An investigation of the expression of the NKX2-1 gene in nodular goiter

doi:10.21203/rs.3.rs-2603587/v1

Download PDF

Research Article

An investigation of the expression of the NKX2-1 gene in nodular goiter

https://doi.org/10.21203/rs.3.rs-2603587/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The reported risk of papillary thyroid cancer among patients with benign nodular goiter is variable. Therefore, understanding the cause of goiters can assist in their management. No consensus has been reached regarding the genetic factors that influence the development of nodular goiter. The objective of this study was to determine the expression level of NKX2-1 in benign goiter tumors.

Methods

A case-control study was conducted on 18 samples of fresh goiter tissue collected during thyroidectomy in Isfahan, Iran and 18 samples of healthy tissue around the goiter. Following extraction of RNA, cDNA was synthesized. RT-qPCR was used to determine the expression of NKX2-1 using specific primers (exon-junction and intron-spanning).

Results

The extracted RNAs were intact and suitable for cDNA synthesis. Melting curve analysis revealed distinct amplifications of the NKX2-1 gene. A significant difference was observed in the level of expression of NKX2-1 between nodular goiter and adjacent healthy tissues (relative expression = 1.172, p = 0.04).

Conclusion

It was found that the expression of NKX2-1 was different between nodular goiter tissues and adjacent healthy tissues.

nodular goiter

NKX2-1

gene expression

Goiter is a common cause of thyroid surgery, but its molecular and genetic origin is unknown. Furthermore, thyroid cancer incidence has recently increased to 15.6% among patients treated surgically for thyroid diseases, which is higher than expected (Smith et al. 2013). Studies of thyroid nodular diseases have focused primarily on well-differentiated and undifferentiated thyroid cancers (Chevillard et al. 2004; Landa et al. 2016), whereas benign nodular goiters often remain unnoticed.

NK2 Homeobox 1 (NKX2-1) gene encodes a transcription factor that is expressed during the early development of the lung, forebrain regions, hypothalamus and especially the thyroid gland (Thorwarth et al. 2014). As a member of the homeodomain-containing NK-2 gene family, NKX2-1 (OMIM *600635, ENSG00000136352) regulates the transcription of thyroid-specific genes (Guazzi et al. 1990). NKX2-1-deficient homozygous animals were born without thyroid glands and died shortly after birth (Kimura et al. 1996). The expression of NKX2-1 is low in siblings with congenital hypothyroid goiter, resulting in defective thyroglobulin synthesis (Acebrón et al. 1995). Because NKX2-1 functions as a tumor suppressor, it inhibits cell proliferation, motility, and metastatic potential and has been implicated in the development of invasive mucinous adenocarcinomas of the lungs (Moisés et al. 2017). In a recent study, we suggested that NKX2-1 may be used as a potential differentiation indicator in papillary thyroid cancer (Mokhtari et al. 2022).

Although NKX2-1 is essential for the onset of many diseases, not much is known about how it affects nodular goiters. The results of a study conducted in 2022 revealed that seventy genes were expressed differently in multinodular goiters and one long non-coding RNA sequence (H19 opposite tumor suppressor) was expressed exclusively in these tissues (de Figueiredo et al. 2022). The results of this study demonstrated a significant increase in NKX2-1 expression in nodular goiter tissues compared to their adjacent normal tissues.

Tissues samples

Each patient who was recommended for thyroid surgery at Al-Zahra and Sina hospitals in Isfahan was required to sign a consent form. According to the Helsinki protocol, ten fresh goiter tissues were collected over a period of eight months (ethical code IR.UI.REC.1398.058). There were initially twice as many participants as this, but they were later dropped from the study due to dissatisfaction. Fresh tissues were soaked in RNAlater fixation solution (Ambion Life Science Company, USA) as directed by the manufacturer. Incubated at 4°C for 24 hours, the tissues were removed from the RNAlater solution and RNA was extracted. The tissues were stored at -70°C for long-term storage. A checklist of sample entry and exit requirements was compared with each sample; if discrepancies were found, the desired sample was removed from the process. Indicators included the presence of excessive blood in the tissue, the presence of fat adjacent to the tissue, and the size of the excised tissue.

RNA extraction and cDNA synthesis

After RNAlater treatment, 50 ± 5 mg of the tissue were washed with a regular saline solution (0.85% NaCl). After being immersed in liquid nitrogen, the tissue was crushed in a mortar. The RNA was extracted with the extraction solution supplied by Biobasic Company (Bio Basic-Canada, lot: BS410A-N116DR0J). For evaluation of the quality of the extracted RNA, a 2% agarose gel was run. The purity of the RNA and the lack of protein contamination were determined by spectrophotometry (Nanodrop model OneC-USA). The remaining genomic DNA was eliminated using DNase treatment according to the manufacturer's instructions (Thermofisher-Germany-Lot: 00645766). cDNA was synthesized using random hexamers according to the manufacturer's instructions (Thermo Fisher Scientific, USA, Lot: 00645766).

Primer design

Beacon Designer 8 software was used to create the exon-junction primers (Premier Biosoft, USA). After examining primer dimer and dG binding as well as additional loop formation, Oligo7 software (Molecular Biology Insights, USA) was utilized to choose primers without secondary structures. A useful explanation of the primers used in the investigation is provided in Table 1. The GAPDH gene was chosen as a calibrator in order to standardize the data. To determine the melting temperature of the primers, a temperature gradient PCR was performed.

Table 1

A summary of the characteristics of the primers.
		Beacon designer scores			Oligo7 scores			Sequence	Primer length	Tm	Product size
Gene name	Refseq-ID	F	R	p	F	R	p
NKX2-1 (NG_013365.1)	NM_003317.4	66.6	55.9	66	741	948	671	F: 5’- CAGGACACCATGAGGAACAGCG − 3’ R:5’- GCCATGTTCTTGCTCACGTCCC G-3’	24bp	60°C	151bp
GAPDH (NG_007073.2)	NM_005228.5	73.6	81	82.5	913	814	769	F: 5’- CCACTCCTCCACCTTTGACG − 3’ R:5’- CCACCACCCTGTTGCTGTAG-3’	20bp	58°C	107bp
F: forward primer, R: reverse primer, P: PCR product

RT-qPCR

RT-qPCR was performed in a final volume of 12 µl using an Amplicon kit (SYBR Green RealQ Plus 2x Master Mix, Denmark, lot: A323402). Initial denaturation and enzyme activation were carried out at 95°C for 15 minutes. The first 40 cycles included primer extension at 72°C for 30 seconds, annealing at Tm temperature, and denaturation at 95°C. All reactions were done in triplicate using a negative control.

Melting curve analysis

By creating a melting curve with a starting point of 55°C, increasing by 1°C at each step, and reaching a maximum temperature of 95°C, the specificity of the RT-qPCR reaction was tested. A fluorescent change in the green channel was read and recorded for every degree the temperature was raised above the base level.

Statistical analysis

Using the t-test, the average expression of the NKX2-1 gene in goiter tissues and their adjacent normal tissues was compared. The relative expression of the NKX2-1 gene was compared using the Livak method.

The quality and quantity of extracted RNA

Using 2% agarose gels, RNA from both goiter tissues and healthy tissues was electrophoresed. The presence of ribosomal RNA bands demonstrated that the RNA was not damaged during the extraction process (Fig. 1). The absorbance ratios of 260 to 280 and 260 to 230 for all intact RNAs were in the range of 1.8 to 2.2. (data not shown). Excluded samples included those with absorbance ratios outside of the acceptable range and those without ribosomal RNA bands on the agarose gel.

Analysis of the melting curve

The peak at 83.5 ± 1°C matched a temperature range predicted by the bioinformatics method, confirming the precision of the RT-qPCR reaction and the specificity of the primers (Fig. 2). Primer dimers and non-specific products weren't present because there were no non-specific peaks.

Analysis of RT-qPCR data

The relative expression of the NKX2-1 gene in goiter tissues and their adjacent normal tissues is shown in Table 2. The NKX2-1 gene was significantly upregulated in goiter tissues compared to normal tissues (relative expression = 1.172, p = 0.04).

Table 2

Comparison of NKX2-1 gene expression between nodular goiter tissues and adjacent healthy tissues.
Gene name	Relative expression	p-value	Result
GAPDH	1	-
NKX2-1	1.172	0.04	Upregulation

The expression of the NKX2-1 gene is closely related to the production of follicles, the survival of the follicle cells precursors, and the expression of thyroid-specific genes in adulthood (Kusakabe et al. 2006a; Guan et al. 2021). Several studies have also demonstrated a connection between this gene and benign hereditary chorea, choreoathetosis, and congenital hypothyroidism of newborns (Krude et al. 2002; Ferrara et al. 2008; Narumi et al. 2010). Studies that have examined the role of NKX2-1 in oncogenesis have primarily focused on its role as a tumor suppressor. There is significant evidence that the SNP rs944289 in the NKX2-1 gene is associated with an increased risk of thyroid cancer (Ngan et al. 2009). NKX2-1 gene rearrangements with T cell receptor or immunoglobulin heavy-chain loci have been reported in T cell acute lymphoblastic leukemia recently (Homminga et al. 2011). It has therefore been found that the NKX2-1 gene is involved in the development of cancer in a mysterious way. As part of our previous investigation, we found that the relative expression level of the NKX2-1 gene did not differ significantly in papillary thyroid cancer (PTC), suggesting that there was no difference between the cancerous tissues and the nearby normal tissues (Mokhtari et al. 2022). According to the findings presented here, the expression level of the NKX2-1 gene increased significantly between nodular goiter tissues and their adjacent normal tissues. It is important to note that thyroid nodules present in late adulthood have an immense reservoir of possible cancerous lesions (Pellegriti et al. 2013). Consequently, it is speculated that the elevated level of NKX2-1 expression might be a defensive mechanism used by goiter cells to limit their aggressiveness and to prevent the development of cancer. Additionally, the nuclear localization of NKX2-1 gradually decreased in thyroid tumors that had undergone dedifferentiation (Zhang et al. 2006). A startling study found that, in addition to the loss of NKX2-1 expression in the majority of undifferentiated thyroid carcinomas, the expression of the gene decreases when thyroid adenomas turn into thyroid carcinomas (Nonaka et al. 2008). According to their findings, NKX2-1 was expressed in 100% of follicular adenomas, 67% of follicular carcinomas, 78% of PTC, and 0% of anaplastic carcinomas. An identical germline missense mutation in the NKX2-1 gene (A339V) has been associated with both multinodular goiter and PTC, suggesting that this gene has an oncogenic function in thyroid cells (Yamaguchi et al. 2013). Interestingly, mice with Nkx2-1 expression loss in many, but not all, thyroid follicles exhibited atrophic/degenerative thyroid follicles with adenomas often present (Kusakabe et al. 2006b). Taking all these factors into consideration, it appears that nodular goiter cells maintained a benign phenotype by maintaining an elevated level of NKX2-1 expression. When NKX2-1 is expressed, thyroid-specific genes, such as thyroglobulin, thyrotropin receptor, and PAX8, are transactivated. NKX2-1 expression is associated with increased cell proliferation, thyrotropin-independent growth, and enhanced activation of survival signaling molecules such as Stat3 and Akt (Kusakabe et al. 2006b). In essence, NKX2-1 is necessary for the maintenance of the normal architecture and function of differentiated thyroids.

Acknowledgements

Volunteers are thanked for their time and effort by the author. Funding for this study was provided by the Departments of Research, Technology, and Graduate Offices of the University of Isfahan, Iran. A sincere thank you is extended to Dr. Mohsen Kolahdouzan, thoracic surgeon, for his kindness, patience and responsibility in the acquisition of thyroid tissues. It is also appropriate to express gratitude to Dr. Keivan Shirneshan for approving the pathological results.

Contribution

S.-M.J.: Conceptualization, design, data analysis, interpretation, financial support, manuscript drafting, critical revision for critical intellectual contents, and final approval of the manuscript.

Ethics approval and consent to participate

All patients recommended for thyroid surgery at Al-Zahra and Sina hospitals in Isfahan had to sign a consent form. The acquisition of human tissues was approved by Isfahan University's institutional review board (IR.UI.REC.1398.058). All the experiments and procedures performed in this study specially but not limited to human participants were in accordance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Authors sincerely thank the volunteers for their participation.

Competing interests

The author declare no competing interests

Funding information

This study was conducted at Isfahan University of Iran and was supported financially by the Departments of Research, Technology and Graduate Offices (Grant number: A\10979\97).

Acebrón A, Aza-Blanc P, Rossi DL, et al (1995) Congenital human thyroglobulin defect due to low expression of the thyroid-specific transcription factor TTF-1. J Clin Invest 96:781–785. https://doi.org/10.1172/JCI118123
Chevillard S, Ugolin N, Vielh P, et al (2004) Gene expression profiling of differentiated thyroid neoplasms: Diagnostic and clinical implications. Clin Cancer Res 10:6586–6597. https://doi.org/10.1158/1078-0432.CCR-04-0053
de Figueiredo WLD, Lopes EF, Jezini DL, et al (2022) Differential gene expression profile of multinodular goiter. PLoS One 17:1–11. https://doi.org/10.1371/journal.pone.0268354
Ferrara AM, De Michele G, Salvatore E, et al (2008) A novel NKX2.1 mutation in a family with hypothyroidism and benign hereditary chorea. Thyroid 18:1005–1009. https://doi.org/10.1089/thy.2008.0085
Guan L, Zhao X, Tang L, et al (2021) Thyroid Transcription Factor-1: Structure, Expression, Function and Its Relationship with Disease. Biomed Res Int 2021:. https://doi.org/10.1155/2021/9957209
Guazzi S, Price M, De Felice M, et al (1990) Thyroid nuclear factor 1 (TTF-1) contains a homeodomain and displays a novel DNA binding specificity. EMBO J 9:3631–3639. https://doi.org/10.1002/j.1460-2075.1990.tb07574.x
Homminga I, Pieters R, Langerak AW, et al (2011) Integrated Transcript and Genome Analyses Reveal NKX2-1 and MEF2C as Potential Oncogenes in T Cell Acute Lymphoblastic Leukemia. Cancer Cell 19:484–497. https://doi.org/10.1016/j.ccr.2011.02.008
Kimura S, Hara Y, Pineau T, et al (1996) The T/ebp null mouse: Thyroid-specific enhancer-binding protein is essential for the organogenesis of the thyroid, lung, ventral forebrain, and pituitary. Genes Dev 10:60–69. https://doi.org/10.1101/gad.10.1.60
Krude H, Schütz B, Biebermann H, et al (2002) Choreoathetosis, hypothyroidism, and pulmonary alterations due to human NKX2-1 haploinsufficiency. J Clin Invest 109:475–480. https://doi.org/10.1172/jci14341
Kusakabe T, Kawaguchi A, Hoshi N, et al (2006a) Thyroid-specific enhancer-binding protein/NKX2.1 is required for the maintenance of ordered architecture and function of the differentiated thyroid. Mol Endocrinol 20:1796–1809. https://doi.org/10.1210/me.2005-0327
Kusakabe T, Kawaguchi A, Hoshi N, et al (2006b) Thyroid-specific enhancer-binding protein/NKX2.1 is required for the maintenance of ordered architecture and function of the differentiated thyroid. Mol Endocrinol 20:1796–1809. https://doi.org/10.1210/me.2005-0327
Landa I, Ibrahimpasic T, Boucai L, et al (2016) Genomic and transcriptomic hallmarks of poorly differentiated and anaplastic thyroid cancers. J Clin Invest 126:1052–1066. https://doi.org/10.1172/JCI85271
Moisés J, Navarro A, Santasusagna S, et al (2017) NKX2-1 expression as a prognostic marker in early-stage non-small-cell lung cancer. BMC Pulm Med 17:1–9. https://doi.org/10.1186/s12890-017-0542-z
Mokhtari M, Javadirad S-M, Kolahdouzan M (2022) Can use NKX2-1 Gene as Indicator of Differentiation of Papillary Thyroid Carcinoma? J gorgan Univ Med Sci 2022 Winter 23:33–39
Narumi S, Muroya K, Asakura Y, et al (2010) Transcription factor mutations and congenital hypothyroidism: Systematic genetic screening of a population-based cohort of Japanese patients. J Clin Endocrinol Metab 95:1981–1985. https://doi.org/10.1210/jc.2009-2373
Ngan ESW, Lang BHH, Liu T, et al (2009) A germline mutation (A339V) in thyroid transcription factor-1 (TITF-1/NKX2.1) in patients with multinodular goiter and papillary thyroid carcinoma. J Natl Cancer Inst 101:162–175. https://doi.org/10.1093/jnci/djn471
Nonaka D, Tang Y, Chiriboga L, et al (2008) Diagnostic utility of thyroid transcription factors Pax8 and TTF-2 (FoxE1) in thyroid epithelial neoplasms. Mod Pathol 21:192–200. https://doi.org/10.1038/modpathol.3801002
Pellegriti G, Frasca F, Regalbuto C, et al (2013) Worldwide increasing incidence of thyroid cancer: Update on epidemiology and risk factors. J Cancer Epidemiol 2013:. https://doi.org/10.1155/2013/965212
Smith JJ, Chen X, Schneider DF, et al (2013) Cancer after thyroidectomy: A multi-institutional experience with 1,523 patients. J Am Coll Surg 216:571–577. https://doi.org/10.1016/j.jamcollsurg.2012.12.022
Thorwarth A, Sarah SH, Schrumpf P, et al (2014) Comprehensive genotyping and clinical characterisation reveal 27 novel NKX2-1 mutations and expand the phenotypic spectrum. J Med Genet 51:375–387. https://doi.org/10.1136/jmedgenet-2013-102248
Yamaguchi T, Hosono Y, Yanagisawa K, Takahashi T (2013) NKX2-1/TTF-1: An Enigmatic Oncogene that Functions as a Double-Edged Sword for Cancer Cell Survival and Progression. Cancer Cell 23:718–723. https://doi.org/10.1016/j.ccr.2013.04.002
Zhang P, Zuo H, Nakamura Y, et al (2006) Immunohistochemical analysis of thyroid-specific transcription factors in thyroid tumors. Pathol Int 56:240–245. https://doi.org/10.1111/j.1440-1827.2006.01959.x

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

An investigation of the expression of the NKX2-1 gene in nodular goiter

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Subjects And Methods

Statistical analysis

Results

Discussion

Declarations

Acknowledgements

Contribution

Ethics approval and consent to participate

Competing interests

Funding information

References

Additional Declarations

Status:

Version 1