ01. Inactivated H5N1 avian influenza + N.D. vaccine: ME FLUVAC H5 + ND7 was purchased by Me Vac Middle East for Veterinary Vaccines Egypt, Batch NO: 2708000101 was injected subcutaneously with a dose of 0.5 ml per bird.

ND, H5 and H9 antigens were used for HA and HI tests, Batch NO: 210804 − 21208 and RD200101AgB1 respectively, were purchased by Me Vac Middle East for Veterinary Vaccines Egypt.

Birds.

Specific pathogen-free (SPF) chicks were purchased from the SPF egg project, Nile SPF Kom Oshim, EL-Fayoum Province, Egypt, Agricultural Research Center, Ministry of Agriculture and Land Lacrimation. Birds were housed in chicken isolators at Animal Health Research Institute, Dokki, Giza. Different groups of chicks were housed in chicken isolators of comparable size, the same light regime, and management. They received commercial layer feed from the same batch, and water and feed were provided ad libitum.

Experimental design.

One hundred SPF chicks were divided into 4 groups (25 chick/group) into 4 separate chicken isolators at Animal Health Research Institute, Dokki, Giza: group 1 was a control negative (non-vaccinated and non-challenged), group 2 was challenged with H9N2 at 12th days old (control challenged), group 3 was vaccinated with IBD vaccine at 17th days (control vaccinated) and group 4 was challenged with H9N2 at 12th days then vaccinated with IBD vaccine at 17th days old. Groups 2 and 4 were challenged with 10⁶ EID50 of H9N2 isolate / 100 µl per chick by intra-ocular and intra-nasal route [19]. Groups 3 and 4 were vaccinated with the intermediate plus IBD (228E) vaccine according to manufacturer instructions via the intraocular route. All groups were vaccinated with the inactivated H5N1 avian influenza + N.D. vaccine at 7th days old.

Blood samples were collected weekly from 5 chicks/group and the sera were separated and preserved at -20°C for measurement of antibodies titers against IBDV via ELISA and against ND, H5 and H9 by HI assay. Five cloacal swabs/group were collected at the 4th and 8th days post-vaccination (DPV) (21st, 25th days old) for quantification of IBD vaccinal virus via real-time PCR. Five chicks/group were randomly selected, weighted and euthanized at 17th, 21st and 25th days old for calculation of immune organs indices (bursa-thymus and spleen) according to the formula: (immune organ weight x 100) / body weight [20].

Pathology.

The collected bursae and kidneys of the different groups were preserved and fixed in 10% buffered formalin for 24 hours. The specimens for histopathology were dehydrated in several grades of alcohol, embedded in paraffin, and sectioned at 4 microns thickness, then stained by H&E stain according to [21].

The bursal lesion score was performed microscopically according to [22] and graded from 0–4; score 0 represents no changes, score 1 represents 1–25% of lymphoid follicles affected, 2 represents 26–50% of lymphoid follicles affected, 3 represents 51–75% of lymphoid follicles affected and 4 represents 76–100% of lymphoid follicles affected. And the kidneys lesion was scored according to [23, 24] as follows: 0 represents no changes, 1 represents few inflammatory cells infiltration in the interstitial tissue, 2 represents inflammatory cells infiltration and focal degeneration in renal tubules, 3 represents inflammatory cells together with foci of necrobiotic changes in renal tubular epithelium and/or glomerulopathy and 4 represents inflammatory cells, necrobiotic changes of the medullary epithelium and renal glomerulopathy.

Quantification of IBD vaccinal virus by real-time polymerase chain reaction.

Total viral RNA was extracted from cloacal swabs using QIAampViral RNA Mini Kit (QIAGEN) catalogue No. 52904 according to the manufacturer’s instructions by Stratagene MX3005P Real-Time PCR machine (Stratagene, USA). The fluorescently labelled probe sequence was (FAM) TCCCCTGAAGATTGCAGGAGCATTTG (TAMRA). Specific primers that flank the probe sequence was (5’- GAGGTGGCCGACCTCAACT-3’) for the forward primer and (5’- AGCCCGGATTATGTCTTTGAAG-3’) for the reverse primer of IBDV [25]. The reverse transcriptase polymerase chain reaction (RT-PCR) and real-time PCR reactions were performed in one step. The following conditions were used: 30 minutes of reverse transcription at 50°C for 5 min. for primary denaturation at 95°C and 40 repeated cycles of 20 seconds of initial denaturation at 95°C followed by 1 min. of annealing at 59°C, and 10 seconds of extension at 72°C.

Serology.

ELISA was used to measure IBDV antibodies' titer according to the protocol of the BioChek IBD kit (CK113 IBD, Gouda, Netherlands).

A hemagglutination inhibition (HI) test was performed according to standard procedures [26] using 1% washed chicken red blood cells and 4 HA units for ND and AI antigens. Titers were recorded as reciprocal values of the highest dilution, which showed complete HI.

Statistical analysis.

SPSS software (version 25.0; SPSS Inc., Chicago, IL, USA) was used for statistical analysis. The significance between the mean values was set at P < 0.05. Differences among groups in immune organs indices, scores of the bursa and renal lesions, IBDV shedding and antibody titers to IBD, ND and H5 vaccines beside H9N2 infection in different times were analyzed via using Analysis of variance (ANOVA) according to [27].

Immune organs indices.

Considering the bursal index, groups 2, 3 & 4 recorded a significant reduction (P < 0.05) in the bursal index in comparison with group 1 (the control -ve group) at both 21st and 25th days old scarifications (4th and 8th DPV). Group 4 showed a significant decrease in the bursal index when compared with groups 2 and 3 at 21st days old scarification (4th DPV). However, the effect of the IBD vaccine was nearly like the dual treatment effect at 25th days old (8th DPV) so, group 4 recorded a non-significant change in the bursal index when compared with group 3 at 8th DPV Fig. 1(a).

Both groups 3 and 4 recorded a significant increase in the splenic index when compared with group 1 at 21st days old with a non-significant change in comparison with each other and there was no significant change between the different groups at 25th days old Fig. 1(b). The thymus body weight ratio of all the treated groups showed a significant reduction when compared with group 1 at 21st -day scarification while there was no significant change among groups 2, 3 and 4 and also no significant change was recorded at 25th days old Fig. 1(c).

Histopathological changes.

Regarding the microscopic changes of the bursa of Fabricius as shown in Fig. (2); At 17th days old scarification, groups 1 and 3 revealed a normal histological structure characterized by typical covering folds or plica and numerous lymphoid follicles separated by thin bands of fibrous connective tissue. Meanwhile, examination of groups 2 and 4 revealed mild histopathological alterations characterized by mild expansion of subepithelial and interfollicular connective tissue with edema and congested blood vessels and fewer inflammatory cell infiltration. Several examined sections showed apparently normal bursal structures without any detectable abnormalities. At 21st days old, group 1 revealed normal histological structure. Variable-sized lymphoid follicles were detected in group 2 accompanied by atrophy of some follicles; however, lymphocytic depletion was less commonly observed. Interfollicular oedema and inflammatory cells infiltration were limited to fewer affected foci. Regarding group 3, depletion of lymphoid follicles was detected in several examined sections associated with missing lymphocytes in both the cortex and medulla. A Cystic space containing proteinaceous fluid was observed within the damaged lymphoid follicle that is characterized by severely depleted lymphoid cells and contains nuclear debris, many macrophages, and some heterophils. Group 4 showed marked depletion of lymphocytes in the cortex and medulla of lymphoid follicles in all most examined sections with subsequent atrophied lymphoid follicles and expansion of interfollicular connective tissue with oedema and fewer inflammatory cells infiltration. On the 25th day, group 1 revealed normal histological structure. Group 2 showed apparently normal bursal structure in several examined sections with intact lymphoid follicles containing numerous lymphocytes in the cortex and medulla. Few sections showed mild plica folding with limited subepithelial fibroplasia. The bursae of group 3 showed marked depletion of lymphoid follicles in several individuals associated with plica collapse and marked increase of infolding epithelium with an accumulation of mucous exudates was noticed in the lumen of examined bursae. Group 4 showed severe histopathological alterations that were characterized by expansion of the interfollicular connective tissue with edema and congested blood vessels and numerous inflammatory cells infiltration. The plica displayed increased folding associated with marked atrophy of the lymphoid follicles. The severely atrophied lymphoid follicles disappeared and were replaced by ductal structures separated by fibrous connective tissue and lined by epithelium like the epithelium on the mucosa surface of the plica. The bursal lymphoid follicles showed serious lymphocytolysis and necrosis with many vacuolated macrophages containing phagocytic debris.

The histopathological changes of the kidneys at 17th days old as shown in Fig. (3) revealed that groups 1 and 3 showed normal histological structure of cortical areas composed of closely packed nephrons and medullary cones (medullary tracts) containing collecting tubules, looped tubules of the mammalian nephrons, ureteral branches, and a network of blood capillaries in interstitial connective tissue whereas groups 2 and 4 showed multifocal areas of interstitial nephritis that characterized aggregation of mononuclear inflammatory cells in the intertubular tissue in both renal cortex and medulla. A Few cases showed interstitial hemorrhages that effaced the renal parenchyma. On the 21st day of age scarification, the examination of group 1 revealed the normal histological structure of kidney parenchyma. Meanwhile, the examination of groups 2 and 4 showed a nearly similar picture of apparently normal renal tissue without any detectable histopathological alterations. Multifocal areas of mononuclear inflammatory cells aggregation were detected in group 4 replacing the renal tubules. Examination of group 1 at 25th days old revealed a normal histological structure of the kidney parenchyma. Group 2 showed mesangioproliferative glomerulopathy characterized by proliferation of mesangial cells. Bowman's spaces were obliterated associated with mild proliferation of podocytes. Moderate medullary interstitial nephritis was also observed in some affected individuals. Some sections showed apparently normal renal parenchyma. Meanwhile, group 3 showed less aggregation of mononuclear inflammatory cells in the interstitial tissue in some circumstances. Multifocal extensive inflammatory foci were determined in the renal interstitial tissue of group 4 in several examined sections associated with degeneration of epithelium lining renal tubules with interstitial oedema in the medullary zones in some instances.

The histological lesion scores.

As shown in Fig. 4 (a); the bursal microscopical score of group 4 recorded a significant rise when compared with group 2 at the 21st and 25th days old and in comparison, with group 3 at all scarifications.

Regarding renal lesion score, group 4 was the only group to record a significant increase in the renal lesion score in comparison with group 1 and a significant rise when compared with groups 2 and 3 at 4th DPV. However, at 8th DPV, it recorded a significant increase when compared with groups 1 and 2 but a non-significant change in comparison with group 3. Figure 4 (b)

Quantification of IBD vaccine by real-time PCR.

Table (1) showed that the shedding of the IBD vaccine was dramatically affected with the pre-infection by H9N2 as group 4 recorded a significant increase in the number of CT (decrease in the IBDV shedding) (P ≤ 0.05) in comparison with group 3 (the control IBD vaccinated) at 4th and 8th DPV respectively.

Immune response to IBD live vaccine.

Results of ELISA demonstrated that the pre-challenge with H9N2 affected the immune response against the IBD vaccine resulting in immune suppression represented in a significant decrease in IBD ELISA titers in group 4 when compared to group 3 (the control IBD vaccinated) as shown in Fig. (5).

Immune response to ND + H5 inactivated vaccine.

Regarding ND and H5 HI results, the immunosuppressive effect of the H9N2 challenge and IBD vaccine was completely clearly represented in sub titers of antibodies as group 4 recorded a significant decrease in ND and H5 HI titers (P ≤ 0.05) in comparison with group 1 at 21st, 28th days old (14th and 21st DPV) and showed a significant decrease in comparison with group 2 and 3 at 14th and 21st DPV. Figure 6 (a&b).

Immune response to H9N2 challenge.

As shown in Fig. (7); groups 2 and 4 recorded a significant reduction in H9 antibody titers in comparison with group 1 at 7th − 14th -21st days post challenge (DPC). Comparing groups 2 and 4 with each other demonstrated a significant decline in group 4 at the 14th and 21st DPC.

Most of the IBD live vaccines are immunosuppressive due to different degrees of the bursal lesion and lymphoid depletion despite their protection [1, 3]. As well, the low pathogenic avian influence of H9N2 is considered one of the immunosuppressive viruses [28]. This is because of the degenerative effect on the primary immune organs [18, 29]. So, we focused on the evaluation of the H9N2 impact on the patho-immunological response of the IBD vaccine and the impact of the interaction between them on the response to the IBD vaccine and the other vaccines.

Regarding the effect of this interaction on immune organs indices, each of the H9N2 infection and IBD vaccine had a clear bursal atrophy effect which in turn reflected on its relative weight and consequently, the dual treatment was stronger than each one separately. As birds receive the IBD vaccine only in group 3 showed a significant reduction (P < 0.05) in the bursal index in comparison with non-vaccinated non-challenged birds in group 1 at both the 21st and 25th days old scarifications (4th and 8th DPV). The effect of this vaccine came in accordance with the results of previous studies which recorded a significant decrease in the bursal index in the 228E vaccinated group in comparison with the control -ve one [30, 31]. Dislike, the GM-97 IBD vaccinal strain resulted in a non-significant change in the bursal relative weight of the vaccinated broilers when compared with the non-vaccinated group [6]. This may be related to the species' susceptibility as the severity of the IBDV is more in SPF chicks (light breed) than in broilers (heavy breeds) [32]. Also, birds challenged with H9N2 in group 2 showed a significant reduction (P < 0.05) in the bursal index in comparison with non-vaccinated non-challenged birds in group 1 at the 4th and 8th DPV. The results of this study came in accordance with a previous study which demonstrated that the H9N2 challenge resulted in a significant decline in the bursal index when compared with the non-challenged group [18]. Also dented immune organs in the wake of the H9N2 challenge were proven [33]. Interestingly birds that received the IBD vaccine after the H9N2 challenge in group 4 suffered from significant bursal atrophy represented in a significant reduction (P < 0.05) in the bursal index in comparison with birds that received the H9N2 challenge or IBD vaccine alone. This finding suggested that pre-infection with H9N2 may enhance the bursal atrophy of the IBD vaccine, potentially by amplifying the tissue damage as discussed later.

In addition to the decreased bursal index, this study demonstrated that the pre-challenge with H9N2 increased the degenerative changes produced by the IBD vaccine on the bursa because birds in group 4 recorded a significant rise in the bursal lesion score when compared with birds in group 3 (IBD vaccinated group) and also recorded a higher significance in its lesion than birds in group 3 when comparing these two groups with non-vaccinated non-challenged birds in group 1 at 4th and 8th DPV. This microscopically presented in marked lymphoid depletion in group 4, expansion of the interfollicular connective tissue with oedema. The severely atrophied lymphoid follicles disappeared and were replaced by ductal structures separated by fibrous connective tissue. This is supported by the findings proved the ability of both H9N2 infection and the IBD vaccine to multiply in B-cells of the bursa resulting in lymphoid degeneration [2, 30]. So, the entrance of the H9N2 infection before the IBD vaccine resulted in some degenerative changes due to its multiplication, and when the IBD vaccine also multiplied and made its effect, the significance of the lesion increased may be due to the cumulative effect of the two viruses. This is supported by our findings as the challenge with H9N2 on the bursae (group 2) revealed atrophy of some follicles though, the lymphocytic depletion was less commonly observed. Interfollicular oedema, inflammatory cells infiltration and mild plica folding with limited subepithelial fibroplasia were restricted in fewer affected foci. These results agreed with a previous study that recorded mild to moderate lymphoid depletion and atrophy, epithelial folding and corrugation, and several interfollicular oedema as well in commercial broiler infected with A / Chicken / Tehran / ZMT − 173/99 H9N2 isolate [34]. Meanwhile, marked and severe lymphoid depletion, follicular atrophy, and cystic follicles of the bursa of Fabricius were noted in broilers challenged with H9N2 [35]. Besides, the depletive effect of the IBD vaccine in group 3 was clear and represented in the depletion of lymphoid follicles with the accumulation of mucous exudates noticed in the lumen of examined bursae. A cystic space containing proteinaceous fluid was observed within the damaged lymphoid follicle as shown in Fig. (2) which is reflected in the bursal lesion score in this group. Similarly, a significant rise in the bursal lesion of the 228E was recorded in the vaccinated group in comparison with the control -ve [30]. In contrast, only mild to moderate lymphoid depletion was documented in the vaccinated group with minimal lesion scores in the bursa of vaccinated chickens compared to the IBDV-challenged group [6]. Normal follicles with or without mild to moderate lymphoid depletion, there was no follicular atrophy or cystic follicles formation were observed in the vaccinated broilers with the intermediate plus Winterfield 2512 g-61 Strain and consequently limited and minimal bursal lesion scores [7].

Despite the significant effect of the interaction on the bursal index, it has a non-noticeable effect on the spleen index as group 4 had a non-significant difference in the spleen index in comparison with group 3 however, it had a significant increase when compared with group 1. This is because of the obvious effect of the IBD vaccine alone on the spleen's index as group 3 recorded a significant increase in comparison with group 1 at 4th DPV. Likewise, a significant increase in the spleen index was recorded in groups vaccinated with D87, Gumbo-L and Bursine-2 vaccines in comparison with the control group at 5th DPV [36]. Also, the vaccinated groups with 228E, D78 and Bursa-vac strains showed a significant rise in the spleen relative weight [37]. Nevertheless, the H9N2 challenge failed to induce a significant change in the splenic index as group 2 showed a non-significant change in the spleen index. Dislike, the H9N2 challenge made degenerative changes in the spleen affecting its index in broiler chicks [18]. This difference may be attributed to the different used hosts because we used SPF chicks while he used broiler chicks. However, a significant decrease in the splenic relative weight was confirmed in control H9N2-challenged SPF chicks when compared with the control non-challenged group [38]. The variance may be due to different virus lineage (A⁄chicken⁄Korea⁄MS96⁄1996, H9N2), different doses as he used 10 ^7.5 median embryo infection dose /0.1ml and different climatic conditions.

The renal histopathological changes and lesion revealed that chicks in group 4 (dual-treated one) were the only ones to show renal changes of a significantly increased score when compared to the control group at 4th and 8th DPV. Chicks in group 3 showed a significant increase in the renal score only at the 8th DPV. The renal changes of IBDV may be prominent in birds that die or are in advanced stages of the disease as it can reach kidneys after the lymphoid replication via the second viremia [39, 40]. The pre-challenge with H9N2 may trigger and accelerate the appearance of renal interstitial nephritis and the degeneration of epithelium lining renal tubules with interstitial oedema in the medullary zones in the dual-treated group. This may be attributed to H9N2 infection which can enhance the spread of other virus strains to different tropisms (i.e., host specificity and tissue specificity). This is because it is an immunosuppressive virus which impairs the bird's ability to express an effective immune response, consequently allowing other viruses to infect the host and increasing the accessibility of these viruses to other tissues rather than their main tropism [41].

Considering the shedding of the IBD vaccine, the shedding of the IBD vaccine was dramatically affected by the pre-infection with H9N2 accordingly, group 3 (the control IBDV vaccinated) recorded a significant rise in the IBDV shedding (P ≤ 0.05) in 4th and 8th DPV respectively when compared with group 4. This can be attributed to the ability of H9N2 infection to induce apoptosis (type of cell death) of lymphocytes which leads to their destruction and dysfunction of them [18]. Furthermore, avian influenza causes an increase in the rate of Fas gene expression which leads to apoptosis [42]. The Fas receptor is a tumor necrosis factor receptor superfamily member 6, a death receptor (DR) which present on the cell surface and stimulates signals leading to apoptosis in the immune system [43]. So, the decrease of IBD vaccine shedding in group 4 in comparison with group 3 may be a result of decreased number of the normal B-lymphocytes where IBDV can multiply because the accessibility of H9N2 to these cells before the IBDV resulted in apoptosis and necrosis of them. Therefore, the live IBD vaccine loses a lot of its targeting B- cells.

Consequently, the H9N2 infection had a drastic effect on the immune response against the different vaccines either live or inactivated vaccines. Concerning the response to 228E live IBD vaccine, group 4 (H9N2 challenged + IBD vaccinated) recorded a significant decline in IBDV ELISA antibody titers when compared to group 3 (control IBD vaccinated), and this was actually supported by the previously mentioned findings of [42, 43]. It was suggested that H9N2 infection has an apoptotic effect on lymphocytes which makes them disable to do the main function of the antibodies production [18]. Also, the humoral response in case of H9N2 infection decreased due to the downregulation of IL-4, the IL-4 receptor (IL-4R) which has a major role in the stimulation of CD4 + helper T (Th) cells and the humoral response [44]. The LaSota vaccinated H9N2 challenged group showed lower ND antibody titers against LaSota vaccine in comparison with the only vaccinated one and the results were attributed that H9N2 may interfere and decrease the replication of NDV, so it was insufficient to stimulate the humoral immunity [35].

The immune response to the ND + H5 inactivated vaccine also negatively affected, ND and H5 HI antibody titers of the combined treated group (group 4) showing a significant decline in ND and H5 HI titers in comparison with groups 2 and 3 at the 21st and 28th days old and revealed the highest significant reduction in the titers when compared with group 1. This is supported and explained by the bursal lesion of group 4 which was significantly decreased in comparison with groups 2 and 3 (H9N2 challenged & IBD vaccinated, respectively). Besides, both H9N2 infection and the IBD vaccine are immunosuppressive [3, 18]. So, group 2 recorded a significant decrease in ND and H5 antibody titers in comparison with group 1, especially at the 21st and 28th days old (14 and 21st DPV). This is supported by previous findings that demonstrated lower ND antibody titers in H9N2 challenged group in comparison with the unchallenged one [18]. In addition, H9N2-infected chickens were associated with suboptimal levels of neutralizing antibodies and abnormal humoral response [44]. Also, IBD vaccinated group (3) showed a significant reduction in ND and H5 antibody titers when compared to group 1 at 21st and 28th days old (14th -21st DPV) due to the immunosuppressive effect of the IBD vaccine as a result of the depletive effect on bursal cells so they lose their main function of antibodies production. This is supported by findings of a previous study that determined that the intermediate plus IBD vaccines resulted in bursal damage and consequently low blood B cell concentrations so a significant decline in ND vaccine antibody titers [4]. However, the GM-97 IBD vaccine recorded a non-significant effect on ND vaccine response [6]. To sum up, the single treatment either by H9N2 challenge or IBD vaccine had immunosuppressive effects so, the rate of immunosuppression was the highest in group 4 due to the highest bursal damage so the B- cells fail to produce antibodies.

Concerning H9 infection antibody titers, group 4 recorded a significant decline when compared to group 2 at the 14th -21st DPC. So, we suggested that the dual depletive effect of H9N2 and IBD vaccine on the bursal cells resulted in this difference in the response to H9N2 infection. Our findings came in accordance with a study which proved that H9N2 challenged group recorded a significant increase in H9 antibody titers when compared to H9N2-LaSota vaccinated group and it suggested that the ND vaccine may interfere with the replication of the H9N2 so it was insufficient to stimulate the humoral response to the infection [35]. Dislike, low H9 HI antibody titers were recorded in H9N2 challenged group as only 20% of the challenged chicks were seropositive [44]. These findings were interpreted that the H9N2 virus resulted in dropping in the expression of IL-4, IL-4R, IL-17 and IL-21R in the macrophages infected with H9N2 [44]. These interleukins play a vital role in the stimulation of Th2 responses and differentiation of T and B which are responsible for antibodies production [45, 46].

To recap, according to the findings of this study; the pre-challenge with H9N2 amplified the patho-immunosuppressive effect of the intermediate plus IBD vaccine represented in a significant decline in the bursal index and microscopical lesion of the dual-treated birds when compared to IBD vaccinated birds while the H9N2 decreased IBD vaccine shedding due to increase the apoptotic B-cells induced by H9N2 multiplication and decrease the count of the normal B-cells where IBDV can multiply. And consequently, the pre-challenge with H9N2 led to a significant decrease in IBD vaccine immune response. Furthermore, there were sub-titers of ND and H5 in the dual-treated birds and a significant decrease in comparison with IBD vaccinated birds due to a higher significance rise in the bursal lesion score which in turn reflected on the humoral response and antibody titers production against the live IBD vaccine and the inactivated ND + H5 vaccine. So, the early diagnosis of H9N2 before IBD vaccination is a crucial issue.

Avian influenza.

B.F

Bursa of Fabricius.

DPC

Day post challenge.

DPV

Day post vaccination.

ELISA

Enzyme linked immunosorbent assay.

subtype of Avian influenza.

Hemagglutination inhibition test.

IBD

Infectious bursal disease.

interleukin.

New castle disease.

PCR

Polymerase chain reaction.

significance

SPF

specific pathogen free.

Acknowledgements.

The authors wish to thank the Isolators department at Animal Health Research Institute, Dokki, Giza, for their kind effective help during the period of the experiment.

Funding.

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Author Contributions.

The authors confirm their contribution to the paper as follows: study conception and design: N. W. Khalil, M. A. Elshorbagy, E. M. Elboraay and A. M. Helal.; data collection: N. W. Khalil; analysis and interpretation of results: N. W. Khalil; draft manuscript preparation: N. W. Khalil. Review the results and approved the final version of the manuscript N. W. Khalil, E. M. Elboraay, and A. M. Helal.

Disclaimer.

This document is provided for scientific purposes only. Any reference to a brand or trademark herein is for informational purposes only and is not intended for commercial purposes or to dilute the rights of the respective owner(s) of the brand(s) or trademark(s).

Statements & Declarations.

Ethics Declarations.

-We confirm that this study was approved by the Research Ethics Board, Faculty of Veterinary Medicine, Benha University entered at the national level (No.: BUFVTM 01-10-21).

-We confirm that all procedures and methods in this study were carried out in accordance with relevant guidelines of Research Ethics Board, Faculty of Veterinary Medicine, Benha University entered at the national level (No.: BUFVTM 01-10-21).

-We confirm that all procedures and methods in this study were performed in agreement with the recommendations of the animal welfare committee after approval of the protocols.

Consent to participate.

Not applicable

Consent to publish.

Not applicable.

Competing Interests.

No conflict of interest was reported by the authors.

Ratcliffe MJH, Härtle S. B Cells, the Bursa of Fabricius and the Generation of Antibody Repertoires. Avian Immunology.Elsevier; 2014.pp. 65–89.
Teshome M, Fentahunand T, Admassu B. Infectious bursal disease (Gumboro disease) in chickens. Br J Poult Sci. 2015;4:22–8.
Rautenschlein S, Haase C. Differences in the immunopathogenesis of infectious bursal disease virus (IBDV) following in ovo and post-hatch vaccination of chickens. Vet Immunol Immunopathol. 2005;106:139–50.
Courtillon C, Allée C, Amelot M, Keita A, Bougeard S, Härtle S, et al. Blood B Cell Depletion Reflects Immunosuppression Induced by Live-Attenuated Infectious Bursal Disease Vaccines. Front Vet Sci. 2022;9:871–549.
Prandini F, Simon B, Jung A, Pöppel M, Lemiere S, Rautenschlein S. Comparison of infectious bursal disease live vaccines and a HVT-IBD vector vaccine and their effects on the immune system of commercial layer pullets. Avian Pathol. 2016;45:114–25.
Murmu R, Islam M, Juli M, Khan M, HarunurRashid S, Hossain F, et al. Pathogenicity and immunosuppresive properties of GM-97 strain of infectious bursal disease virus in commercial broiler chicken. J Adv Vet Anim Res. 2014;1:1.
Khan MAW, Islam MN, Harun-ur-Rashid S, Akter MR. Winterfield 2512 G-61 Strain of IBDV Vaccine (CEVAC® IBD L) Showed Reduced Pathogenicity in Commercial Chickens. Microbes Heal. 2013;1:58–61.
Peacock TP, James J, Sealy JE, Iqbal M. A Global Perspective on H9N2 Avian Influenza Virus. Viruses. 2019;11:620.
Homme PJ, Easterday BC. Avian Influenza Virus Infections. I. Characteristics of Influenza A/Turkey/Wisconsin/1966 Virus. Avian Dis. 1970;14:66.
Shortridge KF. Pandemic influenza: a zoonosis? Semin Respir Infect. 1992;7:11–25.
Chen BL, Zhang ZJ, Chen WB. Study on avian influenza I. Isolation and preliminary serological identification of avian influenza A virus in chickens. China J Vet Med. 1994;10:3–5.
Guan Y, Shortridge KF, Krauss S, Webster RG. Molecular characterization of H9N2 influenza viruses: Were they the donors of the “internal” genes of H5N1 viruses in Hong Kong? Proc Natl Acad Sci U S A. 1999;96:9363–7.
El-Zoghby EF, Arafa A-S, Hassan MK, Aly MM, Selim A, Kilany WH, et al. Isolation of H9N2 avian influenza virus from bobwhite quail (Colinus virginianus) in Egypt. Arch Virol. 2012;157:1167–72.
Alexander DJ. A review of avian influenza in different bird species. Vet Microbiol. 2000;74:3–13.
Abdel Hamid HS, Ellakany HF, Hussien HA, El-Bestawy AR, Abdel Baky KM. Pathogenicity of an Avian Influenza H9N2 Virus isolated From Broiler Chickens in Egypt. Alexandria J Vet Sci. 2016;51:90.
Arafat N, Abd El Rahman S, Naguib D, El-Shafei RA, Abdo W, Eladl AH. Co-infection of Salmonella enteritidis with H9N2 avian influenza virus in chickens. Avian Pathol. 2020;49:496–506.
Hadipour MM, Farjadian S. Histologic Lesions of Thymus and Bursa of Fabricius in Commercial Broiler Chickens Inoculated with H9N2 Avian Influenza Virus.Artic Int J Anim Vet Adv. 2011.
Qiang F, Youxiang D. The Effects of H9N2 Influenza A on the Immune System of Broiler Chickens in the Shandong Province. Transbound Emerg Dis. 2011;58:145–51.
El Miniawy HMF, Ahmed KA, El-Sanousi AA, Salah Khattab MM. Effect of aflatoxin induced immunosuppression on pathogenesis of H9N2 avian influenza virus. Pak Vet J. 2014;34:234–8.
Tanimura N, Tsukamoto K, Nakamura K, Narita M, Maeda M. Association between Pathogenicity of Infectious Bursal Disease Virus and Viral Antigen Distribution Detected by Immunohistochemistry. Avian Dis. 1995;39:9.
Bancroft JD, Gamble M. Theory and Practice of Histological Techniques. 6th Edition,. Churchill Livingstone, Elsevier, China. - References - Scientific Research Publishing (2008). https://www.scirp.org/(S(vtj3fa45qm1ean45vvffcz55))/reference/ReferencesPapers.aspx?ReferenceID=1582193. Accessed 9 Jan 2023.
Rauf A, Khatri M, Murgia MV, Jung K, Saif YM. Differential modulation of cytokine, chemokine and Toll like receptor expression in chickens infected with classical and variant infectious bursal disease virus. Vet Res. 2011;42:1–11.
Mohammed FF, Abdel reheem FA, El-deeb AH, Ahmed KA, Mousa MR. Characterization of Renal Inflammatory Cytokines and Related Nephropathy in Experimentally Infected Broiler Chickens with Velogenic Newcastle Disease Virus. J World’s Poult Res. 2020;10:109–17.
Xu A, Sun L, Tu K, Teng Q, Xue J, Zhang G. Experimental co-infection of variant infectious bursal disease virus and fowl adenovirus serotype 4 increases mortality and reduces immune response in chickens. Vet Res. 2021;52:61.
Moody A, Sellers S, Bumstead N. Measuring infectious bursal disease virus RNA in blood by multiplex real-time quantitative RT-PCR. J Virol Methods. 2000;85:55–64.
World Organization for Animal Health (OIE). World organization for animal health manual of diagnostic tests and vaccines (mammals, birds and bees) Seventh Edition. 2012.
Booth GD, Steel RGD, Torrie JH. Principles and Procedures of Statistics: A Biometrical Approach. J Am Stat Assoc. 1981;76:753.
Nguyen GT, Rauw F, Steensels M, Ingrao F, Bonfante F, Davidson I, et al. Study of the underlying mechanisms and consequences of pathogenicity differences between two in vitro selected G1-H9N2 clones originating from a single isolate. Vet Res. 2019;50:18.
Allawe AB. Study of effect of immunosuppresion caused by H9N2 in broiler. Iraqi J Vet Med. 2008;32:80–9.
Arafat N, Eladl AH, Mahgoub H, El-shafei RA. Effect of infectious bursal disease (IBD) vaccine on Salmonella Enteritidis infected chickens. Vaccine. 2017;35:3682–9.
Amer MM, El-Bayomi KM, Abdel-Ghany WA, Kotkat MA, Abdel -Gaied SS, Shakal MA. The efficacy of live infectious bursal disease vaccines in commercial 10 days old chicks. TH Sci Conf. 2007;5:23–33.
Silva MS e, Rissi DR, Swayne DE. Very Virulent Infectious Bursal Disease Virus Produces More-Severe Disease and Lesions in Specific-Pathogen-Free (SPF) Leghorns Than in SPF Broiler Chickens. Avian Dis. 2016;60:63–6.
Nguyen GT, Rauw F, Steensels M, Ingrao F, Bonfante F, Davidson I, et al. Study of the underlying mechanisms and consequences of pathogenicity differences between two in vitro selected G1-H9N2 clones originating from a single isolate. Vet Res. 2019;50:1–12.
Pazani J, Marandi MV, Ashrafihel J, Marjanmehr SH, Ghods F. Pathological Studies of A / Chicken / Tehran / ZMT – 173/99 (H9N2) Influenza Virus in Commercial Broiler Chickens of Iran. Int J Poult Sci. 2008;7:502–10.
Ellakany HF, Gado AR, Elbestawy AR, Abd El-Hamid HS, Hafez HM, Abd El-Hack ME, et al. Interaction between avian influenza subtype H9N2 and Newcastle disease virus vaccine strain (LaSota) in chickens. BMC Vet Res. 2018;14:358.
Hedayati BA. Comparison of Pathogenicity and Serologic Response of Four Commercial Infectious Bursal Disease Live Vaccines Short Communication. Arch Razi Ins. 2005;59:65–73.
Amer MM, El-Bayomi KM, Abdel-Ghany WA, Kotkat MA, Abdel –Gaied S, Shakal S. The efficacy of live infectious bursal disease vaccines in commercial 10 days old chicks. J Vet Med Res. 2008;18:23–33.
Seo BJ, Rather IA, Kumar VJR, Choi UH, Moon MR, Lim JH, et al. Evaluation of Leuconostoc mesenteroides YML003 as a probiotic against low-pathogenic avian influenza (H9N2) virus in chickens. J Appl Microbiol. 2012;113:163–71.
Swayne DE, Boulianne M, Logue CM, McDougald LR, Nair V, Suarez DL, Wit S, Grimes T, Johnson D, Kromm M, editors, editors. ; John Wiley & Sons, Inc.: Hoboken N, USA. Infectious Bursal Disease. Diseases of Poultry. 2019;14th ed.;257–283.
Dey S, Pathak D, Ramamurthy N, Maity HK, Chellappa MM. Infectious bursal disease virus in chickens: prevalence, impact, and management strategies. Vet Med Res Reports. 2019;10:85–97.
Horman WSJ, Nguyen THO, Kedzierska K, Bean AGD, Layton DS. The Drivers of Pathology in Zoonotic Avian Influenza: The Interplay Between Host and Pathogen. Front Immunol. 2018;9 AUG:1.
Takizawa T, Fukuda R, Miyawaki T, Ohashi K, Nakanishi Y. Activation of the Apoptotic Fas Antigen-Encoding Gene upon Influenza Virus Infection Involving Spontaneously Produced Beta-Interferon. Virology. 1995;209:288–96.
Nagata S. Apoptosis by Death Factor. Cell. 1997;88:355–65.
Xing Z, Cardona CJ, Li J, Dao N, Tran T, Andrada J. Modulation of the immune responses in chickens by low-pathogenicity avian influenza virus H9N2. J Gen Virol. 2008;89:1288–99.
Strengell M, Sareneva T, Foster D, Julkunen I, Matikainen S. IL-21 Up-Regulates the Expression of Genes Associated with Innate Immunity and Th1 Response. J Immunol. 2002;169:3600–5.
Strengell M, Matikainen S, Sirén J, Lehtonen A, Foster D, Julkunen I, et al. IL-21 in Synergy with IL-15 or IL-18 Enhances IFN-γ Production in Human NK and T Cells. J Immunol. 2003;170:5464–9.

Table (1): Cloacal shedding of IBD vaccinal virus in different groups (mean of CT ± st. error).

Groups	4^th DPV	8^th DPV
1	0±0.238^A	0±0.238^A
2	0±0.238^A	0±0.238^A
3	23.027±0.238^C	19.03±0.238^B
4	30.64±0.238^E	27.84±0.238^D

Values within the column which have different letters are significantly different (P ≤ 0.05) in the interaction between groups and time. G1: non-vaccinated and non-challenged group, G2: challenged and non-vaccinated group, G3: vaccinated and non-challenged group, G4: challenged and vaccinated group.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Impact of H9N2 Infection on the Pathological and Immunological Effects of the IBD Vaccine in Chicks: A Study of Vaccine Interaction and Immune Response

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Viruses and vaccines:

Statistical analysis.

Results

Discussion

Abbreviations

Declarations

References

Tables

Additional Declarations

Status:

Version 1