Multidrug Resistance and Virulence Gene Profile of Non Typhoidal Salmonella Isolates from Poultry Enteritis in Semi-arid Region of India

doi:10.21203/rs.3.rs-2598340/v1

Background and Objectives: The present study has determined the serological diversity, virulence gene and antibiotic resistance gene profile, and in-vitro antibiogram of non-typhoidal Salmonella (NTS) from poultry enteritis in semiarid area of Rajasthan, India

Methods: Organized poultry farms, from six districts of semiarid regions of Rajasthan were tested for presence of Salmonella serovars. Thirty Salmonella enterica strains, were screened for the presence of 15 virulence genes by PCR. Further, resistance to eight antibiotics was tested phenotypically by Kirby–Bauer method and genotypically by PCR.

Results: NTS were isolated from 78.17%( N= 178/151) samples. These were serologically belonged to . S. Typhimurium (51 strains), S. Weltevreden (90 strains) and untypable (10 strains). Out of these, Thirty Salmonella strains (S. Weltevreden, ten strains, Salmonella Typhimurium ten strains and two untypable strains) were subjected to virulence gene profiling and phenotypic tests. Eleven virulence genes i.e. invA, hilA, sivH, tolC, agfA, lpfA, spaN, pagC, spiA, iroN and fliC genes were present in all the 30 isolates. While, sopE was present in only 2 isolates but spvC, cdtB and sefA were not detected in any of the isolates. Antibiotic sensitivity test revealed multidrug resistance in 70% (N=21/30) of the Salmonella isolates. All twenty-one multidrug resistant Salmonella stains were tested for presence of antimicrobial resistant genes i.e. blaTEM, blaSHV, blaCTX-M, tet(A), tet(B), tet(C), sul1, sul2, sul3. blaTEM and tet(A) which were present in 95% (20/21) isolates and sul2 gene was present in all isolates.

Conclusion: NTS strains with characteristics of pathogenicity and multidrug resistance from poultry enteritis were detected. These virulent salmonella strains may be responsible for causing poultry enteritis. These NTS strains have zoonotic implications and multidrug resistance showed necessity of prudent use of antibiotics in poultry industry.

Antimicrobial resistance gene

Poultry enteritis

Salmonella Typhimurium

Salmonella Weltevreden

and Virulence genes

Poultry enteritis is a multi-factorial disease, caused by several pathogens. Among them Salmonella is a common pathogen associated with the disease (Jindal et al., 2009). The pathogenicity of Salmonella depends on a variety of virulence factors that help the pathogen in adhesion, invasion, intracellular survival, fimbrial expansion, systemic infection, antibiotic resistance, toxin production, and magnesium and iron uptake (Suresh et al., 2019).

A well-known virulence gene of Salmonella is the Salmonella invasion gene A (invA) which is responsible for host invasion (Galan et al., 1992). This gene is vital because it is conserved in all Salmonella species and is located on SPI-1. The spv (Salmonella plasmid virulence) operon is considered to be one of the virulence plasmids of many Salmonella serovars that cause systemic disease (Castilla et al., 2006). It harbours five genes spv R,A,B,C,D that have been identified to contribute to its pathogenicity (Card et al., 2016). The presence of hilA gene in Salmonella is essential for the expressionof the TTSS components and it encodes the central regulator hila (Borges et al., 2013).

Multidrug resistance is a big problem globally; the emergence of antibiotic resistance among Salmonella is of major public health importance. Antibiotic resistance, especially to the most commonly used antimicrobials in humans and in animal production systems, is of critical concern in Asian countries (Chen et al., 2020). It also proves of major economic concern for poultry industry (Bertelloni et al., 2017).

Study area and Sample collection

Intestinal swabs from a total 151 dead birds having history of enteritis were collected during post-mortem between July 2019-Dec 2020 from organized poultry farms from six districts (i.e. Ajmer, Sirohi, Dungurpur, Pali, Bhilwara and Udaipur) of semiarid regions of Rajasthan.

Salmonella isolation and identification

Bacterial culture and identification were carried out as per standard protocols (Quinn et al., 1994). The biochemically confirmed salmonella strains have been sent at National Salmonella and Escherichia Centre, Kasauli, Himachal Pradesh, India for serological characterization. Molecular confirmation of these strains was also done by amplification of invA gene using the PCR assay as described (Borges et al., 2013) (table 1).

Antibiotic susceptibility testing

All the representative sero-grouped Salmonella isolates were subjected to the disc diffusion antimicrobial sensitivity test on Mueller Hinton Agar (Himedia Pvt. Ltd., Mumbai, India), as described by Bauer et al., (1966) and following clinical laboratory standards Institute guidelines.The eight antibiotics discs used in present study were amikacin (30 mcg), azithromycin (15 mcg), ampicillin (10 mcg), ceftriaxone (30 mcg), ciprofloxacin (05 mcg), co-Trimoxazole (15 mcg), gentamycin (10 mcg), and tetracycline (30 mcg).

Detection of virulence and antibiotic associated genes

All isolates of Salmonella were screened for the presence of virulence and resistance genes by Polymerase chain reaction (PCR). DNA was extracted from overnight grown cultures of each isolate by heat treatment method as described (Li et al., 2017) and used directly as template for PCR assays.

All salmonella isolates were screened for the presence of a total of 15 virulence genes viz. invA, hilA, sivH, tolC, agfA, lpfA, spaN, pagC, spiA, iroN, fliC, sopE, spvC, cdtB and sefA . . The details of target genes, their oligonucleotide sequences used in the study and their amplification product size are shown in the Table 1. Simplex PCR was executed for each gene, following protocols reported by Skyberg et al., (2006) and Borges et al., (2013)

Genotypic characterization of antibiotic sensitivity pattern against ampicillin, tetracycline and sulfonamide was done by amplification of blaTEM, blaSHV, blaCTX-M, tet(A), tet(B), tet(C), sul1, sul2, and sul3 genes (Hai et al., 2020). The details of oligonucleotide sequences used in the study and amplification product size are shown in the table-2.

Salmonella prevalence and serotypes

A total of 118 Salmonella isolates (118/151, 78.17%) were recovered from faecal swabs collected during post-mortem of poultry died with symptoms of enteritis. Serologically these salmonella isolates were belonged to S. Typhimurium (51 strains), S. Weltevreden (90 strains) and untypable (10 strains).

Antibiotic susceptibility testing

Among the 118 isolates of Salmonella serovars, the most effective antibiotic was amikacin 39/118 (33.05%) and gentamycin 39/118 (33.05%) followed by ampicillin 20/118 (16.69%), azithromycin 20/118 (16.69%), ciprofloxacin 20/118 (16.69%), co-Trimoxazole 16/118 (13.55%), ceftriaxone 39/118 (33.05%) and tetracycline 8/118 (6.78%) (Table-3). Antibiotic sensitivity test revealed the 70% (N = 82) of the Salmonella isolates showing resistance against more than three antibiotics and these isolates were considered as multidrug resistant (MDR) (Fig. 3).

Detection of virulence genes

Thirty Salmonella strains were screened for presence of 15 virulence genes viz. invA, hilA, sivH, tolC, agfA, lpfA, spaN, pagC, spiA, iroN, fliC, sopE, spvC, cdtB and sefA were detected in Salmonella serovars by PCR using gene specific primers (Fig.1 ). Out of them, eleven genes (invA, hilA, sivH, tolC, agfA, lpfA, spaN, pagC, spiA, iroN and fliC) were prevalent in all the tested S. Typhimurium strains 10/10 (100%), S. Weltevreden 18/18(100%) and untypable Salmonella 2/2(100%). The sopE gene was detected only in 2/10(20%) isolates of S. Typhimurium while spvC, cdtB and sefA were absent among all the tested isolates of Salmonella.

Detection of Antibiotic resistance genes

Out of thirty multidrug resistance strains tested, 21 isolates were β-lactam resistant, 20 isolates (95.24%) carried only bla _TEM gene. Twenty one strains were tested for the presence of three tetracycline resistant genes, namely tet A, tet B and tet C, in which tet A gene was present in 20 isolates (95.24%) while tet B and tet C genes were not detected in our study. Resistance towards sulphonamide was detected by presence of sul1, sul2 and sul3 genes. Sul2 gene was detected in all the 21 resistant isolates, while sul1 and sul3 genes were not detected in all the isolates (Table-4) and ( Fig. 2).

Most predominant serovar identified in present study was Salmonella Weltevreden (60%) followed by Salmonella Typhimurium (33.33%). While, two (6.66 %) isolates were found to be untypable. These findings are corresponding to Abdellah et al., (span style="font-family:'Times New Roman'">2009), who observed Salmonella Typhimurium was found in 40.35% of isolates. In earlier reports by Saikia et al., 2015 and Barua et al., 2013 also reported Salmonella Weltevreden and Salmonella Typhimurium from poultry sources. Originating from India, Salmonella Weltevreden has become the most common non-typhoid Salmonella (NTS) in the south and Southeast Asia due to its peculiar capacity for commensalism, and can cause worldwide zoonosis through the use of infected foods and is considered an important pathogen in the context of public health (Ferrari et al., 2019). After S. Enteriditis, S. Typhimurium is the most frequently isolated serotype responsible for Non Thyphoidal Salmonella (NTS) infections globally (Galanis et al., 2006).

Fifteen virulence gene viz. invA, hilA, sivH, tolC, agfA, lpfA, spaN, pagC, spiA, iroN, fliC, sopE, spvC, cdtB and sefA which are associated with Salmonella invasion, fimbrial production, effector protein, plasmid virulence, intra-macrophage survival, iron transport and motility were investigated. Most of these virulence factors are required for full virulence expression of Salmonella organism and many are located on Salmonella Pathogenicity Islands (SPI) and are associated with TTSS (Skyberg et al., 2006). Among the 15 genes screened, 11 genes (invA, hilA, sivH, tolC, agfA, lpfA, spaN, pagC, spiA, iroN and fliC) were prevalent in all Salmonella serovars tested, while, sopE virulence gene was present in only 2 isolates of S. Typhimurium. spvC, cdtB and sefA were not detected in any isolates.

Further, invA, hilA, sivH, tolC and cbtB genes have an important role in host cell invasion and presence of these genes is indicative of invasive properties of field isolates (Ilyas et al., 2017). Our findings are in accordance with Awad, et al., (2020) and Jayaweera, et al., (2020) who reported the presence of invA, hilA, sivH, tolC and cbtB genes in field isolates from various sources. Our findings about invA gene are also in agreement with previous report of (Abdelfatah et al., 2018).

The protein coded by spaN gene plays an important role in entry of the pathogen into nonphagocytic cells and killing of macrophages (Ahmad, 2020). This gene was found in all the isolates recovered in our study which shows the pathogenic potential of the bacterial isolates. The pagC and spiA genes are responsible for survival inside cells, especially the ability to survive within macrophages (Skyberg et al., 2006). All tested 30 isolates were found to be positive for the presence of these genes.

Bacteria depend on several mechanisms and molecules to obtain iron for its existence after cell invasion; Salmonella spp finds an environment with restricted amount of iron whereas this is an essential element for their survival and growth within the host cell (Skyberg et al., 2006). The iroN gene encodes proteins that have role as receptors of siderophores (Kingsley et al., 2003). In our study iroN gene, was detected in all the Salmonella isolates. Thus, our results are in accordance with the findings of Webber et al., (2019).

Salmonella flagella is made up of two antigenically distinct proteins, fliB and fliC, encoded by the fliB and fliC loci, respectively (Ikeda et al., 2001). The fliC gene encodes the flagellin protein subunit that merges into another protein subunit to form flagellar filaments and give them motility (Aldridge et al 2006). In the present study, all 30 isolates tested were positive for the presence of the fliC gene.

Curli fimbriae play an important role in biofilm formation (Yoo et al., 2013) and the curli fimbriae genes i.e., sefA and agf are organized in two operons, agfBAC and agfDEFG, being involved in their synthesis (Collinson et al., 1996). All the 30 tested isolates were found positive for the presence of lpfA, and agfA genes while sefA gene was not detected in any of the tested isolates.

The second feature of Salmonella Serovars investigated was antimicrobial resistance. Aminoglycosides were found to be effective against 33.33% isolates while ampicillin, azithromycin and ciprofloxacin were found to be effective against 16.67% isolates.

Most isolates showed resistance to penicillin, sulfonamides and tetracycline. Also, these are the most commonly used antimicrobials in chicken flocks in India as feed additives and/or for treatment of various conditions (Cantas et al., 2013). Overall, out of the 118 isolates tested for eight antibiotics, none of them were found 100% effective against all the tested isolates.

The indiscriminate use of antibiotics for the therapeutic purposes in food animals and in animal feeds as growth promoters is responsible for dissemination of Salmonellae antimicrobial resistance, by mutation and acquisition of resistance encoding genes ( Chen et al., 2020; Humphrey, 2000; White et al., 2001; and Fluit, 2005). Further, the 21 multi drug resistant (MDR) Salmonella isolates were analysed for the presence of 9 antibiotic resistance genes viz. 3 genes of β-lactam i.e., bla _TEM, bla _SHV, bla _CTX-M, 3 genes of tetracycline i.e., tet A, tet B, tet C and 3 genes of sulphonamide i.e. sul1, sul2 and sul3. The most common route of bacterial resistance to β-lactam antibiotics is the β-lactamase enzyme (Livermore et al., 2007). Extended-spectrum beta-lactamases (ESBLs), TEM and SHV (sulfhydryl variable active site) types have been defined in Salmonella worldwide (Humphrey, 2000). In our study, out of 21 β-lactam resistant isolates, 20 isolates (95.24%) carried bla _TEM gene while bla _SHV and bla _CTX-M genes were not detected in any of the isolates.

Among tetracycline resistance genes i.e., tet A, tet B, tet C tested, tet A was present in 95.24% (20/21) isolates, while none of the isolates carried tet B, tet C genes. Sulfonamide resistance was detected by the presence of sul1, sul2 and sul3 genes. Out of these three genes, sul2 was detected in 100% isolates (21/21), while sul1 and sul3 were found to be absent in all the isolates Odoch et al., (2018); Hai et al., (2020), and Suez et al., (2013),reported similar results. Similarly, Keelara et al., (2014), reported sul2 gene to be more prevalent in MDR S. Typhimurium isolates from North Carolina, U.S.A. Conflicting to this, Randall et al., (2004),observed higher prevalence of sul1 gene than that of sul2 gene in S. Typhimurium isolates, which signifies its vital role in conferring resistance to sulphonamide in this particular serotype. This variation could be due to differences in the geographical locations.

The present study shows that paratyphoid Salmonella strains with several characters of pathogenicity are associated with poultry enteritis. Diversity in the distribution of virulence genes was observed. Most of the investigated virulence genes were frequently detected in S. Weltevreden and S. Typhimurium serovars, confirming these serovars as the most potentially pathogenic salmonellae. High antibiotic resistance observed in present study indicates towards the increasing threat for the therapy of Salmonella and other bacterial infections. Unfortunately, present investigation did not find any single antibiotic effective against all the tested isolates. Multi drug resistant (MDR) Salmonella isolates confirmed the presence of antimicrobial resistance genes of β-lactam, tetracycline, and sulphonamide. The results present study indicates that the poultry harbour highly virulent and multi drug resistant Salmonella serovars. Which may be caused of poultry enteritis or it may act as secondary invaders and increase mortality of the host.

Funding- The authors declare that no funds, grant or other support were received during preparation of this manuscript. The study was conducted by institutional support.

Data availability statement – All data generated or analysed during this study are included in this published article.

Funding- The authors declare that no funds, grant or other support were received during preparation of this manuscript. The study was conducted by institutional support.

Data availability statement – All data generated or analysed during this study are included in this published article.

Source of support- Dean College of veterinary and animal science Navania Vallabhnagar Udaipur, Rajasthan University of veterinary and animal science Bikaner Rajasthan, India

Acknowledgement: authors want to acknowledge Prof Dr S. K. Garg Vice Chancellor RAJUVAS, Bikaner and Prof Rajiv Kumar Joshi, Dean CVAS Navania for financial support for the study

Conflict of interest: Authors have no conflict of interest

Contributors list –

A.S. and D. K. S. : Concept and design of study or acquisition of data or analysis and interpretation of data;

A. S., C. P., P. R. S. and K. R.- Carried out lab work as per requirement of the manuscript

R. S., A .G. and R. J.: Drafting the article or revising it critically for important intellectual content; and

D. K. S, R. S., A.G. and R. J. Final approval of the version to be published.

Ethical approval-

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to. No ethical approval was required as the study has been carried out on dead birds kept for diagnostic procedures from poultry farms and no other live bird/ laboratory animals involved in the study. So there is no need of ethical committee approval in the present study

It is to certify that the manuscript entitled “Multidrug Resistance and Virulence Gene Profile of Non Typhoidal Salmonella Isolates from Poultry Enteritis in Semi-arid Region of India” has been read and approved by all the authors, that the requirements for authorship as stated earlier in this document have been met, and that each author believes that the manuscript represents honest work,

S. No.	Name	Designation	Department	Email
	Arpita Sain	Teaching associate	Department of Veterinary Microbiology (VMC)	[email protected]
	Deepak Kumar Sharma	Assistant professor and in charge	VMC	[email protected]
	Rajesh Singathia	Assistant professor	VMC	[email protected]
	Abhishek Gaurav	Assistant professor	Department of Veterinary Public Health (VPH)	[email protected]
	Chaman Patidar	M.V.Sc. Scholar	VMC	[email protected]
	PrabuRam Suthar	M.V.Sc. Scholar	VMC	[email protected]
	Karishma Rathore	Teaching associate	VMC	[email protected]
	Rohit Juneja	Teaching associate	Department of Veterinary Gynaecology and Obstratics, CVAS Navania	[email protected]

Name, address, e-mail, and telephone number of the corresponding author,

Dr Deepak Kumar Sharma

Email: [email protected]

Mobile No. 9950970206

Address: Department of Veterinary Microbiology,

College of Veterinary and Animal Science

Navania, Vallabhnagar, Udaipur

PIN- 313601

Abdelfatah, E. N., Mohameda, A. S., & Abdellatif, S. S. (2018). Molecular differentiation and antimicrobial resistance patterns of Salmonella enteritidis and Salmonella typhimurium isolated from different food samples. In 5th International Food Safety Conference Daman hour University (pp.165–183)
Abdellah, C., Fouzia, R. F., Abdelkader, C., Rachida, S. B.& Mouloud, Z. (2009). Prevalence and anti-microbial susceptibility of Salmonella isolates from chicken carcasses and giblets in Mekns, Morocco. African journal of microbiology Research, 3(5): 215-219.
Ahmad, Y. (2020). Molecular screening of resistant and virulent genes in salmonella enteritidis and salmonella typhimurium from poultry in Khyber Pakhtunkhwa. Pakistan Veterinary Journal. doi:10.29261/pakvetj/2020.044
Aldridge, P., Gnerer, J., Karlinsey, J. E., & Hughes, K. T. (2006). Transcriptional and translational control of the Salmonella fliC gene. Journal of Bacteriology, 188(12), 4487–4496. doi:10.1128/JB.00094-06
Awad, A., Gwida, M., Khalifa, E., & Sadat, A. (2020). Phenotypes, antibacterial-resistant profile, and virulence-associated genes of Salmonella serovars isolated from retail chicken meat in Egypt. Veterinary World, 13(3), 440–445. doi:10.14202/vetworld.2020.440-445
Barua, H., Biswas, P. K., Olsen, K. E., Shil, S. K., & Christensen, J. P.. (2013). Molecular characterization of motile serovars of Salmonella enterica from breeder and commercial broiler poultry farms in Bangladesh. PLOS ONE, 8(3), e57811. doi:10.1371/journal.pone.0057811
Bauer, A. W. (1966). Antibiotic susceptibility testing by a standardized single disc method. American Journal of Clinical Pathology, 45, 149–158. doi:10.1093/ajcp/45.4_ts.493
Bertelloni, F., Tosi, G., Massi, P., Fiorentini, L., Parigi, M., Cerri, D., & Ebani, V. V. (2017). Some pathogenic characters of paratyphoid Salmonella enterica strains isolated from poultry. Asian Pacific Journal of Tropical Medicine, 10(12), 1161–1166. doi:10.1016/j.apjtm.2017.10.023
Borges, K. A., Furian, T. Q., Borsoi, A., Moraes, H. L. S., Salle, C. T. P., & Nascimento, V. P. (2013). Detection of virulence-associated genes in Salmonella enteritidis isolates from chicken in South of Brazil. Pesquisa Veterinaria Brasileira, 33(12), 1416–1422. doi:10.1590/S0100-736X2013001200004
Cantas, L., Shah, S. Q. A., Cavaco, L. M., Manaia, C. M., Walsh, F., Popowska, M., Garelick, H., Bürgmann, H., & Sørum, H. (2013). A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota. Frontiers in Microbiology, 4, 96. doi:10.3389/fmicb.2013.00096
Card, R., Vaughan, K., Bagnall, M., Spiropoulos, J., Cooley, W., Strickland, T., & Anjum, M. F. (2016). Virulence characterization of Salmonella enterica isolates of differing antimicrobial resistance recovered from UK livestock and imported meat samples. Frontiers in Microbiology, 7(640), 1–11. doi:10.3389/fmicb.2016.00640
Castilla, K. S., Ferreira, C. S. A., Moreno, A. M., Nunes, I. A., & Ferreira, A. J. P. (2006). Distribution of virulence genes sefC, pefA and spvC in Salmonella enteritidis phage type 4 strains isolated in Brazil. Brazilian Journal of Microbiology, 37(2), 135–139. doi:10.1590/S1517-83822006000200007
Chen, Z., Bai, J., Wang, S., Zhang, X., Zhan, Z., Shen, H., Zhang, H., Wen, J., Gao, Y., Liao, M., & Zhang, J. (2020). Prevalence, Antimicrobial Resistance, Virulence Genes and Genetic Diversity of Salmonella Isolated from Retail Duck Meat in Southern China. Microorganisms, 8(3), 444. https://doi.org/10.3390/microorganisms8030444
Collinson, S. K., Liu, S. L., Clouthier, S. C., Banser, P. A., Doran, J. L., Sanderson, K. E., & Kay, W. W. (1996). The location of four fimbrin-encoding genes, Agfa, fimA, sefA and sefD, on the Salmonella enteritidis and/or S. typhimurium XbaI-BlnI genomic restriction maps. Gene, 169(1), 75–80. doi:10.1016/0378-1119(95)00763-6
Ferrari, R. G., Rosario, D. K. A., Cunha-Neto, A., Mano, S. B., Figueiredo, E. E. S., & Conte-Junior, C. A. (2019). Worldwide epidemiology of Salmonella serovars in animal-based foods: A meta-analysis. Applied and Environmental Microbiology, 85(14). doi:10.1128/AEM.00591-19
Fluit, A. C. (2005). Towards more virulent and antibiotic-resistant Salmonella? FEMS Immunology and Medical Microbiology, 43(1), 1–11. doi:10.1016/j.femsim.2004.10.007
Galán, J. E., Ginocchio, C., & Costeas, P. (1992). Molecular and functional characterization of the Salmonella invasion gene invA: Homology of InvA to members of a new protein family. Journal of Bacteriology, 174(13), 4338–4349. doi:10.1128/jb.174.13.4338-4349.1992
Galanis, E., Lo Fo Wong, D. M. A., Patrick, M. E., Binsztein, N., Cieslik, A., Chalermchikit, T., Aidara-Kane, A., Ellis, A., Angulo, F. J., Wegener, H. C., & World Health Organization Global Salm-Surv. (2006). Web-based surveillance and global Salmonella distribution, 2000–2002. Emerging Infectious Diseases, 12(3), 381–388. doi:10.3201/eid1205.050854
Hai, D., Yin, X., Lu, Z., Lv, F., Zhao, H., & Bie, X. (2020). Occurrence, drug resistance, and virulence genes of Salmonella isolated from chicken and eggs. Food Control, 113, (107109). doi:10.1016/j.foodcont.2020.107109
Humphrey, T. (2000). Public-health aspects of Salmonella infection. In Salmonella in domestic animals (pp. 245–263). CABI Publishing. U.K. http://sherekashmir.informaticspublishing.com
Ikeda, J. S., Schmitt, C. K., Darnell, S. C., Watson, P. R., Bispham, J., Wallis, T. S., Weinstein, D. L., Metcalf, E. S., Adams, P., O’Connor, C. D., & O’Brien, A. D. (2001). Flagellar phase variation of Salmonella enterica serovar Typhimurium contributes to virulence in the murine typhoid infection model but does not influence Salmonella-induced enteropathogenesis. Infection and Immunity, 69(5), 3021–3030. doi:10.1128/IAI.69.5.3021-3030.2001
Ilyas B, Tsai CN and Coombes BK (2017) Evolution of Salmonella-Host Cell Interactions through a Dynamic Bacterial Genome. Front. Cell. Infect. Microbiol. 7:428. doi: 10.3389/fcimb.2017.00428
Jayaweera, T. S. P., Ruwandeepika, H. A. D., Deekshit, V. K., Vidanarachchi, J. K., Kodithuwakku, S. P., Karunasagar, I., & Cyril, H. W. (2020). Isolation and identification of Salmonella spp from broiler chicken meat in Sri Lanka and their antibiotic resistance [Internet]. Journal of Agricultural Sciences – Sri Lanka, 15(3), 395. doi:10.4038/jas.v15i3.9031
Jindal, N., Patnayak, D. P., Ziegler, A. F., Lago, A., & Goyal, S. M. (2009). A retrospective study on poult enteritis syndrome in Minnesota. Avian Diseases, 53(2), 268–275. doi:10.1637/8513-110308-Reg.1
Keelara, S., Scott, H. M., Morrow, W. M., Hartley, C. S., Griffin, D. L., Gebreyes, W. A., & Thakur, S. (2014). Comparative phenotypic and genotypic characterization of temporally related nontyphoidal Salmonella isolated from human clinical cases, pigs, and the environment in North Carolina. Foodborne Pathogens and Disease, 11(2), 156–164. doi:10.1089/fpd.2013.1630
Kingsley, R. A., Humphries, A. D., Weening, E. H., De Zoete, M. R., Winter, S., Papaconstantinopoulou, A., Dougan, G., & Bäumler, A. J. (2003). Molecular and phenotypic analysis of the CS54 island of Salmonella enterica serotype typhimurium: Identification of intestinal colonization and persistence determinants. Infection and Immunity, 71(2), 629–640. doi:10.1128/IAI.71.2.629-640.2003
Li, F., Li, F., Chen, B., Zhou, B., Yu, P., Yu, S., Lai, W., & Xu, H. (2017). Sextuplex PCR combined with immunomagnetic separation and PMA treatment for rapid detection and specific identification of viable Salmonella spp, Salmonella enterica serovars Paratyphi B, Salmonella Typhimurium, and Salmonella enteritidis in raw meat. Food Control, 73, 587–594. doi:2016.09.009
Livermore, D. M., Canton, R., Gniadkowski, M., Nordmann, P., Rossolini, G. M., Arlet, G., Ayala, J., Coque, T. M., Kern-Zdanowicz, I., Luzzaro, F., Poirel, L., & Woodford, N. (2007). CTX-M: Changing the face of ESBLs in Europe. Journal of Antimicrobial Chemotherapy, 59(2), 165–174. doi:10.1093/jac/dkl483
Odoch, T., Sekse, C., L’Abee-Lund, T. M., Høgberg Hansen, H. C., Kankya, C., & Wasteson, Y. (2018). Diversity and antimicrobial resistance genotypes in non-typhoidal salmonella isolates from poultry farms in Uganda. International Journal of Environmental Research and Public Health, 15(2), 324. doi:10.3390/ijerph15020324
Quinn, P. J., Carter, M. E., Markey, B., & Carter, G. R. (1994). Enterobacteriaceae. Clinical Veterinary Microbiology, 27(1), 109–135.
Randall, L. P., Cooles, S. W., Osborn, M. K., Piddock, L. J. V., & Woodward, M. J. (2004). Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. Journal of Antimicrobial Chemotherapy, 53(2), 208–216. doi:10.1093/jac/dkh070
Saikia, L., Sharma, A., Nath, R., Choudhury, G., & Borah, A. K. (2015). Salmonella Weltevreden food poisoning in a tea garden of Assam: An outbreak investigation. Indian Journal of Medical Microbiology, 33(4), 503–506. doi:10.4103/0255-0857.167347
Skyberg, J. A., Logue, C. M., & Nolan, L. K. (2006). Virulence genotyping of Salmonella spp with multiplex PCR. Avian Diseases, 50(1), 77–81. doi:10.1637/7417.1
Suez, J., Porwollik, S., Dagan, A., Marzel, A., Schorr, Y. I., Desai, P. T., Agmon, V., McClelland, M., Rahav, G., & Gal-Mor, O. (2013). Virulence gene profiling and pathogenicity characterization of non-typhoidal Salmonella accounted for invasive disease in humans. PLOS ONE, 8(3), e58449. doi:10.1371/journal.pone.0058449
Suresh, Y., Bindukiranmayi, Ch., Rao, T. S., Srivani, M., Sankar, A. U. S. N. (2019). Prevalence and virulence gene profiles of Salmonella serovars isolated from animal origin. The Pharma Innovation Journal, 8(12), 139–145.
Webber, B., Borges, K. A., Furian, T. Q., Rizzo, N. N., Tondo, E. C., Santos, L. R. D., Rodrigues, L. B., & Nascimento, V. P. D. (2019). Detection of virulence genes in Salmonella Heidelberg isolated from chicken carcasses. Revista do Instituto de Medicina Tropical de São Paulo, 61, e36. doi:10.1590/S1678-9946201961036
White, D. G., Zhao, S., Sudler, R., Ayers, S., Friedman, S., Chen, S., McDermott, P. F., McDermott, S., Wagner, D. D., & Meng, J. (2001). The isolation of antibiotic-resistant salmonella from retail ground meats. New England Journal of Medicine, 345(16), 1147–1154. doi:10.1056/NEJMoa010315
Yoo, A. Y., Yu, J. E., Yoo, H., Lee, T. H., Lee, W. H., Oh, J. I., & Kang, H. Y. (2013). Role of sigma factor E in regulation of Salmonella AGF expression. Biochemical and Biophysical Research Communications, 430(1), 131–136. doi:10.1016/j.bbrc.2012.11.025

Table 1: virulence gene detected, oligonucleotide sequences and PCR amplicon size.

Gene	Virulence-related function	Sequence (5’----3’)	Amplicon Size (Base Pair)	Annealing temp (⁰C)	Reference
invA	Host recognition/ invasion	GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC	284	55	Skyberg et al., (2006) and Borges et al., (2013)
hilA	Host recognition/invasion	CTGCCGCAGTGTTAAGGATA CTGTCGCCTTAATCGCATGT	497	47
sivH	Host recognition/invasion	CAGAATGCGAATCCTTCGCAC GTATGCGAACAAGCGTAACAC	763	49
tolC	Host recognition/invasion	TACCCAGGCGCAAAAAGAGGCTATC CCGCGTTATCCAGGTTGTTGC	161	54
cdtB	Host recognition/invasion	ACAACTGTCGCATCTCGCCCCGTCATT CAATTTGCGTGGGTTCTGTAGGTGCGAGT	268	59
agfA	fimbrial production	TCCACAATGGGGCGGCGGCG CCTGACGCACCATTACGCTG	350	51
lpfA	fimbrial production	CTTTCGCTGCTGAATCTGGT CAGTGTTAACAGAAACCAGT	250	43
sefA	fimbrial production	GATACTGCTGAACGTAGAAGG GCGTAAATCAGCATCTGCAGTAGC	488	47
sopE	Effector protein	ACACACTTTCACCGAGGAAGCG GGATGCCTTCTGATGTTGACTGG	398	52
spvC	Plasmid – virulence	CGGAAATACCATCTACAAATA CCCAAACCCATACTTACTCTG	669	42
span	Entry into nonphagocytic cells, killing of macrophages	AAAAGCCGTGGAATCCGTTAGTGAAGT CAGCGCTGGGGATTACCGTTTTG	504	55
pagC	Survival within macrophage	CGCCTTTTCCGTGGGGTATGC GAAGCCGTTTATTTTTGTAGAGGAGATGTT	454	56
spiA	Survival within macrophage	CCAGGGGTCGTTAGTGTATTGCGTGAGATG CGCGTAACAAAGAACCCGTAGTGATGGATT	550	56
iroN	Iron acquisition	ACTGGCACGGCTCGCTGTCGCTCTAT CGCTTTACCGCCGTTCTGCCACTGC	1205	61
fliC	Motility (formation of flagella)	TATATCCATGGCACAAGTCATTAATACAAAC AGCCTGT ATTACTCGAGACGCAGTAAAGAGAGGACGT TTTGC	1521	57

Table 2: Antimicrobial resistance genes detected, oligonucleotide sequences and PCR amplicon size

Antibiotics	Target Gene	Sequence (5’----3’)	Amplicon size (Base Pair)	Annealing. Temp (⁰C)	Reference
β-Lactams	bla_TEM	GAGTACTCACCA TCACAGAA AAGC GACTTCCCGTCGTGTAGATAAC	489	51	(Hai et al., 2020)
	bla_SHV	TTA TCT CCC TGT TAG CCA CC GATTTGCTGATTTCGCGCCG	797	47
	bla _CTX-M	TTTGCGATGTGCAGTACCAGTAA CGATATCGTTGGTGGTGCCATA	544	48
Tetracycline	tet(A)	GTAATTCTGAGCACTGTCGC GAGACGCAATCGAATTCGG	956	47
	tet(B)	GAGACGCAATCGAATTCGG TTTAGTGGCTATTCTTCCTGCC	228	46
	tet(C)	CTTGAGAGCCTTCAACCCAG ATGGTCGTCATCTACCTGCC	418	49
Sulphonamide	sul1	CTTCGATGAGAGCCGGCGGC GCAAGGCGGAAACCCGCGCC	549	55
	sul2	GCGCTCAAGGCAGATGGCATT GCGTTTGATACCGGCACCCGT	285	51
	sul3	AGATGTGATTGATTTGGGAGC TAGTTGTTTCTGGATTAGAGCCT	443	45

Table 3: Antimicrobial susceptibility of Salmonella isolates

S. No.	Antibiotics		Total isolates	Resistance	Intermediate	Sensitive
1	Penicillins	Ampicillin (AMP)	118	83(70)	16(13.33)	19(16.67)
2	Tetracyclines	Tetracycline (TE)	118	95(80.71)	15(12.62)	8(6.67)
4	Folate pathway inhibitors	Co- trimoxazole (COT)	118	94(80)	8(6.67)	16(13.33)
5	Cephems	Ceftriaxone	118	75(63.33)	31(26.66)	12(10)
6	Fluoroquinolones	Ciprofloxacin (CIP)	118	87(73.33)	12(10)	19(16.67)
7	Aminoglycosides	Amikacin (Ak)	118	51 (43.33)	28(23.33)	39(33.33)
		Gentamycin (GEN)	118	59(50)	20(16.67)	39(33.33)
		Azithromycin (AZM) amikacin 39/118 (33.05%) and gentamycin 39/118 (33.05%)	118	71(60)	28(23.33)	19(16.67)

NB: The figures in parenthesis represent percentage

Table 4: Distribution of antimicrobial resistant genes in the Salmonella isolates

Antimicrobial (s)	Resistance genes	No. of resistant isolates (R)	Resistance gene positive	Reference
β-lactam	bla _TEM	21	20 (95.24%)
	bla _SHV	21	-
	bla _CTX-M	21	-
Tetracycline	tet(A)	21	20 (95.24%)
	tet(B)	21	-
	tet(C)	21	-
Sulphonamide	sul1	21	-
	sul2	21	21 (100%)
	sul3	21	-

Multidrug Resistance and Virulence Gene Profile of Non Typhoidal Salmonella Isolates from Poultry Enteritis in Semi-arid Region of India

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Declarations

References

Tables

Status:

Journal Publication

Version 1