Anticancer effect of combinational therapy (sorafenib and anti-miR-222) on renal cell carcinoma cell lines: an invitro study

doi:10.21203/rs.3.rs-2622044/v1

Download PDF

Research Article

Anticancer effect of combinational therapy (sorafenib and anti-miR-222) on renal cell carcinoma cell lines: an invitro study

https://doi.org/10.21203/rs.3.rs-2622044/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Sorafenib chemotherapy drug can fight renal cell carcinoma (RCC) cells, the most common kidney cancer, by preventing cell migration and viability and stimulating apoptosis. In recent years, studies on combination therapies in cancer have increased due to greater effectiveness and prevention of drug resistance. In this study, we aimed to investigate the apoptotic and anti-metastatic effect of sorafenib and anti-miR-222 on RCC cell lines

Methods: 786-O and Caki-1 were used as RCC cell lines. Gene expression of PD-L1, Bim, miR-34a, miR-122, miR-513, and miR-570 were evaluated using quantitative real-time polymerase chain reaction(qRT-PCR) before and after sorafenib treatment. Changes in cell viability, apoptosis, and cell migration respectively were evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) test, flow cytometry, and scratch assay after treatment of 786-O and Caki-1 cell lines with sorafenib and anti-miR-222.

Results: Sorafenib led to increased expression of PD-L1, Bim, miR-34a, miR-122, miR-513, and miR-570genes in 786-O and Caki-1 cell lines. MTT assay results showed that cotreatment of 786-O and Caki-1 cell lines with sorafenib and anti-miR-222 solely and together decrease cell viability but combination therapies results were more significant. Also, the data of the apoptosis test showed an increased apoptosis rate in both 786-O and Caki-1 cell lines after treatment with sorafenib and anti-miR-222 solely and together but combination therapies results were more remarkable. The scratch test results also showed a decrease in cell migration in both cell lines in the treatment with sorafenib and anti-miR-222 solely and together after 24 and 48 hours but combination therapies results were more considerable.

Conclusion: Therefore, the present study shows a significant enhancement of the increase in apoptosis, as well as a significant decrease in cell migration and viability, after the use of sorafenib and anti-miR-222 at the same time. It seems that these results can contribute to the development of therapeutic strategies against RCC.

RCC

Sorafenib

Combination therapy

Apoptosis

Metastasis

Renal cell carcinoma (RCC) is the ninth most common neoplasm and is the most common kidney cancer with a high possibility of distant metastasis [1–3]. The most common type of RCC is clear cell RCC, more than two-thirds of RCCs are of this type [4]. Most cases of RCC are detected by chance in magnetic resonance imaging (MRI), computed tomography scan (CT scan), or Medical ultrasound [5]. As the deadliest urological cancer, RCC is more likely to occur in men and less likely to survive [1, 6, 7]. Obesity [8], smoking [9], high alcohol consumption [10], and poorly controlled high blood pressure increase the susceptibility to RCC [11].

Sorafenib is a chemotherapy drug from the group of oral-targeted multikinase inhibitors, and it is the first drug of this group that targets Raf protein kinase [12]. In addition to Raf, this drug targets other protein kinases in the signaling cascade, such as ERK, MEK, and Ras [13, 14]. Sorafenib can lead to increased apoptosis (such as stimulation of apoptosis through increased activating transcription factor 4) and decreased viability of RCC cells [15, 16]. Also, sorafenib combats tumorigenesis in RCC by inhibiting proliferation, migration, and angiogenesis in RCC cells, and by preventing tumor suppressor gene silencing, it can prevent tumor progression [17, 18]. This drug was approved by the food and drug administration (FDA) for the treatment of RCC in 2005, and in the following years, it was approved for hepatocellular carcinoma (HCC) and differentiated thyroid cancers (DTC) refractory to radioactive iodine (RaI) treatment, and it is still the first-line drug for the treatment of RCC [3, 17]. Due to the increasing resistance to drugs in patients with RCC and the increased survival of these patients treated with sorafenib, its combined treatment with other drugs such as immunotherapy drugs has been considered [3].

In all types of cancers, including RCC, we see an increase in the expression of programmed death-ligand 1 (PD-L1) protein, and as a result, there is a decrease in immunity against the tumor, because it causes programmed cell death 1 (PD-1) protein to bind to activated B and T cells, also, this increase in PD-L1 expression causes a higher nuclear grade and tumor necrosis [19–21]. PD-L1 can increase migration in RCC cells[22]. RCC cases with PD-L1 positive tumors have shorter survival than patients with tumors without PD-L1 expression [23, 24]. Intrinsic factors such as genetic and epigenetic alterations, external factors such as some tumor microenvironment cytokines (such as IFN-γ), metabolic factors such as glucose disorders, and treatment methods can lead to the upregulation of PD-L1 in RCC cases [25].

MicroRNAs (miRNAs) with a size of approximately 22 nucleotides are small non-coding RNAs, due to their important effects in regulating cellular functions and their effect on different aspects of carcinogenesis such as resistance to apoptosis and angiogenesis of tumor cells, recently the study of miRNAs has gained special importance as cancer biomarkers [26–30]. In RCC cases, there is a decrease in the expression of the Bim pro-apoptotic protein, and inhibition of its expression leads to a decrease in apoptosis sensitivity [31], also, miR-34a induces apoptosis in RCC cells and inhibits cell proliferation in these cells, miR-34a expression is decreased in RCC cells, however, positive and negative effects of miR-34a on RCC progression have been reported [32, 33]. miR-513 is a tumor suppressor in RCC and its expression is downregulated in these RCC cells [34], miR-570 is also known as a tumor inhibitor in cancers[35], for example, miR-570 in HCC cells leads to the weakening of angiogenesis and the reduction of immune escape, also, miR-570 reduces cell proliferation and invasion by targeting PD-L1, its expression increases in these cells[36, 37]. On the other hand, miR-122 enhances cell invasion, migration, and proliferation in RCC through the activation of the PI3K/Akt signaling pathway, and its expression is upregulated in RCC cells[38]. Also, miR-222 was discovered to induce cell growth and cycle progression via direct modulation of PTEN expression and is associated with renal cell carcinoma metastasis via the ERK pathway [39]. As a result misregulation of miRNAs expression is important in the process of carcinogenesis, including RCC, although some cancer treatment strategies such as chemotherapy also affect the expression of some miRNAs in cancer patients [40].

Therefore, in this study, changes in the amount of apoptosis, migration, and cell viability after using sorafenib, anti-miR-222, and combined treatment with both in RCC cells (786-O and Caki-1 cell lines) have been investigated. We also investigated the effect of sorafenib on the expression of PD-L1 and Bim, miR-34a, miR-122, miR-513, and miR-570 miRNAs in these two cell lines.

2.1. Cell culture

Purchased Caki-1 and 786-O cell lines (Pasteur Institute, Tehran, Iran) were cultured separately in RPMI1640 medium containing 10% FBS (Gibco, UK), 2 mM L-Glutamine (Gibco, UK), penicillin (100 Unit/ml) (Gibco, UK), and streptomycin (100 Unit/ml) (Gibco, UK), under sterile conditions at 37°C and 5% CO2.

2.2. Quantitative real-time polymerase chain reaction (qRT-PCR)

RNeasy Kits (Qiagen, UK) was used for the extraction of 786-o and Caki-1 cells total RNA. Complementary DNA (cDNA) synthesize was done using extracted RNA and QuantiTect reverse transcription kit (Qiagen, UK) after evaluation of RNA quality and quantity via 260/230 and 260/280 absorbance ratio by nanodrop spectrophotometer (Agilent Technologies, CA). Synthesized cDNAs were used to evaluate the expression level of PD-L1, Bim, miR-34a, miR-122, miR-513, and miR-570 genes, before and after treatment with sorafenib, with specific primers (Table 1).

Table 1

Required primer pairs sequences.
Gene	Primer	Sequence (5′→3′)
PDL-1	Forward Reverse	TGCCGACTACAAGCGAATTACTG CTGCTTGTCCAGATGACTTCGG
Bim	Forward Reverse	CAAGAGTTGCGGCGTATTGGAG ACACCAGGCGGACAATGTAACG
miR-34a	Forward Reverse	GGCAGTGTCTTAGCTGG GAACATGTCTGCGTATCTC
miR-122	Forward Reverse	GGAGTGTGACAATGGTG GAACATGTCTGCGTATCTC
miR-513	Forward Reverse	TTCACAGGGAGGTGTCA GAACATGTCTGCGTATCTC
miR-570	Forward Reverse	GAAAACAGCAATTACCTTTG GAACATGTCTGCGTATCTC
β-actin	Forward Reverse	CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT
U6	Forward Reverse	CTCGCTTCGGCAGCACAT TTTGCGTGTCATCCTTGCG
Abbreviations: PDL-1: Programmed cell death ligand 1; miRs: Micro RNAs.

A high-performance real-time PCR LightCycler® System (Roche, Germany) was applied to evaluate desired genes expression using the SYBER Green protocol. β-Actin was considered as normalizing internal control. The expression level of targeted genes was calculated based on the 2-△△CT formula using threshold cycle (Ct) values, and the validity of amplification was verified by electrophoresis of PCR products on 2% agarose gel.

2.3. Examination of cell viability by MTT test

Briefly, 2 × 10⁵ cells per well were cultured in a 96-well plate. The cells were treated with sorafenib, anti-miR-222, and sorafenib anti-miR-222 for 24 hours. Then, 0.1 ml of MTT (1 g/l, Sigma Aldrich, USA) was added into the treated and untreated wells and incubated for 4 hours at 37°C. After that, each well was encountered with 0.1 ml of DMSO to dissolve the purple formazan crystals and incubated at 25ºC for 30 min. Finally, a spectrophotometer was used to read the optical density at 540 nm wavelength. This procedure was done for both Caki-1 and 786-O cell lines.

2.4. Apoptosis investigation by flow cytometry

The amount of apoptosis was measured by propidium Iodide (PI)/Annexin V using flow cytometry analysis for both cell lines separately. For this purpose, after culturing the cells with different treatments which is mentioned in the previous section, cells were incubated with PI and Annexin V-FITC for 30 minutes in a dark condition at room temperature. Subsequently, 0.4 mL of binding buffer was added in order to count labeled cells by a FACS Calibur flow cytometer (BD Biosciences, USA).

2.5. Investigation of cell migration by scratch assay

786-O and Caki-1 cells were cultured in the culture medium at 37°C and 5% CO2 in 6-well culture plates and incubated for 24 hours. Cells of each cell line were treated with sorafenib, anti-miR-222, and simultaneously with both. Linear scratches were made with a micropipette tip after the cells reached 70% confluence. Then the transplanted cells were washed with PBS and the culture medium was changed. Finally, after 24 hours and 48 hours, the cell migration was checked by measuring the wound width and the results were read.

2.6. Statistical analysis

Data distribution was checked using Prism v8 software (Graph Pad). Mann Whitney test and Kruskal-Wallis followed by Dunn's multiple comparisons test were used for obtained data analysis. Two-sided P-values < 0.05 were considered statistically significant.

3.1. Evaluation of PD-L1 and miRNAs expression rate after treatment with sorafenib

After qRT-PCR in the 786-O cell line treated with sorafenib, significant increase was observed in the expression of PD-L1 (p = 0.0088), Bim (p = 0.0056), miR-34a (p = 0.0005), miR-122 (p = 0.0023), miR-513 (p = 0.0038), and miR-570 (p = 0.0087) (Fig. 1).

Also, qRT-PCR showed that the treatment of Caki-1 cells with sorafenib leads to increased expression of PD-L1 (p = 0.0147), Bim (p = 0.0092), miR-34a (p = 0.0008), miR-122 (p = 0.0039), miR-513 (p = 0.0006), and miR-570 (p = 0.0007) (Fig. 2).

3.2. Evaluation of cell viability rate after treatment with sorafenib and anti-miR-222

After performing the MTT test in 786-O and Caki-1 cell lines, a decrease in cell viability was observed after treatment with sorafenib (p = 0.0092 and p = 0.0254 for 786-O and Caki-1 cell lines, respectively) compared to untreated cells. Also, incubation of these cells with anti-miR-222 led to a slight decrease in cell viability in comparison with untreated cells. Combined treatment of these cells with sorafenib and anti-miR-222 caused to further decrease in these cells’ viability compared to untreated cells (p = 0.0044 and p = 0.0040 for 786-O and Caki-1 cell lines, respectively). Also, cell viability of both cell lines was significantly less in combination therapy condition compared to treatment with anti-miR-222 solely (p = 0.0277 and p = 0.0326 for 786-O and Caki-1 cell lines, respectively) (Fig. 3).

3.3. Evaluation of apoptosis rate after treatment with sorafenib and anti-miR-222

Flow cytometric analysis showed increased apoptosis in 786-O and Caki-1 cells after treatment with sorafenib compared to untreated cells (p = 0.0159 and p = 0.0244 for 786-O and Caki-1 cell lines, respectively). After simultaneous treatment with sorafenib and anti-miR-222, we observed a more significant increase in apoptosis in both cell lines in comparison with untreated condition (p = 0.0028 and p = 0.0044 for 786-O and Caki-1 cell lines, respectively). Also, the apoptosis rate of both cell lines was significantly more in combination therapy condition compared to treatment with anti-miR-222 solely (p = 0.0093 and p = 0.0337 for 786-O and Caki-1 cell lines, respectively) (Fig. 4).

3.4. Evaluation of migration rate after treatment with sorafenib and anti-miR-222

The results of the scratching assay showed that the simultaneous treatment of 786-O and Caki-1 cells with sorafenib and anti-miR-222 leads to significant prevention of cell migration after 24 hours (p = 0.0114 and p = 0.0091 for 786-O and Caki-1 cell lines, respectively), of course, in the treatment with only sorafenib, a decrease in cell migration was observed after 24 hours (p = 0.0352 and p = 0.0156 for 786-O and Caki-1 cell lines, respectively). Reduction of cell migration in these two cell lines occurred after a single treatment with anti-miR-222, which is minor compared to the simultaneous use of sorafenib and anti-miR-222, after 24 hours (p = 0.0446 and p = 0.0185 for 786-O and Caki-1 cell lines, respectively) (Fig. 5).

Also, the results of the scratching assay showed that the simultaneous treatment of 786-O and Caki-1 cells with sorafenib and anti-miR-222 leads to significant prevention of cell migration after 48 hours (p = 0.064 and p = 0.0009 for 786-O and Caki-1 cell lines, respectively), of course, in the treatment with only sorafenib, a decrease in cell migration was observed after 48 hours (p = 0.0398 and p = 0.0038 for 786-O and Caki-1 cell lines, respectively). Reduction of cell migration in these two cell lines occurred after a single treatment with anti-miR-222, which is minor compared to the simultaneous use of sorafenib and anti-miR-222, after 48 hours (p = 0.0246 and p = 0.0193 for 786-O and Caki-1 cell lines, respectively) (Fig. 5).

More than 90% of kidney cancers are RCC type and their incidence rate has been increasing in recent years [41, 42]. In 2020, 431288 cases of RCC and 179368 deaths from it were reported in Global Cancer Statistics, which shows the importance of this type of cancer, finding more details and new treatment strategies for it [43].

As a multikinase inhibitor, the sorafenib chemotherapy drug actively leads to an increase in apoptosis in RCC [16, 44]. Also, the treatment of RCC cells with sorafenib indicates a decrease in the viability of these cells and, as a result, a decrease in the proliferation of RCC cells [45, 46]. Sorafenib can inhibit the tumor by preventing cell migration and metastasis of RCC [18].

In RCC, the expression level of miR-222 is significantly higher compared to adjacent and healthy tissues, and it enhances cell migration and invasion in this disease. Also, miR-222 reduces the amount of apoptosis in RCC-related cell lines[47]. MiR-222 has similar effects on cell migration, invasion, and apoptosis in HCC cells. MiR-222 increases the resistance of HCC cells to sorafenib through the activation of the PI3K/Akt signaling pathway, and its inhibitors increase the antitumor effects of sorafenib in HCC-related cell lines[48]. The present study shows increased apoptosis, decreased migration, and cell viability in RCC cells after treatment with sorafenib. Also, the Inhibition of miR-222 expression in RCC cells leads to stimulation of apoptosis and has an inhibitory effect on cell viability and migration. Interestingly, the simultaneous effect of sorafenib and anti-miR-222 in these cells shows a significant decrease in cell migration and viability and a significant increase in apoptosis, which is probably the first time that their simultaneous effect has been investigated in RCC.

In the tumor microenvironment (TME) of patients with advanced HCC, the effect of sorafenib on PD-L1 expression is unclear [49], but Chen, Y., et al. reported increased PD-L1 expression in HCC cells in patients with recurrent tumors after treatment with sorafenib at low doses [50], like our study.

In the treatment of cancer, the most important issue is preventing the metastasis of cancer cells and inducing apoptosis of these cells in order to cleanse the body of cancer cells. Apoptosis of cancer cells can occur under the influence of specific treatment from internal or external pathways. Bim is one of the pro-apoptotic molecules, whose expression is greatly reduced in cancer cells [31]. Yuen, J., et al. showed that in the treatment with sorafenib, the expression of the pro-apoptotic protein Bim is increased in the RCC xenograft model in mice [16]. Also, sorafenib prevents the downregulation of Bim expression in acute myeloid leukemia (AML) cells [51]. According to our measurement, a significant increase in Bim expression is observed after treatment with sorafenib in RCC-related cell lines, which can be effective in increasing apoptosis in RCC through Bim.

Dysregulation of miR-34a expression has been observed in many tumors [52]. In HCC cells, miR-34a leads to decreased cell invasion and migration [53]. Apoptosis is also enhanced in HCC cells after treatment with sorafenib by miR-34a, which leads to the inhibition of B-cell lymphoma 2 (BCL-2) expression, also miR-34a increases the sensitivity of sorafenib through BCL-2 in these cells miR-34a can affect the process Treatment with sorafenib is effective [54–56]. Also, treatment with sorafenib in lung metastatic cells leads to increased miR-34a expression [57]. Our study confirmed previous studies about the effect of sorafenib on miR-34a expression in RCC-related cell lines.

miR-122 has been considered a biomarker for various types of hepatic conditions. Changing the blood level of miR-122 may aware to liver transplantation rejection, alcohol, viral infection, and liver injury due to chemicals [30]. Like our study, miR-122 increases the growth inhibition caused by sorafenib in HCC and increases the sensitivity of sorafenib in these cells, also its expression increases after treatment with sorafenib [58, 59].

miR-513 and miR-570 known as anti-tumor miRs by inhibiting cell proliferation, angiogenesis, cancer cell invasion, immune escape, and enhancing cancer cell apoptosis via different routes [60–64]. Since there are few studies on the effect of sorafenib on the expression of miR-513 and miR-570 in different types of cancers, Therefore, in the present study, we showed the stimulatory effect of sorafenib chemotherapy drug on the expression of miR-513 and miR-570 in RCC cells.

Combination therapy is one of available approaches in order to prevail drug resistance in cancer treatment. The evidence obtained from our study showed that sorafenib can increase pro-apoptotic and anti-metastatic genes and miRs in RCC cell lines, but the combination of this drug with anti-miR-222 could overcome increased PD-L1 expression and its pro-metastatic effects due to sorafenib treatment. These results can suggest new combined treatment strategies in the future. More targeted studies especially in RCC animal models are needed about the exact effect of combination therapy of sorafenib and anti-miR-222 in this regard.

Ethical Approval

Not applicable.

Competing interests

The authors declare that they have no conflicts of interest.

Authors' contributions

Masoud Delashoub conceived and designed the experiments and contributed to the preparation of materials; Erfan Komijani performed the experiments and wrote the paper. All authors reviewed the manuscript.

Funding

None.

Availability of data and materials

The datasets used during the present study are available from the corresponding author upon reasonable request.

Padala, S.A., et al., Epidemiology of renal cell carcinoma. World journal of oncology, 2020. 11(3): p. 79.
Díaz-Montero, C.M., B.I. Rini, and J.H. Finke, The immunology of renal cell carcinoma. Nature Reviews Nephrology, 2020. 16(12): p. 721–735.
He, Y., et al., New frontiers against sorafenib resistance in renal cell carcinoma: from molecular mechanisms to predictive biomarkers. Pharmacological Research, 2021. 170: p. 105732.
Chevrier, S., et al., An immune atlas of clear cell renal cell carcinoma. Cell, 2017. 169(4): p. 736–749. e18.
DeCastro, G.J. and J.M. McKiernan, Epidemiology, clinical staging, and presentation of renal cell carcinoma. Urologic Clinics of North America, 2008. 35(4): p. 581–592.
Bray, F., et al., Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians, 2018. 68(6): p. 394–424.
Howlader, N., et al., SEER cancer statistics review, 1975–2016. National Cancer Institute, 2019. 1.
Macleod, L.C., et al., Risk factors for renal cell carcinoma in the VITAL study. The Journal of urology, 2013. 190(5): p. 1657–1661.
Tsivian, M., et al., Cigarette smoking is associated with advanced renal cell carcinoma. Journal of clinical oncology, 2011. 29(15): p. 2027–2031.
Lew, J.Q., et al., Alcohol consumption and risk of renal cell cancer: the NIH-AARP diet and health study. British journal of cancer, 2011. 104(3): p. 537–541.
Colt, J.S., et al., Hypertension and risk of renal cell carcinoma among white and black Americans. Epidemiology (Cambridge, Mass.), 2011. 22(6): p. 797.
Wilhelm, S., et al., Discovery and development of sorafenib: a multikinase inhibitor for treating cancer. Nature reviews Drug discovery, 2006. 5(10): p. 835–844.
Salvatore, G., et al., BRAF is a therapeutic target in aggressive thyroid carcinoma. Clinical Cancer Research, 2006. 12(5): p. 1623–1629.
Wilhelm, S.M., et al., BAY 43-9006 exhibits broad spectrum oral antitumor activity and targets the RAF/MEK/ERK pathway and receptor tyrosine kinases involved in tumor progression and angiogenesis. Cancer research, 2004. 64(19): p. 7099–7109.
Wang, Q., et al., Sorafenib induces renal cell carcinoma apoptosis via upregulating activating transcription factor 4. Die Pharmazie-An International Journal of Pharmaceutical Sciences, 2018. 73(3): p. 156–160.
Yuen, J., et al., Inhibition of angiogenic and non-angiogenic targets by sorafenib in renal cell carcinoma (RCC) in a RCC xenograft model. British journal of cancer, 2011. 104(6): p. 941–947.
Escudier, B., F. Worden, and M. Kudo, Sorafenib: key lessons from over 10 years of experience. Expert Review of Anticancer Therapy, 2019. 19(2): p. 177–189.
Huang, S., et al., The transcription factor creb is involved in sorafenib-inhibited renal cancer cell proliferation, migration and invasion. Acta Pharmaceutica, 2018. 68(4): p. 497–506.
Joseph, R.W., et al., PD-1 and PD-L1 Expression in Renal Cell Carcinoma with Sarcomatoid DifferentiationPD-1 and PD-L1 in RCC with Sarcomatoid Differentiation. Cancer immunology research, 2015. 3(12): p. 1303–1307.
Weinstock, M. and D. McDermott, Targeting PD-1/PD-L1 in the treatment of metastatic renal cell carcinoma. Therapeutic advances in urology, 2015. 7(6): p. 365–377.
Carlsson, J., et al., PD-L1 expression is associated with poor prognosis in renal cell carcinoma. Applied Immunohistochemistry & Molecular Morphology, 2020. 28(3): p. 213–220.
Wang, Y., et al., PD-L1 induces epithelial-to-mesenchymal transition via activating SREBP-1c in renal cell carcinoma. Medical oncology, 2015. 32(8): p. 1–7.
Shin, S.-J., et al., Clinicopathologic analysis of PD-L1 and PD-L2 expression in renal cell carcinoma: association with oncogenic proteins status. Annals of surgical oncology, 2016. 23(2): p. 694–702.
Choueiri, T., et al., PD-L1 expression in nonclear-cell renal cell carcinoma. Annals of oncology, 2014. 25(11): p. 2178–2184.
Ding, L., et al., PD-1/PD‐L1 inhibitors‐based treatment for advanced renal cell carcinoma: Mechanisms affecting efficacy and combination therapies. Cancer Medicine, 2021. 10(18): p. 6384–6401.
Russo, F., et al., MicroRNAs, regulatory networks, and comorbidities: decoding complex systems, in MicroRNA Detection and Target Identification. 2017, Springer. p. 281–295.
Peng, Y. and C.M. Croce, The role of MicroRNAs in human cancer. Signal transduction and targeted therapy, 2016. 1(1): p. 1–9.
Gao, Y., et al., MicroRNAs as potential diagnostic biomarkers in renal cell carcinoma. Tumor Biology, 2014. 35(11): p. 11041–11050.
Majidi Zolbanin, N., et al., Targeted Co-Delivery of Docetaxel and cMET siRNA for Treatment of Mucin1 Overexpressing Breast Cancer Cells. Adv Pharm Bull, 2018. 8(3): p. 383–393.
Dirksen, K., et al., Hepatocyte-derived microRNAs as sensitive serum biomarkers of hepatocellular injury in Labrador retrievers. Vet J, 2016. 211: p. 75–81.
Zantl, N., et al., Frequent loss of expression of the pro-apoptotic protein Bim in renal cell carcinoma: evidence for contribution to apoptosis resistance. Oncogene, 2007. 26(49): p. 7038–7048.
Zhang, C., et al., Tumor suppressor microRNA‑34a inhibits cell proliferation by targeting Notch1 in renal cell carcinoma. Oncology Letters, 2014. 7(5): p. 1689–1694.
Yamamura, S., et al., MicroRNA-34a suppresses malignant transformation by targeting c-Myc transcriptional complexes in human renal cell carcinoma. Carcinogenesis, 2012. 33(2): p. 294–300.
Li, J., et al., Circular RNA MYLK promotes tumour growth and metastasis via modulating miR-513a‐5p/VEGFC signalling in renal cell carcinoma. Journal of cellular and molecular medicine, 2020. 24(12): p. 6609–6621.
Wang, L.L., et al., Protective effect of hsa-miR‐570‐3p targeting CD274 on triple negative breast cancer by blocking PI3K/AKT/mTOR signaling pathway. The Kaohsiung Journal of Medical Sciences, 2020. 36(8): p. 581–591.
Lin, Y., et al., miR-570 inhibits proliferation, angiogenesis, and immune escape of hepatocellular carcinoma. Cancer Biotherapy and Radiopharmaceuticals, 2018. 33(6): p. 252–257.
Guo, W., et al., MiR-570 inhibited the cell proliferation and invasion through directly targeting B7-H1 in hepatocellular carcinoma. Tumor Biology, 2015. 36(11): p. 9049–9057.
Lian, J.-H., et al., MicroRNA-122 promotes proliferation, invasion and migration of renal cell carcinoma cells through the PI3K/Akt signaling pathway. Asian Pacific Journal of Cancer Prevention, 2013. 14(9): p. 5017–5021.
Lyu, J., Y. Zhu, and Q. Zhang, An increased level of MiR-222-3p is associated with TMP2 suppression, ERK activation and is associated with metastasis and a poor prognosis in renal clear cell carcinoma. Cancer Biomark, 2020. 28(2): p. 141–149.
Ghafouri-Fard, S., et al., MicroRNA signature in renal cell carcinoma. Frontiers in oncology, 2020. 10: p. 596359.
Hsieh, J., M. Purdue, and S. Signoretti, Swanton c, albiges l, Schmidinger M, Heng dY, larkin J and Ficarra V: renal cell carcinoma. Nat Rev dis Primers, 2017. 3: p. 17009.
Ljungberg, B., et al., The epidemiology of renal cell carcinoma. European urology, 2011. 60(4): p. 615–621.
Bahadoram, S., et al., Renal cell carcinoma: An overview of the epidemiology, diagnosis, and treatment. G Ital. Nefrol, 2022. 39.
Chang, Y.S., et al., Sorafenib (BAY 43-9006) inhibits tumor growth and vascularization and induces tumor apoptosis and hypoxia in RCC xenograft models. Cancer chemotherapy and pharmacology, 2007. 59(5): p. 561–574.
Serrano-Oviedo, L., et al., Autophagic cell death associated to Sorafenib in renal cell carcinoma is mediated through Akt inhibition in an ERK1/2 independent fashion. PLoS One, 2018. 13(7): p. e0200878.
Liu, L., et al., Long non-coding RNA GAS5 sensitizes renal cell carcinoma to sorafenib via miR-21/SOX5 pathway. Cell cycle, 2019. 18(3): p. 257–263.
Lyu, J., Y. Zhu, and Q. Zhang, An increased level of MiR-222-3p is associated with TMP2 suppression, ERK activation and is associated with metastasis and a poor prognosis in renal clear cell carcinoma. Cancer Biomarkers, 2020. 28(2): p. 141–149.
Liu, K., et al., miR‑222 regulates sorafenib resistance and enhance tumorigenicity in hepatocellular carcinoma Retraction in/10.3892/ijo. 2021.5280. International journal of oncology, 2014. 45(4): p. 1537–1546.
Lu, L.-C., et al., Increased expression of programmed death-ligand 1 in infiltrating immune cells in hepatocellular carcinoma tissues after sorafenib treatment. Liver Cancer, 2019. 8(2): p. 110–120.
Chen, Y., et al., Overcoming sorafenib evasion in hepatocellular carcinoma using CXCR4-targeted nanoparticles to co-deliver MEK-inhibitors. Scientific reports, 2017. 7(1): p. 1–12.
Mori, S., et al., Potential role of sorafenib in the treatment of acute myeloid leukemia. Leukemia & lymphoma, 2008. 49(12): p. 2246–2255.
Kong, J. and W. Wang, A systemic review on the regulatory roles of miR-34a in gastrointestinal cancer. OncoTargets and therapy, 2020. 13: p. 2855.
Li, N., et al., miR-34a inhibits migration and invasion by down-regulation of c-Met expression in human hepatocellular carcinoma cells. Cancer letters, 2009. 275(1): p. 44–53.
Zhang, G., et al., miR-27b and miR-34a enhance docetaxel sensitivity of prostate cancer cells through inhibiting epithelial-to-mesenchymal transition by targeting ZEB1. Biomedicine & Pharmacotherapy, 2018. 97: p. 736–744.
Yang, H.-L., et al., Antrodia camphorata induces G 1 cell-cycle arrest in human premyelocytic leukemia (HL-60) cells and suppresses tumor growth in athymic nude mice. Food & function, 2014. 5(9): p. 2278–2288.
Zhao, J., K. Kelnar, and A.G. Bader, In-depth analysis shows synergy between erlotinib and miR-34a. PloS one, 2014. 9(2): p. e89105.
Shi, Y. and A. Huang, Effects of sorafenib on lung metastasis in rats with hepatocellular carcinoma: the role of microRNAs. Tumor Biology, 2015. 36(11): p. 8455–8463.
Bai, S., et al., MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. Journal of Biological Chemistry, 2009. 284(46): p. 32015–32027.
Turato, C., et al., MiR-122 targets SerpinB3 and is involved in sorafenib resistance in hepatocellular carcinoma. Journal of clinical medicine, 2019. 8(2): p. 171.
Jiang, G., et al., Positive correlation between miR-570 and prognosis of colon cancer: inhibition of cell proliferation and invasion. Clin Exp Med, 2022. 22(2): p. 193–200.
Dong, P., et al., miR-34a, miR-424 and miR-513 inhibit MMSET expression to repress endometrial cancer cell invasion and sphere formation. Oncotarget, 2018. 9(33): p. 23253–23263.
Yan, H., et al., LncRNA FLVCR1-AS1 mediates miR-513/YAP1 signaling to promote cell progression, migration, invasion and EMT process in ovarian cancer. Journal of Experimental & Clinical Cancer Research, 2019. 38(1): p. 356.
Okusha, Y., et al., MicroRNA-570 targets the HSP chaperone network, increases proteotoxic stress and inhibits mammary tumor cell migration. Scientific Reports, 2022. 12(1): p. 15582.
Bao, X., et al., Inhibition of LCMR1 and ATG12 by demethylation-activated miR-570-3p is involved in the anti-metastasis effects of metformin on human osteosarcoma. Cell Death & Disease, 2018. 9(6): p. 611.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Anticancer effect of combinational therapy (sorafenib and anti-miR-222) on renal cell carcinoma cell lines: an invitro study

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Cell culture

2.2. Quantitative real-time polymerase chain reaction (qRT-PCR)

2.3. Examination of cell viability by MTT test

2.4. Apoptosis investigation by flow cytometry

2.5. Investigation of cell migration by scratch assay

2.6. Statistical analysis

3. Results

3.1. Evaluation of PD-L1 and miRNAs expression rate after treatment with sorafenib

3.2. Evaluation of cell viability rate after treatment with sorafenib and anti-miR-222

3.3. Evaluation of apoptosis rate after treatment with sorafenib and anti-miR-222

3.4. Evaluation of migration rate after treatment with sorafenib and anti-miR-222

4. Discussion

5. Conclusions

Declarations

References

Additional Declarations

Status:

Version 1