Expression of secretory calcium-binding phosphoprotein (scpp) genes in medaka during the formation and replacement of pharyngeal teeth

doi:10.21203/rs.3.rs-2596685/v1

Download PDF

Research Article

Expression of secretory calcium-binding phosphoprotein (scpp) genes in medaka during the formation and replacement of pharyngeal teeth

https://doi.org/10.21203/rs.3.rs-2596685/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 11 Oct, 2023

Read the published version in BMC Oral Health →

You are reading this latest preprint version

Background

Analyses of tooth families and tooth-forming units in medaka with regard to tooth replacement cycles and the localization of odontogenic stem cell niches in the pharyngeal dentition clearly indicate that continuous tooth replacement is maintained. The secretory calcium-binding phosphoprotein (SCPP) cluster is involved in the formation of mineralized tissues, such as dental and bone tissues, and the genes encoding multiple SCPPs are conserved in fish, amphibians, reptiles, and mammals. In the present study, we examined the expression patterns of several scpp genes in the pharyngeal teeth of medaka to elucidate their roles during tooth formation and replacement.

Methods

Himedaka (Japanese medaka, Oryzias latipes) of both sexes (body length: 28 to 33 mm) were used in this study. Real-time reverse transcription–polymerase chain reaction (PCR) (qPCR) data were evaluated using one-way analysis of variance for multi-group comparisons, and the significance of differences was determined by Tukey’s comparison test. The expression of scppgenes was examined using in situhybridization (ISH) with a digoxigenin-labeled, single-stranded antisense probe.

Results

qPCR results showed that several scpp genes were strongly expressed in pharyngeal tissues. ISH analysis revealed specific expression of scpp1, scpp5, and sparc in tooth germ, and scpp5 was continually expressed in the odontoblasts of functional teeth but not in osteoblast of pedicles. In addition, many scpp genes were expressed in enameloid cells but not in odontoblasts, and scpp2 consistently showed epithelial-specific expression in the functional teeth. Taken together, these data indicate that specific expression of scpp2 and scpp5 may play a critical role in pharyngeal tooth formation in medaka.

Conclusion

We characterized changes in the expression patterns of scpp genes in medaka during the formation and replacement of pharyngeal teeth.

scpp

medaka

pharyngeal teeth

in situ hybridization

Medaka (Oryzias latipes) is a small, egg-laying freshwater fish [1] that has a smaller genome size than zebrafish [2]. Medaka have oral and pharyngeal dentition, and adult fish have more than a thousand teeth [3]. The pharyngeal teeth of medaka exhibit a conical shape and are connected to the pharyngeal bone via a tooth-supporting bone called the pedicle or attachment bone [4, 5]. The functional teeth are attached to the pedicle either by ankylosis in the lower teeth or by fibrous connections in upper teeth [6]. A previous study identified tooth families and tooth-forming units in medaka and determined the tooth replacement cycles and the localization of odontogenic stem cell niches in the pharyngeal dentition, providing insights into these mechanisms and clearly indicating that continuous tooth replacement is maintained [4]. Furthermore, tooth replacement in medaka occurs due to the turnover of pedicles by osteoblasts and osteoclasts [5].

The secretory calcium-binding phosphoprotein (SCPP) cluster functions in mineralized tissues such as dental and bone tissues, and the genes encoding multiple SCPPs are reportedly conserved in fishes, amphibians, reptiles, and mammals [7–9]. SCPPs can be classified into two subclasses: acidic SCPPs and Pro/Gln (P/Q)-rich SCPPs [8]. Acidic SCPPs function in bone, dentin, and cementum formation, whereas P/Q-rich SCPPs are involved in enamel and enameloid formation [8–10]. SPP1 and odontogenic ameloblast-associated protein (ODAM), and their common ancestor, secreted protein, acidic, cysteine-rich like 1 (SPARCL1), are conserved in jawed vertebrates [11]. In fishes such as fugu and zebrafish, sparcl1 and other scpp genes (except for spp1) constitute the SPARCL1-SCPP gene cluster [11]. The SPARCL1-SCPP gene cluster of zebrafish and fugu is located on chromosome 1 and chromosome 17, respectively, whereas in medaka, it is also located on chromosome 1. Other members of the SCPP cluster are likely more specific between lineages, indicating that they arose with lineage-specific duplications and deletions, which possibly resulted in the specialization of certain scpp family genes in vertebrates [11, 12]. A recent study further showed that spotted gar has the largest known repertoire of scpp genes, which includes many genes previously unknown in teleosts [12]. In addition, that study confirmed that scpp6 and fa93e10 are teleost orthologues of ameloblastin (ambn) and enamelin (enam), respectively [12].

Previous studies characterized the expression patterns of scpp genes during the tooth germ stage of fugu [7] and zebrafish [8]. In the present study, we examined the expression patterns of several scpp genes in the pharyngeal teeth of medaka to elucidate their roles during tooth formation and replacement.

Medaka

Himedaka (Japanese medaka, Oryzias latipes) of both sexes (n = 22, body length: 28 to 33 mm) were used in this study. The fish were maintained in the laboratory at a water temperature of 23–25°C under a 14-h/10-h light/dark cycle. All animal experiments were performed in accordance with policies and protocols approved by the guidelines of the Animal Welfare Committee of Tokushima University. In addition, we confirmed that all methods are reported in accordance with ARRIVE guidelines 2.0 for the reporting of animal experiments.

Cloning of scpp genes in medaka

Genome Data Viewer (GDV) (https://www.ncbi.nlm.nih.gov/genome/gdv/) [13] and Ensembl Genome Browser (EGB) 105 (https://www.ensembl.org/index.html) were used to search gene sequence databases to identify gene orthologues and examine the expression of scpp genes in medaka (ASM223467v1). Genomic synteny analysis was also conducted using GDV and EGB105. Each scpp gene assembly number in medaka was referenced to GDV and EGB105, as listed in Table 1. For scpp4, scpp7, scpp9, and enam, similar sequences were identified in the medaka genome by performing genomic alignment with zebrafish (GRCz11) and fugu (fTakRub1.2) in EGB105. Those sequences were then searched using BLAST (blastin). Genomic locations of the scpp genes were extracted from publicly available annotations in EGB105. Specific primers were designed using Primer3Plus (https://primer3plus.com), and the primer sequences are listed in Table 1. Brain, liver, fin ray bone, and pharyngeal tissues (teeth and bone) were dissected from the medaka, and total RNA was extracted from each tissue using TRI REAGENT (Molecular Research Center Inc., Cincinnati, OH, USA). cDNAs were generated using a 1st Strand cDNA Synthesis kit for RT-PCR^→ (Roche, Basel, Switzerland).

Table 1. Specific primers for scpp genes and mineralized tissue-related genes used in qPCR and ISH analyses.

	Primer sequences (5' → 3')		Primer sequences (5' → 3')
Gene	qPCR	Size	ISH	Size
scpp1	F: GCCAGCAAGAGTTCAAAGGA	139bp	F: CAGACAACATCGTGAGACTTCTTC	396bp
	R: CATCTCCTACGCTCTGGACAA		R: GAAAACACCCTTACCCAACTCTG
scpp2	F: TGCCAGCAATAGCAATGAGA	148bp	F: CCTTCTGTTGATCTGCCTTTTC	340bp
	R: CTGGGGGTTTAGATTCAGCA		R: CTGAGGGATGTTGGGATTATTG
scpp5	F: CATGCCTCAGCAAACCATAAA	149bp	F: GTGTTTTGTTTCTGAGGGGACA	443bp
	R: GGCAGATAATGACGGAGGAG		R: GTTTGCTGAGGCATGTTTTGAG
sparc	F: TGAGGGACTGGCTGAAGAAC	150bp	F: AGCAGAAGCTCAGGGTAAAGAAG	352bp
	R: CCAACAGGTCCAAAGAGTGG		R: GTCAGAGGAGTTTAGATGACGAGA
spp1	F: CACTGACTTTCTGGAGGAGGA	84bp	F: AAGAAGACGAAGACGAAACCAC	252bp
	R: TGGTCTTGAGATACGCTGGA		R: AGGGAGAGGGAACTTTGTGATAG


col1a1	F: CAAGAACAGCGTTGCCTACA	95bp	F: TGAAGTGGTGTGTGAAGAAGTG	284bp
	R: CCTCGGCTCTGATCTCAATC		R: GCATAGCTGGAGATTTGTCATC
bglap	F: TGAAATGGCTGACACTGAGG	52bp	F: CTACTGCTTCTGCCTCATCATC	215bp
	R: TCCGTAGTAGGCGGTGTATG		R: AGTGTCAGCCATTTCATCACAG
runx2	F: GGAAAGGATGCGAGTGAGAG	105bp	F: GCACACCCTATCTCTACTACGG	265bp
	R: TCTGTGATCTGCGTCTGACC		R: CTCCACCCACTTTTCCTCTAA
sp7	F: GCTCACGGTTTAAGGAGGTG	73bp	F: CGCATCTATTCTGGAGGTAGGAAG	351bp
	R: AATCAGGGATGGAGGGAAAC		R: GAGTGGGAGAAGGGGTTATATTCTG
β-actin	F: GCCAACAGGGAGAAGATGAC	133bp
	R: CATCACCAGAGTCCATGACG

Real-time reverse transcription-polymerase chain reaction (PCR) (qPCR)

qPCR was performed using PowerUp™ SYBR^→ Green Master Mix (Applied Biosystems™, Thermo Fisher Scientific k.k., Tokyo, Japan) and a MyGo mini system (IT-IS Life Science Ltd., Dublin, Ireland). The qPCR conditions for amplification were as follows: initial denaturation at 95°C for 120 s, followed by 40 cycles of 10 s at 95°C and 30 s at 60°C. The length of each amplicon was approximately 50–150 bps, and the confirmed efficacy of each specific primer pair was 2.0. Gene expression levels were normalized to those of β-actin. Three different samples were analyzed, and reactions were repeated three times. Relative mRNA expression levels were calculated using the ΔΔCt method. All data were calculated as the mean ± standard deviation (SD). Data were analyzed using one-way analysis of variance for multi-group comparisons, and the significance was determined by Tukey’s comparison test using SPSS Statistics software (version 24, IBM Inc., Chicago, IL, USA). A p-value of < 0.05 or < 0.01 was considered statistically significant.

Histological Analysis

The heads of medaka were fixed in a 4% paraformaldehyde solution (0.1 M phosphate buffer, pH 7.4) at 4°C overnight, decalcified in 8% ethylenediaminetetraacetic acid (EDTA) solution at 4°C for 3 days, then embedded in paraffin according to conventional methods. The prepared paraffin blocks were cut into sagittal and horizontal sections at a thickness of 5 µm.

Pharyngeal tissues of medaka were fixed in 4% paraformaldehyde solution (0.1 M phosphate buffer, pH 7.4) at 4°C overnight, and then the samples were embedded in Technovit 8100 (Heraeus Kulzer, Wehrheim, Germany) with a coagulant (Heraeus Kulzer). The resin blocks were cut into horizontal sections at a thickness of 1 µm. Toluidine blue staining and tartrate-resistant acid phosphatase (TRAP) reaction were performed to identify osteoclasts [3].

In situ hybridization (ISH)

ISH was performed as previously described [14]. Briefly, template cDNAs for mRNA probes were generated using gene-specific primer sets encoding T3 or T7 RNA polymerase promoter sequences. The primer sequences are listed in Table 1. The RT-PCR products for ISH were generated using Ampdirect^→ Plus (Shimazu, Japan) with a Mastercycler^Ⓡ nexus gradient (Eppendorf, Japan). The PCR conditions were as follows: initial denaturation at 94°C for 120 s, followed by 35 cycles of 30 s at 94°C, 30 s at 60°C, and 60 s at 72°C. Digoxigenin (DIG)-labeled, single-stranded antisense and sense strands were then generated from the PCR products using a DIG RNA Labeling kit^Ⓡ (Roche). After de-waxing, histological sections were treated in the following solutions: Proteinase K (1.0 µg/ml, Sigma) in 10 mM Tris-HCl buffer (pH 8.0) containing 1.0 mM EDTA at 37°C for 10 min; 0.2 M HCl at 25°C for 10 min; and 0.1 M triethanolamine containing 0.5% acetic anhydride at 25°C for 15 min for acetylation. Hybridization was performed by incubating the samples with diluted RNA probes (1.0 µg/ml) at 50–60°C overnight. The sections were washed according to conventional protocols. Samples were visualized using an anti-DIG antibody as follows: sections were incubated with 1.5% blocking buffer at 25°C for 1 h and then incubated with alkaline phosphatase–labeled anti-DIG antibody (Roche) at 25°C for 2 h. Finally, the sections were reacted with BCIP/NBT (Roche) solutions and developed at 25°C overnight. The sections were counterstained with methyl green.

Synteny analysis of scpp in medaka

GDV was used to search for orthologues of medaka scpp1, scpp2, scpp5, and sparc in zebrafish (GRCz11) and fugu (fTakRub1.2). For scpp4, scpp7, scpp9, and enam, similar sequences were identified in the medaka genome by performing genomic alignment with zebrafish and fugu in EGB105. Those sequences were then searched using BLAST (blastin). Genomic locations of the scpp genes were extracted from publicly available annotations in EGB105. The location and transcriptional orientation of the scpp genes are schematically illustrated in Fig. 1. Of the various scpp genes, no expression of scpp3 or ambn orthologues was observed in the present study. However, a genomic alignment analysis indicated that fugu scpp3a and scpp3b are similar to a non-coding RNA in medaka. Fugu scpp3a was similar to uncharacterized LOC101161295 ncRNA or uncharacterized LOC110015140 ncRNA, whereas fugu scpp3b was similar to uncharacterized LOC101160534 ncRNA or uncharacterized LOC101161034 ncRNA. As these are non-coding RNAs, they were not considered in the present study. Fugu scpp3c did not show sequence similarity to that gene in medaka.

Expression levels of scpp and mineralized tissue-related genes in medaka

The expression levels of transcripts for scpp1, scpp9, sparc, and spp1 were analyzed in the pharyngeal tissues, fin ray bone, brain, and liver (Fig. 2a). The expression levels of these genes were significantly higher in the pharyngeal tissues than in other tissues (Fig. 2a). Transcripts for scpp2 were detected only in the pharyngeal tissues (Fig. 2c). Transcripts for scpp4, scpp5, and enam were detected in mineralized tissues but not soft tissues, and the expression levels of scpp4 and scpp5 transcripts were significantly higher in pharyngeal tissues than in fin ray bone (Fig. 2a). However, enam expression levels did not differ significantly between the mineralized tissues, such as bone and teeth (Fig. 2a). Transcripts for scpp7 were detected in each tissue, and the expression levels were significantly higher in fin ray bone than in other tissues (Fig. 2a). Levels of transcripts for collagen 1a1 (col1a1) and bone gla protein (bglap) were higher in mineralized tissues than in other tissues (Fig. 2b). The levels of transcripts for runt-related transcription factor 2 (runx2) were higher in mineralized tissues than in soft tissues (Fig. 2b). Transcripts for sp7 were detected only in mineralized tissues, and no significant difference in expression level was found between the pharyngeal tissues and fin ray bone (Fig. 2b). In addition, there was no significant difference between the expression levels of transcripts for runx2 and sp7 in the tissues examined.

Expression patterns of scpp and mineralized tissue-related genes during tooth germ stages

In the enameloid organ of the tooth germ, the inner dental epithelium (ide) and outer dental epithelium (ode) are clearly distinguishable (Fig. 3a, b). Cap enameloid (acrodin) was observed as a dotted yellow area after decalcification (Fig. 3a, b). Dentin and mesenchymal cells, including odontoblasts, were observed within the enameloid organs (Fig. 3a, b). Transcripts for scpp1 were detected in odontoblasts but not in the ide and dental papilla (Fig. 4a). Transcripts for scpp2, scpp4, scpp9, and enam were detected only in the ide adjacent to enameloid but not in ide adjacent to the cervical loop (Fig. 4b, c, f, and g). Transcripts for scpp5 and sparc were detected in both the ide adjacent to the cervical loop and odontoblasts during dentin formation, but no transcripts were detected in either the ode or dental papilla (Fig. 4d). Transcripts for scpp7 were weakly detected in the ide adjacent to enameloid (Fig. 4e). No spp1 or bglap transcripts were detected in the tooth germ (Fig. 4i, k). Transcripts for col1a1 were weakly detected in the ide adjacent to enameloid and strongly expressed in odontoblasts (Fig. 4j). Transcripts for runx2 were detected in the ide adjacent to enameloid but not in ide adjacent to the cervical loop or dental papilla (Fig. 4l). Transcripts for sp7 were weakly detected in the ide adjacent to enameloid and dental papilla but not in odontoblasts (Fig. 4m).

Expression patterns of scpp and mineralized tissue-related genes in functional teeth

Erupted functional teeth were connected to pedicles by collagenous fibers (Fig. 3c, d). In horizontal sections at the height of the pedicles under the erupted teeth, two pedicles and two tooth germs were usually observed in a row (Fig. 3e, f, and g). In this study, we classified these structures as the first pedicle, second pedicle, third tooth germ, and fourth tooth germ based on their developmental stages (Fig. 3g). Numerous TRAP-positive cells were observed in the anterior side of the first pedicles but not in the second pedicles (Fig. 3h). No scpp1, scpp4, scpp7, or scpp9 transcripts were detected in the pharyngeal teeth or pedicles (Fig. 5a, c, e, and f). Transcripts for scpp2 were detected in the epithelial cells adjacent to the surface of the tooth shaft (Fig. 5b). Transcripts for scpp5 were detected within the odontoblasts above the border between the teeth and pedicles but not in the mesenchymal cells around the pedicles (Fig. 5d). Transcripts for enam were detected in the mesenchymal cells of pedicles but not in odontoblasts of the pharyngeal teeth (Fig. 5g). In horizontal sections, enam was more strongly expressed in the mesenchymal cells of the second pedicles than in those of the first pedicles (Fig. 6g). Transcripts for sparc were detected in the odontoblasts and mesenchymal cells of pedicles (Fig. 5h). Sparc was not detected in the mesenchymal cells around the first pedicles; however, it was expressed in mesenchymal cells around the second pedicles (Fig. 6h). Transcripts for spp1 were weakly detected in the pulp area of the pharyngeal teeth near the pedicles and in the surrounding mesenchymal cells of the pedicles (Figs. 5i, 6i). Transcripts for col1a1 were detected in the mesenchymal cells located in posterior side of the pedicles but not in cells within the pedicles or pharyngeal teeth (Fig. 5j). In horizontal sections, col1a1 transcripts were detected in mesenchymal cells on the posterior side of the second pedicles but not in the first pedicles (Figs. 3g, 6j). No bglap transcripts were detected in the pharyngeal teeth and pedicles, but transcripts were detected in osteoblasts of pharyngeal bone (Fig. 5k). Transcripts for runx2 were detected in mesenchymal cells of the pedicles and weakly detected in the cells surrounding the pedicles, but they were not detected in pharyngeal teeth (Figs. 5l, 6k). Transcripts for sp7 were detected in the cells on the posterior side of the second pedicles but not in the mesenchymal cells of the pharyngeal teeth and pedicles (Figs. 5m, 6l).

To investigate the genetic basis of the formation of tooth and periodontal tissues in medaka, we examined the expression of several scpp genes encoded in the medaka genome. The present study is the first to describe the expression patterns of scpp genes during pharyngeal teeth formation and replacement in medaka.

The role of scpp genes in dentin formation

The expression levels of scpp1 and scpp5 in medaka were higher in pharyngeal tissues (Fig. 2a). Expression of scpp1 was detected only in odontoblasts in tooth germ, and scpp5 was expressed in both ide and odontoblasts in tooth germ (Fig. 4a, d). These tooth germ expression patterns are similar to those of fugu, zebrafish, and cichlids [7, 8, 15]. Interestingly, expression of scpp5 was detected only in odontoblasts of functional teeth, and no other scpp gene was expressed in these cells (Fig. 5d). In addition, seahorses and pipefish (family Syngnathidae) are toothless, a phenomenon known as edentulism, and in seahorses, scpp5 is a pseudogene [18]. Furthermore, the pharyngeal teeth in scpp5-deficient zebrafish exhibit a distinct phenotype characterized by fewer functional teeth [19]. In addition, the expression patterns of scpp1 and scpp5 were similar to those of dentin sialo phosphoprotein (Dspp) genes in rats and mice [16, 17]. Although the genomic position of scpp1 in zebrafish is similar to that of Dspp and dentin matrix protein 1 (Dmp1), the amino acid sequence of scpp1 differs from that of Dspp and Dmp1 [8]. Furthermore, no Dspp or Dmp1 orthologues have been found in fish [8]. These results suggest that both scpp1 and scpp5 in medaka play a critical role in dentin formation.

The role of scpp genes in enameloid formation

Among the scpp genes of medaka, the expression of scpp2, -4, -5, -7, -9, enam, and sparc was detected in the ide (Fig. 4b, c, d, e, f, and Fig. 7). These expression patterns were consistent with those in fugu and zebrafish [7, 8]. Kawasaki et al. reported that scpp2, -4, -5, and − 9 play important roles during enameloid formation in fish [7, 8, 20]. The genes scpp4, -5, -7, and − 9 are fish specific. The scpp2 gene encodes ODAM and is an orthologue of a gene found in mice. In mice, ODAM is expressed in the inner enamel epithelium and junctional epithelium [21, 22] and modulates the mineralization of enamel via the regulation of matrix metalloproteinase–20 in cooperation with Runx2 [23]. The above results suggest that the expression of scpp genes is also involved in the formation of highly mineralized tissues such as cap enameloid (acrodin).

In fish, enameloid is usually found at the tooth cap, and it is called cap enameloid (acrodin) [24]. Moreover, in Polypterus senegalus, collar enamel forms at the surface of the tooth shaft [24], while only cap enameloid (acrodin) is observed in medaka. Kawasaki et al. reported that scpp2 and scpp9 are involved in the hyper-mineralization of collar enameloid in addition to cap enameloid (acrodin) [8]. A recent study reported that scpp5, ameloblastin, and enam are expressed in the ide cells adjacent to the surface of the tooth shaft in gar and zebrafish [20]. Interestingly, in the present study of medaka, no expression of scpp5, scpp9, or enam was detected in the cells adjacent to the surface of the tooth shaft, whereas scpp2 was only detected in those cells (Figs. 4b and 7). Thus, the expression of scpp2 in medaka appears to be related to another role for ODAM in mediating active adhesion mechanisms at the junctional epithelium [25]. These data suggest that expression of scpp2 adjacent to the surface of the tooth shaft in medaka contributes to active adhesion to the epithelial tissue adjacent to the tooth shaft rather than playing a role in hyper-mineralization.

Other scpp genes

In channel catfish, scpp7 is highly expressed in the skin [26]. In the present study, total RNA was extracted from fin ray bone without peeling the epithelium, and analyses revealed that scpp7 was strongly expressed in fin ray bone (Fig. 2a). In ISH, transcripts for scpp7 were detected in the epithelial cells adjacent to the fin ray bone (Additional file 1). In addition, scpp5, scpp7, spp1, and sparc are expressed over time during scale regeneration in zebrafish [27]. These results suggest that scpp7 expression during skin and scale formation and regeneration might be critical.

Spp1 encodes osteopontin, a sialic acid–rich, phosphorylated, integrin-binding extracellular matrix glycoprotein that enhances osteoclast activity [28, 29]. The inhibitory effect of osteopontin on calcification depends on the degree of phosphorylation of serine [28]. In medaka, pharyngeal teeth replacement is accompanied by the remodeling of pedicles, which occurs under the first functional teeth [5]. Such dynamic tooth replacement is associated with the dynamic resorption of pedicles by the large population of TRAP-positive osteoclasts [6]. Bone matrix–resorbing osteoclasts are anchored by osteopontin bound both to the mineral of the bone matrix and to a vitronectin receptor on the osteoclast plasma membrane [30]. In addition, osteopontin is involved in cell attachment during cementogenesis in mice [10]. In the present study, strong spp1 expression was detected in mesenchymal cells on the anterior side of pedicles (Fig. 5i). TRAP-positive cells were also observed in the anterior side of the first pedicles (Fig. 2h). In contrast, spp1 expression was detected in mesenchymal cells on the posterior side of pedicles (Fig. 5i). These results suggest that the expression pattern of spp1 reflects the process of tooth replacement.

Sparc, also known as osteonectin or basement membrane protein 40, is one of the most abundant collagenous proteins in bone [31]. Sparc is expressed in both mineralized and non-mineralized tissues [31]. Osteonectin-null mice exhibit decreased bone remodeling with a negative balance, which causes profound osteopenia [32]. In the present study, the expression pattern of sparc in the tooth germ was similar to that in fugu, zebrafish, and cichlids [7, 8, 33]. In catsharks, sparc is expressed in odontoblasts, and in thornback rays, it is weakly expressed in the mesenchyme cells of tooth buds [34]. These results suggest that homologous gene expression occurs during tooth development in teleosts and chondrichthyans. In the functional teeth of medaka, sparc was continuously expressed in the mesenchymal cells during formation of the pharyngeal teeth and pedicles (Fig. 4h). The expression pattern of sparc during pharyngeal teeth formation in this study was consistent with that in mice, suggesting that sparc has a similar function in teleosts and mammals.

The expression patterns of mineralized tissue-related genes change during the tooth replacement process

Our previous study indicated that individual functional teeth and their successional teeth are organized into families [4]. The pharyngeal teeth of medaka are replaced with the next group of teeth within 4 weeks [4]. Tooth replacement in medaka involves pedicle remodeling by osteoblasts and osteoclasts [5]. In the present study, sparc and col1a1, which are osteoblast markers, were expressed in the posterior side of the first pedicles but not in the anterior side (Fig. 6h, j), and sp7 expression was observed in the posterior side of the second pedicles (Fig. 6l). In addition, enam was expressed in the second pedicle during the process of bone formation, but no enam expression was observed in the already-formed first pedicles (Figs. 5g, 6g). These expression patterns suggest that ameloblastin and enam indirectly regulate osteoclasts in a negative manner [35]. In contrast, numerous TRAP-positive cells and spp1 expression were detected in the anterior side of the first pedicles (Fig. 3h). Considered collectively, these expression patterns are consistent with the cell dynamics of pedicle remodeling during tooth replacement.

Is the pedicle a bone-like tissue or a tooth-like tissue?

Two major points must be considered to answer this question. One is that scpp genes are specifically expressed in the cells that form dentin and pedicles. In this study, the expression of only scpp1 and scpp5 was detected in odontoblasts. Scpp5 transcripts were expressed in odontoblasts during the stages from tooth germ formation to the formation of functional teeth. Previous studies have shown that scpp5 exhibits a similar expression pattern in fugu, zebrafish, and gar [7, 8, 20]. A recent study reported that the pharyngeal teeth in scpp5-deficient zebrafish exhibit a distinct phenotype, particularly a decreased number of functional teeth [19]. Thus, scpp5 plays a role in dentin formation in fish. In the present study, scpp1 and scpp5 were not expressed in the pedicles, whereas spp1, enam, runx2, and sp7 were expressed in the pedicles. Interestingly, many of these factors cause morphological abnormalities in the tooth roots of mammals. For example, in mice, Spp1 is expressed strongly by osteoblasts in alveolar bone but rarely expressed in odontoblasts [36]. In enam-deficient mice, excessive absorption of dentin and cementum of the tooth root was observed [37]. In runx2-overexpressing mice, the tooth roots form osteodentin-like structures [38]. In addition, the jaw teeth of sp7-mutant medaka and zebrafish fail to form pedicles [39, 40]. A micro-computed tomography analysis revealed that Osterix conditional knock-out mice have short roots and a thin dentin matrix [41]. These expression patterns parallel those of medaka (Figs. 5, 6, and 7).

The other major point that must be considered is that the epithelial elongation of the enameloid organs terminates at a certain level during tooth formation in fish such as medaka. Tooth development is controlled by interactions between the epithelium and mesenchyme. In tooth development in mammals, the cervical loop grows after the crown formation stage, becoming Hertwig’s epithelial root sheath. However, the extent to which Hertwig’s epithelial root sheath descends toward the root apex varies in different species [42]. The teeth of medaka are also formed by interactions between the epithelium and mesenchyme. However, no epithelial tissue adjacent to the pedicle is observed during pedicle formation. These characteristics of scpp expression and epithelial elongation suggest that the pedicle is a bone-like tissue rather than a tooth-like tissue.

We characterized changes in the expression patterns of scpp genes in medaka during the formation and replacement of pharyngeal teeth. Furthermore, the expression patterns of mineralized tissue-related genes in medaka were found to be consistent with the cell dynamics of pedicle turnover during tooth replacement.

SCPP: secretory calcium-binding phosphoprotein

PCR: reverse transcription-polymerase chain reaction

qPCR: Real-time PCR

ISH: in situ hybridization

P/Q: Pro/Gln

ODAM: odontogenic ameloblast-associated protein

SPARCL1: secreted protein, acidic, cysteine-rich like 1

ambn: ameloblastin

enam: enamelin

GDV: Genome Data Viewer

EGB: Ensembl Genome Browser

SD: standard deviation

EDTA: ethylenediaminetetraacetic acid

TRAP: tartrate-resistant acid phosphatase

DIG: Digoxigenin

col1a1: collagen 1a1

bglap: bone gla protein

runx2: runt-related transcription factor 2

ide: inner dental epithelium

ode: outer dental epithelium

Dspp: dentin sialo phosphoprotein

Dmp1: dentin matrix protein 1

Ethics approval and consent to participate

All animal experiments were performed in accordance with policies and protocols approved by the guidelines of the Animal Welfare Committee of Tokushima University. In addition, we confirmed that all methods are reported in accordance with ARRIVE guidelines 2.0 for the reporting of animal experiments.

Consent for publication

Not applicable

Availability of data and materials

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. The accession or Ensembl numbers used for data analysis were as follows.

scpp1: XM_011475869.3, ENSORLG00000024846

scpp2: XM_004065876.4, ENSORLG00000006190

scpp4: XM_011475773.3

scpp5: XM_004084047.4, ENSORLG00000019321

scpp7: XM_020699512.2

scpp9: XM_004065877.3

enamelin: XM_011475762.3

spp1: XM_004086583.4, ENSORLG00000020900

sparc: NM_001104877.1, ENSORLG00000011369

col1a1: NM_001122918.2

bglap: NM_001201510.1

runx2: NM_001104850.1

sp7: XM_011474867.2

Conflict of interest

The authors declare that they have no competing interests.

Funding

The present study was supported in part by a Grant-in-Aid for Scientific Research (grant number: 22K09903). The funder had no role in the study design, data collection and analysis, decision to publish, or manuscript preparation.

Authors’ contributions

TM and OB contributed to the study conception and design. TM collected data. TM and SM conducted the experiments. TM performed the statistical analyses and final analysis of the data. The first draft of the manuscript was written by TM. OB commented on previous version of the manuscript. All authors read and approved the final manuscript.

Acknowledgments

We thank the members of the Department of Oral & Maxillofacial Anatomy for their support of this study.

Wittbrodt J, Shima A, Schartl M. Medaka - a model organism from the far East. Nat Rev Genet. 2002; 3:53-64.
Kasahara M, Naruse K, Sasaki S, Nakatani Y, Qu W, Ahsan B, Yamada T, Nagayasu Y, Doi K, Kasai Y, Jindo T, Kobayashi D, Shimada A, Toyoda A, Kuroki Y, Fujiyama A, Sasaki T, Shimizu A, Asakawa S, Shimizu N, Hashimoto S, Yang J, Lee Y, Matsushima K, Sugano S, Sakaizumi M, Narita T, Ohishi K, Haga S, Ohta F, Nomoto H, Nogata K, Morishita T, Endo T, Shin-l T, Takeda H, Morishita S, Kohara Y. The medaka draft genome and insights into vertebrate genome evolution. Nature. 2007; 447:714-719.
Atukorala ADS, Inohaya K, Baba O, Tabata MJ, Ratnayake RaRK, Abduweli D, Kasugai S, Mitani H, Takano Y. Scale and tooth phenotypes in medaka with a mutated ectodysplasin-A receptor: implications for the evolutionary origin of oral and pharyngeal teeth. Arch Histol Cytol. 2010; 73:139-148.
Abduweli D, Baba O, Tabata MJ, Higuchi K, Mitani H, Takano Y. Tooth replacement and putative odontogenic stem cell niches in pharyngeal dentition of medaka (Oryzias latipes). Microscopy (Oxf). 2014; 63:141-153.
Mantoku A, Chatani M, Aono K, Inohaya K, Kudo A. Osteoblast and osteoclast behaviors in the turnover of attachment bones during medaka tooth replacement. Dev Biol. 2016; 409:370-381.
Nemoto Y, Higuchi K, Baba O, Kudo A, Takano Y. Multinucleate osteoclasts in medaka as evidence of active bone remodeling. Bone. 2007; 40:399-408.
Kawasaki K, Suzuki T, Weiss KM. Phenogenetic drift in evolution: the changing genetic basis of vertebrate teeth. Proc Natl Acad Sci USA. 2005; 102:18063-18068.
Kawasaki K. The SCPP gene repertoire in bony vertebrates and graded differences in mineralized tissues. Dev Genes Evol. 2009; 219:147-157.
Kawasaki K, Weiss KM. SCPP gene evolution and the dental mineralization continuum. J Dent Res. 2008; 87:520-531.
Takano-Yamamoto T, Takemura T, Kitamura Y, Nomura S. Site-specific expression of RNA for osteonectin, osteocalcin and osteopontin revealed by in situ hybridization in rat periodontal ligament during physiological tooth movement. J Histochem Cytochem. 1994; 42:885-896
Lv Y, Kawasaki K, Li J, Li Y, Bian C, Huang Y, You X, Shi Q. A genomic survey of SCPP family genes in fishes provides novel insights into the evolution of fish scales. Int. J. Mol. Sci.2017; 18:2432
Kawasaki K, Mikami M, Nakatomi M, Braasch I, Batzel P, Postletwait HJ, Sato A, Sasagawa I, Ishiyama M. SCPP genes and their relatives in Gar: rapid expansion of mineralization genes in osteichthyans. J Exp Zool B Mol Dev Evol2017; 328: 645-65.
Rangwala SH, Kuznetsov A, Ananiev V, Asztalos A, Borodin E, Evgeniev V, Joukov V, Lotov V, Pannu R, Rudnev D, Shkeda A, Weitz EM, Scneider VA. Accessing NCBI Data Using the NCBI Sequence Viewer and Genome Data Viewer (GDV). Genome Res. 2021, 31, 159-169.
Baba O, Ota MS, Terashima T, Tabata MJ, Takano Y. Expression of transcripts for fibroblast growth factor 18 and its possible receptors during postnatal dentin formation in rat molars. Odontology. 2015; 103:136-142.
Karagic N, Schneider RF, Meyer A, Hulsey CD. A genomic cluster containing novel and conserved genes is associated with cichlid fish dental developmental convergence. Mol. Biol. Evol.2020; 37:3165-3174.
Baba O, Qin C, Brunn JC, Jones JE, Wygant JN, McIntyre BW, Butler WT. Detection of dentin sialoprotein in rat periodontium. Eur J Oral Sci. 2004; 112:163-170.
Balic A, Mina M. Identification of secretory odontoblasts using DMP1-GFP transgenic mice. Bone. 2011; 48:927-937.
Lin, Q, Fan S, Zhang Y, Xu M, Zhang H, Yang Y, Lee AP, Woltering JM, Ravi V, Gunter HM, Luo W, Gao Z, Lim ZW, Qin G, Schneider RF, Wang X, Xiong P, Li G, Wang K, Min J, Zhang C, Qiu Y, Bai J, He W, Bian C, Zhang X, Shan D, Qu H, Sun Y, Gao Q, Huang L, Shi Q, Meyer A, Venkatesh B. The seahorse genome and the evolution of its specialized morphology. Nature. 2016; 540:395-399.
Qu M, Liu Y, Zhang Y, Wan S, Ravi V, Qin G, Jiang H, Wang X, Zhang H, Zhang B, Gao Z, Huysseune A, Zhang Z, Zhang H, Chen Z, Yu H, Wu Y, Tang L, Li C, Zhong J, Ma L, Wang F, Zheng H, Yin J, Witten PE, Meyer A, Venkatesh B, Lin, Q. Seadragon genome analysis provides insights into its phenotype and sex determination locus. Science Advances. 2021; 7(34):5196.
Kawasaki K, Keating JN, Nakatomi M, Welten M, Mikami M, Sasagawa I, Puttick MN, Donoghue PC, Ishiyama M. Coevolution of enamel, ganoin, enameloid, and their matrix SCPP genes in osteichthyans. iScience. 2021; 24:102023. doi: 10.1016/j.isci.2020.102023
Nishio C, Wazen R, Kuroda S, Moffatt P, Nanci A. Expression pattern of odontogenic ameloblast-associated and amelotin during formation and regeneration of the junctional epithelium. Eur Cell Mater. 2010; 20:393-402.
Lee HK, Park SJ, Oh HJ, Kim JW, Bae HS, Park JC. Expression pattern, subcellular localization, and functional implications of ODAM in ameloblasts, odontoblasts, osteoblasts, and various cancer cells. Gene Expr Patterns. 2012; 12:102-108.
Lee HK, Lee DS, Ryoo HM, Park JT, Park SJ, Bae HS, Cho MI, Park JC. The odontogenic ameloblast-associated protein (ODAM) cooperates with RUNX2 and modulates enamel mineralization via regulation of MMP-20. JCell Biochem. 2010; 111:755-767.
Sasagawa I, Ishiyama M, Yokosuka H, Mikami M, Uchida T. Tooth enamel and enameloid in actinopterygian fish. Frontiers of Materials Science in China. 2009; 3(2):174-182.
Moffatt P, Smith CE, St-Arnaud R, Nanci A. Characterization of Apin, a secreted protein highly expressed in tooth-associated epithelia. J Cell Biochem. 2008; 103:941-956.
Liu Z, Liu S, Yao J, Bao L, Zhang J, Li Y, Jiang C, Sun L, Wang R, Zhang Y, Zhou T, Zeng Q, Fu Q, Gao S, Li N, Koren S, Jiang Y, Zimin A, Xu P, Phillippy AM, Geng X, Song L, Sun F, Li C, Wang X, Chen A, Jin Y, Yuan Z, Yang Y, Tan S, Peatman E, Lu J, Qin Z, Dunham R, Li Z, Sonstegard T, Feng J, Danzmann RG, Schroeder S, Scheffler B, Duke MV, Ballard L, Kucuktas H, Kaltenboeck L, Liu H, Armbruster J, Xie Y, Kirby ML, Tian Y, Flanagan ME, Mu W, Waldbieser GC. The channel catfish genome sequence provides insights into the evolution of scale formation in teleosts. Nat. Commun. 2016; 7:11757.
Bergen DJM, Tong Q, Shukla A, Newham E, Zethof J, Lundberg M, Ryan R, Youlten SE, Frysz M, Croucher PI, Flik G, Richardson RJ, Kemp JP, Hammond CL, Metz JR. Regenerating zebrafish scales express a subset of evolutionary conserved genes involved in human skeletal disease. BMC Biology. 2022; 20, Article number: 21.
Jono S, Peinado C, Giachelli CM. Phosphorylation of osteopontin is required for inhibition of vascular smooth muscle cell calcification. J Biol Chem. 2000; 275:20197-20203.
Tanabe N, Wheal BD, Kwon J, Chen HH, Shugg R, Sims SM, Goldberg HA, Dixon SJ. Osteopontin signals through calcium and nuclear factor of activated T cells (NFAT) in osteoclasts: A novel RGD-dependent pathway promoting cell survival. J Biol Chem. 2011; 286:39871-39881.
Reinholt FP, Hultenby K, Oldberg A, Heinegard D. Osteopontin - a possible anchor of osteoclasts to bone. Proc. Natl. Acad. Sci. USA. 1990; 87:4473-4475
Rosset EM, Bradshaw AD. SPARC/osteonectin in mineralized tissue. Matrix Biol. 2016; 78-87.
Delany AM, Amling M, Priemel M, Howe C, Baron R, Canalis E. Osteopenia and decreased bone formation in osteonectin-deficient mice. J Clin Invest. 2000; 105:915-923.
Weigele J, Franz-Odendaal TA, Hilbig R. Expression of SPARC and the osteopontin-like protein OP-L during skeletal development in the cichlid fish Oreochromis mossambicus. Dev Dyn. 2015; 244:955- 972.
Enault S, Muñoz D, Simion P, Ventéo S, Sire JY, Marcellini S, Debiais-Thibaud M. Evolution of dental tissue mineralization: an analysis of the jawed vertebrate SPARC and SPARC-L families. BMC Evolutionary Biology. 2018; 18:127.
Chaweewannakorn W, Ariyoshi W, Okinaga T, Morikawa K, Saeki K, Maki K, Nishihara T. Ameloblastin and enamelin prevent osteoclast formation by suppressing RANKL expression via MAPK signaling pathway. Biochem. Biophys. Res. Commun. 2017, 485, 621-626.
Foster BL, Ao M, Salmon CR, Chavez MB, Kolli TN, Tran AB, Chu EY, Kantovitz KR, Yadav M, Narisawa S, Millán JL, NocitiJr FH, Somerman MJ. Osteopontin regulates dentin and alveolar bone development and mineralization. Bone. 2018; 107:196-207.
Chan HL, Giannobile WV, Eber RM, Simmer JP, Hu JC. Characterization of Periodontal Structures of Enamelin Null Mice. J Periodontol. 2013; 7: 7.
Miyazaki T, Kanatani N, Rokutana S, Yoshida C, Toyosawa S, Nakamura R, Takada S, Komori T. Inhibition of terminal differentiation of odontoblasts and their transdifferentiation into osteoblasts in Runx2 transgenic mice. Arch Histol Cytol. 2008; 71:131-146.
Yu T, Graf M, Renn J, Schartl M, Larionova D, Huysseune A, Witten PE, Winkler C. A vertebrate-specific and essential role for osterix in osteogenesis revealed by gene knockout in the teleost medaka. Development. 2017; 144:265-271.
Kague E, Witten PE, Soenens M, Campos CL, Lubiana T, Fisher S, Hammond C, Brown KR, Passos-Bueno MR, Huysseune A. Zebrafish sp7 mutants show tooth cycling independent of attachment, eruption and poor differentiation of teeth. Dev Biol. 2018; 435:176-184.
Zhang H, Jiang Y, Qin C, Liu Y, Ho SP, Feng JQ. Essential role of osterix for tooth root but not crown dentin formation. J Bone Miner Res. 2015; 30:742-746.
Luan, X, Ito, Y, Diekwisch, TG. Evolution and development of Hertwig’s epithelial root sheath. Dev Dyn. 2006; 235:1167-1180.

No competing interests reported.

Download PDF

Journal Publication

published 11 Oct, 2023

Read the published version in BMC Oral Health →

Editorial decision: Major revision
03 Aug, 2023
Reviews received at journal
28 Jul, 2023
Reviewers agreed at journal
18 Jul, 2023
Reviewers invited by journal
18 Jul, 2023
Editor assigned by journal
13 Jul, 2023
Editor invited by journal
07 Mar, 2023
Submission checks completed at journal
07 Mar, 2023
First submitted to journal
16 Feb, 2023

You are reading this latest preprint version

Expression of secretory calcium-binding phosphoprotein (scpp) genes in medaka during the formation and replacement of pharyngeal teeth

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Medaka

Real-time reverse transcription-polymerase chain reaction (PCR) (qPCR)

Histological Analysis

Results

Discussion

The expression patterns of mineralized tissue-related genes change during the tooth replacement process

Is the pedicle a bone-like tissue or a tooth-like tissue?

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1