Microglia-derived exosomal miR-302a-3p suppresses ferroptosis to alleviate cerebral ischemia/reperfusion injury by inhibiting neuronal ferritinophagy via regulating the Keap1/Nrf2 axis Running title: The effect of BV2-Exo on cerebral I/R injury

doi:10.21203/rs.3.rs-2625184/v1

Download PDF

Research Article

Microglia-derived exosomal miR-302a-3p suppresses ferroptosis to alleviate cerebral ischemia/reperfusion injury by inhibiting neuronal ferritinophagy via regulating the Keap1/Nrf2 axis Running title: The effect of BV2-Exo on cerebral I/R injury

https://doi.org/10.21203/rs.3.rs-2625184/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Recently, the protective effect of exosomes on ischemia/reperfusion (I/R) injury has become a research hotspot. The purpose of this study was to explore the therapeutic potential of microglia-derived exosomes on cerebral I/R injury. BV2 cell-derived exosomes (BV2-Exo) were extracted and characterized. The cerebral I/R model was constructed in vivo and intervened by using exosomes loaded with miR-302a-3p. The oxygen and glucose deprivation (OGD) model was constructed in vitro to simulate cerebral I/R injury. The binding sites of miR-302a-3p to Keap1 were analyzed by bioinformatics prediction and confirmed by dual-luciferase reporter assay. A study of whether exosomal miR-302a-3p affected cerebral I/R injury via the Keap1/Nrf2 axis was carried out by overexpression of keap1 (oe-keap1). Experimental results in vivo showed exosomal miR-302a-3p significantly repaired the cognitive impairment and suppressed the cell death of hippocampal neurons induced by cerebral I/R injury. Besides, exosomal miR-302a-3p inhibited the expression of ferroptosis-related proteins NCOA4, PTGS2, and p53 in cerebral I/R-treated mice. Bioinformatics prediction and double-luciferase reporter assay showed that Keap1 was the direct downstream target of miR-302a-3p. Experiment results in vitro showed that oe-Keap1 reversed the therapeutic effect of exosomal miR-302a-3p on cerebral I/R injury via the Keap1/Nrf2 axis, promoting the high expression of NCOA4, PTGS2, and p53 and the increase of Fe²⁺, MDA and ROS levels. These results demonstrated that microglia-exosomal miR-302a-3p suppressed ferroptosis to alleviate cerebral I/R injury by inhibiting neuronal ferritinophagy via regulating the Keap1/Nrf2 axis.

microglia-derived exosomes

miR-302a-3p

Keap1/Nrf2 axis

cerebral ischemia/reperfusion injury

ferroptosis

Ischemic stroke is still a major cause of high disability and mortality worldwide (Miller and Merck 2017). Blockage of a brain artery accounts for 87% of cerebral ischemia cases (Benjamin et al. 2019). With the progress of intravenous thrombolysis and mechanical thrombectomy technology, the recanalization rate of acute intracranial large vessel occlusion is significantly higher than before (Suzuki et al. 2021; Kleindorfer et al. 2021). However, cerebral ischemia/reperfusion (I/R) injury is also a problem that cannot be ignored, which will reduce the benefit of patients after recanalization (Wang and Zheng 2020). Unfortunately, many therapeutic candidates have been developed for the treatment of cerebral I/R injury, with efficacy in preclinical data, but few have shown efficacy in humans (Zhang et al. 2015). Thus, new and potential therapeutic targets for cerebral I/R injury are required.

Exosomes are able to transport proteins, lipids, DNA, mRNA, and noncoding RNAs such as microRNAs (miRNAs) (Dou and Ren 2020), thus bestowing the capacity to modify the behavior of the recipient cells in healthy and diseased conditions (Budnik et al. 2016). Microglia, resident immune cells, play an essential role in maintaining homeostasis in the central nervous system (Li and Barres 2018). The role of exosomes from microglia after ischemic insult has been scarcely studied (Osier et al. 2018). As functional RNA molecules, miRNAs can participate in many physiological and pathological processes (Blenkiron et al. 2014; Bartel 2018). Previous studies have demonstrated that miR-302 can protect mice from traumatic brain injury and cognitive impairment (Chen et al. 2019). Moreover, miR-302 can inhibit cell death by inhibiting ROS production induced by oxidants, and its regulation may be a strategy to prevent ischemic tissue damage(Kim et al. 2014). Therefore, miR-302a-3p may represent a promising therapeutic target for cerebral I/R injury.

Ferroptosis, a new kind of programmed cell death, is dependent on iron and reactive oxygen species (ROS) (Dixon et al. 2012), which is considered to be the main reason for I/R injury (Stockwell et al. 2017). Recent studies have investigated the relationship between ferroptosis and I/R injury and found that some ferroptosis inhibitors efficiently alleviated I/R injury in different organs (Li et al. 2021b). Therefore, ferroptosis inhibition may become a useful treatment strategy for cerebral I/R injury. Some studies have shown that the Keap1/Nrf2 pathway is the main factor in protecting cells from oxidative damage caused by ferroptosis (Sun and Ou 2016; Liu and Ye 2016). Scavenging oxidative compounds, eliminating free radicals generated by excess iron, activating the Keap1/Nrf2 pathway, and enhancing Nrf2 accumulation may provide a protective process from ferroptosis in cerebral injury (Chang and Cho 2014). In studies on I/R injury, the regulation of miR-139-5p or miR-24-3p to the Keap1/Nrf2 axis has been reported (Yao et al. 2022b; Xiao et al. 2018). In addition, miR-302 was found to improve neurodegenerative diseases by promoting Nrf2 expression(Li et al. 2016). In cell oxidative damage, the effect of miR-302 on the Nrf2-Keap1 system has been studied(Kim et al. 2014). However, there is no report about the regulatory relationship between miR-302a-3p and Keap1/Nrf2 axis in cerebral I/R injury.

Based on the above, we constructed the cerebral I/R mouse model and the oxygen and glucose deprivation (OGD) cell model to explore whether miR-302a-3p in microglia-derived exosomes alleviated cerebral I/R injury via regulating the Keap1/Nrf2 axis.

2.1 Cell culture

The mouse microglia cell line (BV2) was bought from Abiowell (AW-CNM081, China). Hippocampal neurons were isolated from normal mice in this experiment. BV2 cells and hippocampal neurons were cultured in DMEM (R8758, Sigma, USA), containing 1% Penicillin/Streptomycin (SV30010, Beyotime, China) and 10% fetal bovine serum (FBS) (10099141, Gibco, USA), and then placed in a humidified incubator (DH-160I, SANTN, China) containing 5% CO₂ at 37℃. When the cell confluence reached 70%-80%, trypsin digestion, passage, and transfection experiments were carried out. mimic NC, miR-302a-3p mimic, oe-NC, and oe-Keap1 were obtained from HonorGene. mimic NC and miR-302a-3p mimic were transfected into BV2 cells while oe-NC, and oe-Keap1 were transfected into hippocampal neurons using lipofectamine 2000 (11668019, Invitrogen, USA) reagent.

2.2 Extraction and identification of BV2-Exo

BV2-Exo extraction was performed using an ExoQuick-TC PLUS™ exosomes extraction kit (#WQPL10TC-1, SBI, Japan). For the identification of BV2-Exo, the morphology of BV2-Exo was observed by transmission electron microscopy (TEM) at 100 kV (HT7700, Hitachi High-technologies, Japan). TEM images were taken by CCD camera (MORADA G3, EMSIS GMBH, USA) and quantified using Image J software (National Institutes of Health, USA). The concentration and size of BV2-Exo were measured by nanoparticle tracking analysis (NTA) (ZetaView PMX 110, Particle Matrix, Germany). The expression levels of Calnexin, Alix, CD9, CD63, and CD81 in BV2 and BV2-Exo were analyzed by Western blot. RT-qPCR was utilized to quantify miR-302a-3p expression in BV2 and BV2-Exo.

2.3 Construction of OGD model and intervention

After the normal mice were sacrificed by cervical dislocation, the hippocampus was taken out under sterile conditions and washed with PBS. The hippocampus was digested with trypsin (AWC0232, Abiowell, China) and then counted the hippocampal neurons. 2×10⁵ cells were inoculated in a 24-well culture plate and placed in a humidified incubator containing 5% CO₂ at 37℃. For the construction of the OGD model, the hippocampal neurons were placed in a sealed chamber containing a gas mixture (95% N₂, 5% CO₂). After treatment with oxygen and glucose deprivation for 3 h, cells were allowed to recover in a humidified incubator containing 5% CO₂ at 37℃ for 12 h.

The different interventions of hippocampal neurons were as follows. The hippocampal neurons in the Control group were cultured normally. The hippocampal neurons in the OGD group were subjected to OGD treatment. The hippocampal neurons in the Exo group were subjected to OGD treatment and cocultured with BV2-Exo. The hippocampal neurons in the Exo-mimic NC group were subjected to OGD treatment and cocultured with exosomes secreted from mimic NC-transfected BV2. The hippocampal neurons in the Exo-miR-302a-3p mimic group were subjected to OGD treatment and cocultured with exosomes secreted from miR-302a-3p mimic-transfected BV2. The hippocampal neurons in the Exo-mimic NC + oe-NC group were transfected with oe-NC and subjected to OGD treatment and cocultured with exosomes secreted from mimic NC-transfected BV2. The hippocampal neurons in the Exo-miR-302a-3p mimic + oe-Keap1 group were transfected with oe-Keap1 and subjected to OGD treatment and cocultured with exosomes secreted from miR-302a-3p mimic-transfected BV2.

2.4 Construction of cerebral I/R model and intervention

C57BL/6 adult male mice (6–8 weeks, 18–20 g) were bought from Hunan SJA Laboratory Animal Co., Ltd. The mice were raised in separate cages, with 4 in each one. The experiment of constructing a cerebral I/R model was carried out after one week of adaptive feeding. G*Power software 3.1.9.2 (Heinrich-Heine-Universität Düsseldorf, Germany) was applied to calculate the minimum number of effective results in animal experiments. The results showed that the sample size should be at least 6, so each group in this study included 8 mice. Mice were anesthetized with 4% isoflurane, and the left common carotid artery (CCA), internal carotid artery (ICA), and external carotid artery (ECA) were exposed and isolated. A monofilament (1620A4, Beijing Cinontech Co.Ltd., China) with a diameter of 0.16 mm was inserted into ICA and pushed 7–8 mm to block the middle cerebral artery (MCA) blood flow. After 60 min of vascular occlusion, the monofilament was withdrawn to achieve ICA blood reperfusion. For the Sham + vehicle group, mice received the same surgical protocol, but no monofilament was implanted. Buprenorphine (0.03 mg/kg) was given every 12 h within 24 h after the operation to treat pain.

The different interventions of mice for 3 consecutive days were as follows. The mice in the Sham + vehicle group accepted sham surgery and injection of saline (200 µg) through the tail vein. The mice in the I/R group accepted cerebral I/R and injection of saline (200 µg) through the tail vein. The mice in the EV-NC group accepted cerebral I/R and injection of exosomes secreted from mimic NC-transfected BV2 (200 µg) through the tail vein. The mice in the EV-miR-302a-3p group accepted cerebral I/R and injection of exosomes secreted from miR-302a-3p mimic-transfected BV2 (200 µg) through the tail vein. All procedures were approved by the ethics of Affiliated Haikou Hospital of Xiangya School of Central South.

2.5 Behavioral test

The morris water maze test was conducted on day 3 after the operation, and the escape latency (s), time spent in finding the platform (s), and the number of errors of mice were recorded. The modified neurological severity score (mNSS) experiment was conducted on day 7 after the operation, including a series of comprehensive tests to evaluate the motion, sense, and reflex abilities. Failure to perform a specific task or no test reflection resulted in 1 point. Therefore, higher scores indicated more severe brain injury. After the behavioral test, all mice were sacrificed by cervical dislocation to collect their brains. In each group, 2 brains were used for TTC staining, and the remaining 6 were used for other analyses. Hippocampal tissues were aseptically dissected, embedded with paraffin, and sliced for subsequent experiments.

2.6 Western blot

The samples were treated with RIPA lysate (AWB0136, Abiowell, China) and mixed with protease inhibitors (AWH0645, Abiowell, China) and phosphatase inhibitors (AWH0650, Abiowell, China) to extract proteins. After electrophoretic separation, the protein was transferred to the membrane. After being blocked with 5% skimmed milk for 1.5 h, the membrane was incubated with the corresponding antibody overnight at 4℃, which were Alix (1:8000, 12422-1-AP, Proteintech, USA), CD63 (1:10000, 67605-1-IG, Proteintech, USA), Calnexin (1:50000, 10427-2-AP, Proteintech, USA), CD9 (1:3000, 20597-1-AP, Proteintech, USA), CD81 (1:2000, 27855-1-AP, Proteintech, USA), NCOA4 (1:1000, ab86707, Abcam, UK), ferritin light polypeptide (FTL, 1:10000, 68068-1-Ig, Proteintech, USA), ferritin heavy polypeptide 1 (FTH1, 1:1000, ab183781, Abcam, UK), p53 (1:5000, 60283-2-IG, Proteintech, USA), PTGS2 (1:1000, 27308-1-AP, Proteintech, USA), SLC7A11 (1:1000, 26864-1-AP, Proteintech, USA), GPX4 (1:5000, 67763-1-Ig, Proteintech, USA), Keap1 (1:2000, 60027-1-Ig, Proteintech, USA), Nrf2 (1:2500, 80593-1-RR, Proteintech, USA), and β-actin (1:5000, 66009-1-Ig, Proteintech, USA). Subsequently, the membrane was incubated with HRP goat anti-mouse IgG (1:5000, SA00001-1, Proteintech, USA) and HRP goat anti-rabbit IgG (1:6000, SA00001-2, Proteintech, USA) for 1.5 h. Finally, the ECL reagent (AWB0005, Abiowell, China) was used for chemiluminescence detection. Quantity One 4.6.6 (Bio-Rad Inc., USA) was employed to obtain the gray values of bands, and the expression level of each protein was calculated with β-actin being an internal reference. All original band images were shown in Supplementary Fig. 1.

2.7 Quantitative real-time polymerase chain reaction (RT-qPCR)

The total RNA in samples was extracted using the Trizol total RNA extraction kit (15596026, Thermo, USA). miRNAs and mRNAs were reverse transcribed into cDNA using a miRNA reverse transcription kit (CW2141, CWBIO, China) and mRNA reverse transcription kit (CW2569, CWBIO, China). With U6 and β-actin being the internal reference, the reaction primers were as shown in Table 1. RT-qPCR was performed with cDNA as a template followed by the calculation of expression levels by the 2^−△△Ct method.

Table 1

Sequences of the primers.
Gene name	Forward (5’-3’)	Reverse (5’-3’)
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
miR-302a-3p	CACTTAAACGTGGTTGTACTTGC	CCATCACCAAAACATGGAAGCA
β-actin	ACATCCGTAAAGACCTCTATGCC	TACTCCTGCTTGCTGATCCAC
p53	CAGCCCCCTCTCTGAGTAGT	ACCCTATGAGGGCCCAAGAT
PTGS2	AATACTGGAAGCCGAGCACCT	ACACCCCTTCACATTATTGCAGA
SLC7A11	CATACTCCAGAACACGGGCAG	AACAAAAGCCAGCAAAGGACCA
Keap1	GCCCCGGGACTCTTATTGTG	TTTGCCCTAAGCTCATCTCGT
Nrf2	GCTCCTATGCGTGAATCCCAA	TTTGCCCTAAGCTCATCTCGT

2.8 2,3,5-Triphenyltetrazolium chloride (TTC) staining

The brain tissue was cut into 5 pieces from the coronal plane, and each piece was about 2 mm thick. Brain slices were treated with TTC solution at 37℃ for 10 min. TTC was able to react with dehydrogenases in brain tissue. The dehydrogenase activity in normal brain tissue was high and stained red, while it decreased in ischemic and stained white. The slices were fixed with 4% paraformaldehyde and photographed for observation.

2.9 Hematoxylin-eosin (HE) staining

The slices were placed in xylene for 20 min to dewax and followed by gradient ethanol dehydration (75–100%). The slices were stained with hematoxylin (AWI0001a, Abiowell, China) for 1–10 min and returned to blue with PBS. The slices were stained with eosin (AWI0029a, Abiowell, China) for 1–5 min, rinsed with distilled water, and then dehydrated with gradient ethanol (95–100%). The slices were placed in xylene for 10 min for transparency and then sealed with neutral gum (AWI0238a, Abiowell, China) for observation by microscope.

2.10 Immunofluorescence (IF) staining

Hippocampal neurons were identified using IF staining based on neuron-specific enolase (NSE). The slide of hippocampal neurons was washed with PBS and fixed with 4% paraformaldehyde for 30 min. Next, the slide was reacted with 0.3% Triton at 37℃ for 30 min. Then, the slide was blocked with 5% BSA at 37℃ for 60 min followed by incubation with NSE antibody (1:50, 10149-1-AP, Proteintech, USA) overnight at 4℃. Then, the slide was incubated with 50–100 µL CoraLite594-conjugated Goat Anti-Rabbit IgG (SA00013-4, Proteintech, USA) at 37℃ for 90 min. After that, the slide was fixed with 4% paraformaldehyde for 10 min. 4', 6-diamidino-2-phenylindole (DAPI) (AWI0331a, Abiowell, China) was used for nuclear staining at 37℃ for 10 min. After glycerin sealing, the slide was observed under a fluorescence microscope.

2.11 Immunohistochemistry (IHC) staining

The slices were dewaxed in xylene for 20 min and then dehydrated by gradient ethanol (75–100%). The slices were immersed in citrate buffer (pH 6.0, 0.01 M) (AWI0206a, Abiowell, China) and heated for antigen repair. Subsequently, 1% periodic acid was added to inactivate the endogenous enzyme. Antibodies including p53 (1:200, 10442-1-AP, Proteintech, USA), SLC7A11 (1:200, 26864-1-AP, Proteintech, USA), and GPX4 (1:200, ab125066, Abcam, UK) were incubated with the slices overnight at 4℃ respectively. Then, the slices were incubated with 50–100 µL anti-Rabbit-IgG-HRP at 37℃ for 30 min. Next, 50–100 µL DAB solution was added to develop color. After counterstaining with hematoxylin for 5–10 min, the slices were returned to blue with PBS. The slices were dehydrated with gradient ethanol (60–100%), 5 min for each gradient. After being placed in xylene for 10 min, the slices were sealed with neutral gum and photographed under a microscope.

2.12 TUNEL staining

The slices were placed in xylene for 20 min to dewax, followed by gradient ethanol dehydration (75–100%). First, 100 µL Proteinase K solution was prepared according to the TUNEL cell apoptosis detection kit (40306ES50, Yeasen, China) and then reacted with the slices at 37℃ for 20 min. Next, 100 µL equilibration buffer was used to cover the whole slice and incubated at 25℃ for 10–30 min. Then, the slices were incubated with 50 µL TDT solution at 37℃ for 60 min. After nuclear staining with DAPI solution at 37℃ for 10 min, the slices were sealed with glycerol and observed by fluorescence microscope.

2.13 Biochemical detection

The contents of Malondialdehyde (MDA), Glutathione (GSH), and Fe²⁺ in hippocampal neurons were detected, respectively, using the MDA detection kit (A003-1-2, Nanjing Jiancheng Bioengineering Institute, China), GSH detection kit (A006-2-1, Nanjing Jiancheng Bioengineering Institute, China), and iron detection kit (TC1015, Beijing Leagene Biotechnology Co., Ltd. China).

2.14 Flow cytometry

For ROS analysis, the cells were separated from the medium and suspended with 10 µM DCFH-DA (S0033S, Beyotime, China) and then incubated in a humidified incubator containing 5% CO₂ at 37℃ for 20 min. Next, cells were washed with a medium to remove DCFH-DA that failed to enter the cells. For mitochondrial membrane potential (MMP) analysis, 1 mL of JC-1 staining solution (C2006, Beyotime, China) was mixed with cells and incubated in the humidified incubator containing 5% CO₂ at 37℃ for 20 min. Subsequently, the cells were washed twice with the JC-1 staining buffer and suspended with the medium for detection.

2.15 Dual-luciferase reporter assay

Bioinformatics prediction was applied to analyze the binding sites of miR-302a-3p and 3'-UTR of Keap1 (https://starbase.sysu.edu.cn). Plasmids psiCHECK-2-musKeap1-3U-WT (wild type) and psiCHECK-2-musKeap1-3U-Mut (mutant type) were all bought from HonorGene. HEK-293A cells (AW-CNH216, Abiowell, China) were used in dual-luciferase reporter assay systems, then transfected with plasmids and miR-302a-3p mimic or mimic NC, respectively, and cultured in a humidified incubator containing 5% CO₂ at 37℃. After culturing for 48 h, HEK-293A cells of each group were lysed, and other treatments were performed using the dual-luciferase detection kit (E1910, Promega, USA). Firefly luciferase and Renilla luciferase activity were detected sequentially on a chemiluminescence detector (GloMax 20/20, Promega, USA).

2.16 Data analysis

GraphPad Prism 8.0 (GraphPad Software Inc., USA) was utilized for statistical analysis. Data were expressed as mean ± standard deviation (SD). Kolmogorov-Smirnov test and exploratory descriptive statistics test were used to analyze whether the data conformed to a normal distribution and homogeneity of variance. The unpaired student's t-test was used to compare the data of two groups that were not one-to-one correspondence. One-way ANOVA and Tukey's post-hoc test were employed in comparison between multiple groups. The difference was statistically significant when P < 0.05. The related information was shown in Supplementary Table 1. All the experiments followed randomization and blind analysis to avoid experimental bias.

3.1 Extraction and identification of BV2-Exo

BV2-Exo was successfully isolated from BV2 cells by ultracentrifugation and then characterized by TEM, NTA, and Western blot. As shown from TEM images in Fig. 1A, BV2-Exo was single-distributed, with an obvious double-layer capsule structure, and its morphology was typically saucer-shaped or hemispherical with one side depressed. NTA results showed that the concentration of BV2-Exo was about 4×10⁶ particles/mL, with a diameter of about 100 nm, which was consistent with the theoretical exosome size value (Kalluri 2016) (Fig. 1B). Western blot proved that exosome markers, including Alix, CD9, CD63, and CD81, were expressed in BV2-Exo (Fig. 1C). As depicted from RT-qPCR results in Fig. 1D, miR-302a-3p was expressed in BV2-Exo. The above results indicated that BV2-Exo was successfully extracted and could be employed as the vector of miR-302a-3p.

3.2 Cerebral I/R induced ferroptosis in hippocampal neurons

In the mNSS experiment, the mice in the Sham group had no abnormal symptoms, with a neurological score of 0. However, the mice in the cerebral I/R group showed hemiplegia and rotation to one side after surgery, and the high neurological score indicated that the cerebral I/R model was successfully constructed (Fig. 2A). As shown in the brain slices after TTC staining, the left hemisphere of mice in the cerebral I/R group appeared to have obvious infarcted areas (Fig. 2B). In addition, HE staining further observed that the number of hippocampal neurons decreased with incomplete cell structure, irregular arrangement, and deepened nucleus staining after cerebral I/R treatment (Fig. 2C). Furthermore, the Western blot analysis displayed that cerebral I/R treatment significantly induced the expression of NCOA4 (Fig. 2D). Besides, IHC staining found that the expression of p53 in the hippocampus of mice increased, while that of SLC7A11 and GPX4 decreased significantly after cerebral I/R treatment (Fig. 2E). Together, these results indicated that cerebral I/R induced ferroptosis in the hippocampal neurons of mice.

3.3 Exosomal miR-302a-3p reduced ferroptosis in hippocampal neurons

To explore whether exosomal miR-302a-3p acted on ferroptosis in hippocampal neurons, BV2-Exo with overexpressed miR-302a-3p was injected into cerebral I/R mice via the tail vein. The Morris water maze test results showed that exosomal miR-302a-3p alleviated the cognitive impairment of cerebral I/R mice, shortening the escape latency and time spent finding the platform and reducing the number of errors (Fig. 3A). TUNEL staining confirmed that exosomal miR-302a-3p significantly reduced the high cell death of hippocampal neurons induced by cerebral I/R (Fig. 3B). In addition, Western blot revealed that high NCOA4 expression in cerebral I/R mice was significantly reduced by exosomal miR-302a-3p (Fig. 3C). As expected, cerebral I/R inhibited the expression of miR-302a-3p. However, this situation was rescued in the EV-miR-302a-3p group, which again verified the successful loading of miR-302a-3p in BV2-Exo (Fig. 3D). It was worth noting that cerebral I/R treatment promoted expressions of p53 and PTGS2, but SLC7A11 was the opposite. However, exosomal miR-302a-3p inhibited high expressions of p53 and PTGS2, but induced the expression of SLC7A11 at the mRNA and protein levels (Fig. 3E). Thus, the above results proved that exosomal miR-302a-3p reduced ferroptosis in hippocampal neurons.

3.4 Exosomal miR-302a-3p inhibited ferroptosis in hippocampal neurons by inhibiting ferritinophagy

We isolated the hippocampal neurons from the normal mouse brain and then identified them using IF staining. NSE-positive staining was found in both cell bodies and dendrites, indicating the successful isolation and culture of hippocampal neurons (Fig. 4A). Consistent with the results in vivo, the expression of miR-302a-3p was significantly reduced by OGD treatment, indicating the successful construction of the cell model. Exosomal miR-302a-3p promoted the high expression of miR-302a-3p in OGD-treated hippocampal neurons (Fig. 4B). Meanwhile, OGD treatment inhibited the expressions of FTH1 and FTL, but NCOA4 was the opposite. However, exosomal miR-302a-3p treatment reversed this trend (Fig. 4C). As determined by the biochemical kit, the Fe²⁺ accumulation in OGD-treated hippocampal neurons was notably inhibited by exosomal miR-302a-3p treatment (Fig. 4D). Subsequently, TUNEL staining proved that exosomal miR-302a-3p alleviated cell death of OGD-treated hippocampal neurons (Fig. 4E). In agreement with these findings, the synthesis and accumulation of GPX4 and GSH increased obviously in OGD-treated hippocampal neurons under exosomal miR-302a-3p treatment (Fig. 4F and 4H). Flow cytometry results displayed that the declined MMP of OGD-treated hippocampal neurons was rescued by exosomal miR-302a-3p treatment (Fig. 4G). Besides, the high ROS level caused by OGD was reduced by exosomal miR-302a-3p treatment (Fig. 4I). Furthermore, exosomal miR-302a-3p significantly elevated SLC7A11 expression and reduced p53 and PTGS2 expressions in OGD-treated hippocampal neurons (Fig. 4J). Altogether, the above results indicated that exosomal miR-302a-3p inhibited ferroptosis in hippocampal neurons by inhibiting ferritinophagy.

3.5 Exosomal miR-302a-3p regulated the Keap1/Nrf2 axis

Through bioinformatics prediction, we found that miR-302a-3p bound to the 3'-UTR of Keap1 (Fig. 5A). Dual-luciferase reporter assay verified that Keap1 was the direct downstream target of miR-302a-3p. miR-302a-3p significantly reduced luciferase activity in HEK-293A cells transfected with musKeap1-3U-WT, indicating that miR-302a-3p inhibited the expression of Keap1 (Fig. 5B). To explore the potential involvement of exosomal miR-302a-3p in the Keap1/Nrf2 axis, OGD-treated hippocampal neurons were cultured with exosomes secreted respectively from BV, mimic NC-transfected BV2, and miR-302a-3p mimic-transfected BV2. As seen in Fig. 5C-D, exosomal miR-302a-3p markedly suppressed the expression of Keap1 and induced the high expression of Nrf2 at the mRNA and protein levels in OGD-treated hippocampal neurons. These results displayed that exosomal miR-302a-3p could regulate the Keap1/Nrf2 axis.

3.6 Exosomal miR-302a-3p alleviated ferroptosis via regulating the Keap1/Nrf2 axis to inhibit ferritinophagy in hippocampal neurons

To further explore whether exosomal miR-302a-3p alleviated ferroptosis via regulating the Keap1/Nrf2 axis, Exosomes secreted from miR-302a-3p mimic-transfected BV2 were cocultured with oe-Keap1-transfected and OGD-treated hippocampal neurons. Compared with the OGD group, the expression of miR-302a-3p in the Exo-miR-302a-3p mimic group was upregulated. However, it reduced obviously in the presence of oe-Keap1 (Fig. 6A). Exosomal miR-302a-3p promoted high expression of Nrf2 and inhibited that of Keap1 in OGD-treated hippocampal neurons at the mRNA and protein levels, but these reversed in the presence of oe-Keap1 (Fig. 6B). Western blot analysis revealed that expressions of FTH1 and FTL were increased and that of NCOA4 was inhibited by exosomal miR-302a-3p in OGD-treated hippocampal neurons, but this trend was changed by oe-Keap1 (Fig. 6C). Moreover, under the effect of exosomal miR-302a-3p, the Fe²⁺, and MDA concentrations were reduced, and GPX4 and GSH synthesis was raised in OGD-treated hippocampal neurons, which was opposite to the situation under oe-Keap1 treatment (Fig. 6D, 6F-6H). TUNEL staining results displayed that oe-Keap1 reversed the inhibitory effect of exosomal miR-302a-3p on the cell death of OGD-treated hippocampal neurons (Fig. 6E). Further analysis by flow cytometry reflected that the OGD-induced high ROS level was suppressed by exosomal miR-302a-3p but promoted by oe-Keap1 (Fig. 6I). Subsequently, Western blot analysis exhibited that SLC7A11 expression was increased and PTGS2 and p53 expressions were decreased in OGD-treated hippocampal neurons under the effect of exosomal miR-302a-3p. However, the oe-Keap1 treatment showed the opposite results (Fig. 6J). The above results indicated that exosomal miR-302a-3p alleviated ferroptosis by regulating the Keap1/Nrf2 axis to inhibit ferritinophagy in hippocampal neurons.

Ferroptosis is related to cerebral I/R injury, but its specific mechanism is still unclear (Xu et al. 2022). Microglia are necessary for maintaining the central nervous system, such as injury response and immune surveillance(Frost and Schafer 2016). Microglia can release exosomes rich in miRNAs related to neurotrophic signals, including miR-302a-3p (Hou et al. 2020). Here we found that microglia-derived exosomal miR-302a-3p suppressed ferroptosis to alleviate cerebral I/R injury by inhibiting neuronal ferritinophagy via regulating the Keap1/Nrf2 axis. Therefore, it was expected to become a potential target for treating cerebral I/R injury.

Generally, brain injury is accompanied by a certain degree of loss of neural function, including consciousness, motor, sense, and neural reflex (Yan et al. 2018). This was confirmed by the high neurological deficit score of cerebral I/R model mice in this experiment. At the same time, TCC staining showed cerebral I/R successfully caused obvious infarcted areas in the mouse brain. HE staining of hippocampal tissue observed a significant decrease in the neurons' number, accompanied by pyknosis and deep staining, all indicating that cerebral I/R successfully caused brain injury in mice. Studies have explained that ferroptosis plays a significant harmful role in many I/R models (Yan et al. 2020). NCOA4 is a selective cargo receptor that can mediate ferritin autophagy and cause an increase in Fe²⁺ levels to promote ferroptosis (Gao et al. 2016). Western blot results displayed that the expression level of NCOA4 increased in hippocampal neurons of mice after cerebral I/R treatment, which was in line with the results of relevant literature (Li et al. 2021a). In addition, the decrease of SLC7A11 and GPX4 content and the increase of p53 content also indicated that cerebral I/R induced ferroptosis in hippocampal neurons. In ferroptosis, GPX4 is considered a key regulator (Bersuker et al. 2019), and its catalytic activity is used to reduce the level of lipid peroxidation to inhibit the occurrence of ferroptosis. Similarly, SLC7A11 participates in the exchange of extracellular cystine and glutamate and plays an inhibitory role in ferroptosis. Relevant studies have shown that activation of the SLC7A11/GPX4 axis can inhibit ferroptosis and alleviate cerebral I/R injury (Liu et al. 2022). P53 is a tumor suppressor, which can induce apoptosis and ferroptosis. Studies have found that p53 apoptosis-stimulating protein inhibitors can inhibit ferroptosis and alleviate intestinal I/R-induced acute lung injury (Zhou et al. 2020).

Studies have found that I/R can induce hippocampal damage in young mice and lead to cognitive dysfunction (Yu et al. 2020). In this study, the learning and memory abilities of cerebral I/R model mice decreased, indicating that the cognitive function of mice was seriously damaged by cerebral I/R. The high cell death of hippocampal neurons discovered by TUNEL staining also verified this injury. RT-qPCR and Western blot results proved that cerebral I/R could promote ferritin autophagy and induce ferroptosis. In addition, cerebral I/R can form sustained oxidative stress damage to mitochondria (Piantadosi and Zhang 1996). In this study, cerebral I/R and OGD treatment decreased MMP, GPX4, and GSH accumulation, and increased ROS level and MDA concentration. However, injection of exosomal miR-302a-3p reversed the above situation, and ferroptosis of hippocampal neurons was alleviated. It has been well documented that miRNAs derived from microglia are closely related to regulating cerebral I/R injury. In related research, BV2-Exo alleviated cerebral I/R injury by targeting Notch1 through the transport of miR-137 (Zhang et al. 2021). In addition, miR-589 of BV2-Exo targeted TRAF6 to alleviate inflammatory response and defend against cerebral I/R injury (Ma et al. 2020). Also, M2 microglia-derived exosomes alleviated ischemic brain injury and promoted neuronal survival through the miR-124/USP14 axis (Song et al. 2019). miR-302a-3p has been reported in myocardial I/R injury (Lv et al. 2020) and renal I/R injury research (Bai et al. 2021), but less in cerebral I/R injury. miR-302a-3p can regulate E2F1 expression and SNHG3 transcription activated by E2F1 to promote neural repair after ischemic stroke (Sun et al. 2021).

The Nrf2-Keap1 system is one of the main mechanisms for cells to resist oxidative stress(Kim et al. 2014). The Nrf2-Keap1 system can modify susceptibility to ferroptosis(Capelletti et al. 2020). In I/R injury models, the Nrf2-Keap1 system and related signaling pathways were important(Zhang et al. 2022; Yao et al. 2022a; Ucar et al. 2021). The role of the Keap1/Nrf2 axis has been studied in cerebral I/R injury (Huang et al. 2019), but there is no report on the regulatory interaction between exosomal miR-302a-3p and Keap1/Nrf2 axis. In this study, the double-luciferase reporter assay demonstrated that Keap1 was the direct downstream target of miR-302a-3p, and the Keap1/Nrf2 axis was involved in the treatment of exosomal miR-302a-3p for cerebral I/R injury. Nrf2, a transcription factor, regulates antioxidant stress response, and Keap1 is a specific receptor of it (Moi et al. 1994). In this study, the exosomal miR-302a-3p inhibited ferritinophagy by regulating the Keap1/Nrf2 axis, thereby alleviating the ferroptosis in OGD-treated hippocampal neurons. However, the oe-Keap1 treatment decreased the therapeutic effect of exosomal miR-302a-3p on hippocampal neuronal injury.

To conclude, BV2-exosomal miR-302a-3p was identified as a key regulatory factor in suppressing ferroptosis to alleviate cerebral I/R injury, and its role was achieved by regulating the Keap1/Nrf2 axis to inhibit neuronal ferritinophagy. This study will offer fresh perspectives on the therapeutic targets and approaches to cerebral I/R injury.

Acknowledgements

We gratefully acknowledge technical support from Well Biological Science company. Graphic abstract was created by Figdraw (www.figdraw.com).

Funding

This study was supported by the Hainan Cerebrovascular Disease Clinical Research Center of China (No.LCYX202206).

Conflicts of interest/Competing interests

The authors declare that no competing interests exist.

Availability of data and materials

All data generated or analyzed during this study are included in this published article

Code availability

Not applicable.

Authors’ contributions

YX and LW designed experiments and directed the project. ZY, LW, and YZ performed experiments. YL, JZ, and ML analyzed experiments and drafted the manuscript. YZ and ZY performed data analysis. All the authors reviewed the manuscript. All authors read and approved the ﬁnal manuscript.

Ethics approval

The animal experiments in this research were approved by Aﬃliated Haikou Hospital of Xiangya School of Central South University (2022-124). We confirm that all methods are reported in accordance with ARRIVE guidelines. The study didn’t involve human participants, human data or human tissue.

Bai T, Cui Y, Yang X, Cui X, Yan C, Tang Y, Cao X, Dong C (2021) miR-302a-3p targets FMR1 to regulate pyroptosis of renal tubular epithelial cells induced by hypoxia-reoxygenation injury. Experimental physiology 106 (12):2531–2541. doi:10.1113/ep089887
Bartel DP (2018) Metazoan MicroRNAs. Cell 173 (1):20–51. doi:10.1016/j.cell.2018.03.006
Benjamin EJ, Muntner P, Alonso A, Bittencourt MS, Callaway CW, Carson AP, Chamberlain AM, Chang AR, Cheng S, Das SR, Delling FN, Djousse L, Elkind MSV, Ferguson JF, Fornage M, Jordan LC, Khan SS, Kissela BM, Knutson KL, Kwan TW, Lackland DT, Lewis TT, Lichtman JH, Longenecker CT, Loop MS, Lutsey PL, Martin SS, Matsushita K, Moran AE, Mussolino ME, O'Flaherty M, Pandey A, Perak AM, Rosamond WD, Roth GA, Sampson UKA, Satou GM, Schroeder EB, Shah SH, Spartano NL, Stokes A, Tirschwell DL, Tsao CW, Turakhia MP, VanWagner LB, Wilkins JT, Wong SS, Virani SS (2019) Heart Disease and Stroke Statistics-2019 Update: A Report From the American Heart Association. Circulation 139 (10):e56-e528. doi:10.1161/cir.0000000000000659
Bersuker K, Hendricks JM, Li Z, Magtanong L, Ford B, Tang PH, Roberts MA, Tong B, Maimone TJ, Zoncu R, Bassik MC, Nomura DK, Dixon SJ, Olzmann JA (2019) The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis. Nature 575 (7784):688–692. doi:10.1038/s41586-019-1705-2
Blenkiron C, Askelund KJ, Shanbhag ST, Chakraborty M, Petrov MS, Delahunt B, Windsor JA, Phillips AR (2014) MicroRNAs in mesenteric lymph and plasma during acute pancreatitis. Ann Surg 260 (2):341–347. doi:10.1097/sla.0000000000000447
Budnik V, Ruiz-Cañada C, Wendler F (2016) Extracellular vesicles round off communication in the nervous system. Nat Rev Neurosci 17 (3):160–172. doi:10.1038/nrn.2015.29
Capelletti MM, Manceau H, Puy H, Peoc'h K (2020) Ferroptosis in Liver Diseases: An Overview. Int J Mol Sci 21 (14). doi:10.3390/ijms21144908
Chang C-F, Cho S (2014) (-)-Epicatechin protects hemorrhagic brain via synergistic Nrf2 pathways. Ann Clin Transl Neurol 1 (4):258–271
Chen W, Zhao L, Zhang J, Wang B, Xu G, Lin C, Liu N (2019) Elevated expression of miR-302 cluster improves traumatic brain injury by inhibiting phosphorylation of connexin43 via ERK signaling. J Chem Neuroanat 99:1–8. doi:10.1016/j.jchemneu.2019.05.003
Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B, 3rd, Stockwell BR (2012) Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 149 (5):1060–1072. doi:10.1016/j.cell.2012.03.042
Dou D, Ren X (2020) Cancer-Associated Fibroblasts-Derived Exosomes Suppress Immune Cell Function in Breast Cancer via the miR-92/PD-L1 Pathway. Front Immunol 11
Frost JL, Schafer DP (2016) Microglia: Architects of the Developing Nervous System. Trends in cell biology 26 (8):587–597. doi:10.1016/j.tcb.2016.02.006
Gao M, Monian P, Pan Q, Zhang W, Xiang J, Jiang X (2016) Ferroptosis is an autophagic cell death process. Cell Res 26 (9):1021–1032. doi:10.1038/cr.2016.95
Hou BR, Jiang C, Wang ZN, Ren HJ (2020) Exosome-mediated crosstalk between microglia and neural stem cells in the repair of brain injury. Neural regeneration research 15 (6):1023–1024. doi:10.4103/1673-5374.270302
Huang R, Ma J, Niu B, Li J, Chang J, Zhang Y, Liu P, Luan X (2019) MiR-34b Protects Against Focal Cerebral Ischemia-Reperfusion (I/R) Injury in Rat by Targeting Keap1. Journal of stroke and cerebrovascular diseases: the official journal of National Stroke Association 28 (1):1–9. doi:10.1016/j.jstrokecerebrovasdis.2018.08.023
Kalluri R (2016) The biology and function of exosomes in cancer. J Clin Invest 126 (4):1208–1215. doi:10.1172/jci81135
Kim JY, Shin KK, Lee AL, Kim YS, Park HJ, Park YK, Bae YC, Jung JS (2014) MicroRNA-302 induces proliferation and inhibits oxidant-induced cell death in human adipose tissue-derived mesenchymal stem cells. Cell Death Dis 5 (8):e1385. doi:10.1038/cddis.2014.344
Kleindorfer DO, Towfighi A, Chaturvedi S, Cockroft KM, Gutierrez J, Lombardi-Hill D, Kamel H, Kernan WN, Kittner SJ, Leira EC, Lennon O, Meschia JF, Nguyen TN, Pollak PM, Santangeli P, Sharrief AZ, Smith SC, Jr., Turan TN, Williams LS (2021) 2021 Guideline for the Prevention of Stroke in Patients With Stroke and Transient Ischemic Attack: A Guideline From the American Heart Association/American Stroke Association. Stroke 52 (7):e364-e467. doi:10.1161/str.0000000000000375
Li HH, Lin SL, Huang CN, Lu FJ, Chiu PY, Huang WN, Lai TJ, Lin CL (2016) miR-302 Attenuates Amyloid-β-Induced Neurotoxicity through Activation of Akt Signaling. J Alzheimers Dis 50 (4):1083–1098. doi:10.3233/jad-150741
Li Q, Barres BA (2018) Microglia and macrophages in brain homeostasis and disease. Nat Rev Immunol 18 (4):225–242. doi:10.1038/nri.2017.125
Li W, Li W, Wang Y, Leng Y, Xia Z (2021a) Inhibition of DNMT-1 alleviates ferroptosis through NCOA4 mediated ferritinophagy during diabetes myocardial ischemia/reperfusion injury. Cell Death Discov 7 (1):267. doi:10.1038/s41420-021-00656-0
Li X, Ma N, Xu J, Zhang Y, Yang P, Su X, Xing Y, An N, Yang F, Zhang G, Zhang L, Xing Y (2021b) Targeting Ferroptosis: Pathological Mechanism and Treatment of Ischemia-Reperfusion Injury. Oxid Med Cell Longev 2021:1587922. doi:10.1155/2021/1587922
Liu T, Cui Y, Dong S, Kong X, Xu X, Wang Y, Wan Q, Wang Q (2022) Treadmill Training Reduces Cerebral Ischemia-Reperfusion Injury by Inhibiting Ferroptosis through Activation of SLC7A11/GPX4. Oxid Med Cell Longev 2022:8693664. doi:10.1155/2022/8693664
Liu WJ, Ye L (2016) p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. Cell Mol Biol Lett 21
Lv W, Jiang J, Li Y, Fu L, Meng F, Li J (2020) MiR-302a-3p aggravates myocardial ischemia-reperfusion injury by suppressing mitophagy via targeting FOXO3. Experimental and molecular pathology 117:104522. doi:10.1016/j.yexmp.2020.104522
Ma GP, Yang BZ, Zhang YS, Wang B, Wei XH, Zhang RF, Jia KH, Gao JP (2020) Protective effects of miRNA-589 on cerebral ischemia-reperfusion injury. Journal of biological regulators and homeostatic agents 34 (4):1269–1275. doi:10.23812/20-52-a
Miller JB, Merck LH (2017) The Advanced Reperfusion Era: Implications for Emergency Systems of Ischemic Stroke Care. Ann Emerg Med 69 (2):192–201
Moi P, Chan K, Asunis I, Cao A, Kan YW (1994) Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proceedings of the National Academy of Sciences of the United States of America 91 (21):9926–9930. doi:10.1073/pnas.91.21.9926
Osier N, Motamedi V, Edwards K, Puccio A, Diaz-Arrastia R, Kenney K, Gill J (2018) Exosomes in Acquired Neurological Disorders: New Insights into Pathophysiology and Treatment. Mol Neurobiol 55 (12):9280–9293. doi:10.1007/s12035-018-1054-4
Piantadosi CA, Zhang J (1996) Mitochondrial generation of reactive oxygen species after brain ischemia in the rat. Stroke 27 (2):327–331; discussion 332. doi:10.1161/01.str.27.2.327
Song Y, Li Z, He T, Qu M, Jiang L, Li W, Shi X, Pan J, Zhang L, Wang Y, Zhang Z, Tang Y, Yang GY (2019) M2 microglia-derived exosomes protect the mouse brain from ischemia-reperfusion injury via exosomal miR-124. Theranostics 9 (10):2910–2923. doi:10.7150/thno.30879
Stockwell BR, Friedmann Angeli JP, Bayir H, Bush AI, Conrad M, Dixon SJ, Fulda S, Gascón S, Hatzios SK, Kagan VE, Noel K, Jiang X, Linkermann A, Murphy ME, Overholtzer M, Oyagi A, Pagnussat GC, Park J, Ran Q, Rosenfeld CS, Salnikow K, Tang D, Torti FM, Torti SV, Toyokuni S, Woerpel KA, Zhang DD (2017) Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 171 (2):273–285. doi:10.1016/j.cell.2017.09.021
Sun X, Ou Z (2016) Activation of the p62-Keap1-NRF2 pathway protects against ferroptosis in hepatocellular carcinoma cells. Hepatology 63 (1):173–184
Sun X, Wang L, Huang X, Zhou S, Jiang T (2021) Regulatory Mechanism miR-302a-3p/E2F1/SNHG3 Axis in Nerve Repair Post Cerebral Ischemic Stroke. Current neurovascular research 18 (5):515–524. doi:10.2174/1567202618666211210155715
Suzuki K, Matsumaru Y, Takeuchi M, Morimoto M, Kanazawa R, Takayama Y, Kamiya Y, Shigeta K, Okubo S, Hayakawa M, Ishii N, Koguchi Y, Takigawa T, Inoue M, Naito H, Ota T, Hirano T, Kato N, Ueda T, Iguchi Y, Akaji K, Tsuruta W, Miki K, Fujimoto S, Higashida T, Iwasaki M, Aoki J, Nishiyama Y, Otsuka T, Kimura K (2021) Effect of Mechanical Thrombectomy Without vs With Intravenous Thrombolysis on Functional Outcome Among Patients With Acute Ischemic Stroke: The SKIP Randomized Clinical Trial. Jama 325 (3):244–253. doi:10.1001/jama.2020.23522
Ucar BI, Ucar G, Saha S, Buttari B, Profumo E, Saso L (2021) Pharmacological Protection against Ischemia-Reperfusion Injury by Regulating the Nrf2-Keap1-ARE Signaling Pathway. Antioxidants (Basel) 10 (6). doi:10.3390/antiox10060823
Wang H, Zheng X (2020) LncRNA MALAT1 silencing protects against cerebral ischemia-reperfusion injury through miR-145 to regulate AQP4. J Biomed Sci 27
Xiao X, Lu Z, Lin V, May A, Shaw DH, Wang Z, Che B, Tran K, Du H, Shaw PX (2018) MicroRNA miR-24-3p Reduces Apoptosis and Regulates Keap1-Nrf2 Pathway in Mouse Cardiomyocytes Responding to Ischemia/Reperfusion Injury. Oxid Med Cell Longev 2018:7042105. doi:10.1155/2018/7042105
Xu Y, Liu Y, Li K, Yuan D, Yang S, Zhou L, Zhao Y, Miao S, Lv C, Zhao J (2022) COX-2/PGE2 Pathway Inhibits the Ferroptosis Induced by Cerebral Ischemia Reperfusion. Mol Neurobiol 59 (3):1619–1631. doi:10.1007/s12035-021-02706-1
Yan HF, Tuo QZ, Yin QZ, Lei P (2020) The pathological role of ferroptosis in ischemia/reperfusion-related injury. Zool Res 41 (3):220–230. doi:10.24272/j.issn.2095-8137.2020.042
Yan Y, Kong L, Xia Y, Liang W, Wang L, Song J, Yao Y, Lin Y, Yang J (2018) Osthole promotes endogenous neural stem cell proliferation and improved neurological function through Notch signaling pathway in mice acute mechanical brain injury. Brain Behav Immun 67:118–129. doi:10.1016/j.bbi.2017.08.011
Yao H, Xie Q, He Q, Zeng L, Long J, Gong Y, Li X, Li X, Liu W, Xu Z, Wu H, Zheng C, Gao Y (2022a) Pretreatment with Panaxatriol Saponin Attenuates Mitochondrial Apoptosis and Oxidative Stress to Facilitate Treatment of Myocardial Ischemia-Reperfusion Injury via the Regulation of Keap1/Nrf2 Activity. Oxid Med Cell Longev 2022:9626703. doi:10.1155/2022/9626703
Yao Y, Hu S, Zhang C, Zhou Q, Wang H, Yang Y, Liu C, Ding H (2022b) Ginsenoside Rd attenuates cerebral ischemia/reperfusion injury by exerting an anti-pyroptotic effect via the miR-139-5p/FoxO1/Keap1/Nrf2 axis. Int Immunopharmacol 105:108582. doi:10.1016/j.intimp.2022.108582
Yu W, Lyu J, Jia L, Sheng M, Yu H, Du H (2020) Dexmedetomidine Ameliorates Hippocampus Injury and Cognitive Dysfunction Induced by Hepatic Ischemia/Reperfusion by Activating SIRT3-Mediated Mitophagy and Inhibiting Activation of the NLRP3 Inflammasome in Young Rats. Oxid Med Cell Longev 2020:7385458. doi:10.1155/2020/7385458
Zhang D, Cai G, Liu K, Zhuang Z, Jia K, Pei S, Wang X, Wang H, Xu S, Cui C, Sun M, Guo S, Song W, Cai G (2021) Microglia exosomal miRNA-137 attenuates ischemic brain injury through targeting Notch1. Aging 13 (3):4079–4095. doi:10.18632/aging.202373
Zhang X, Ha T, Lu C, Lam F, Liu L, Schweitzer J, Kalbfleisch J, Kao RL, Williams DL, Li C (2015) Poly (I:C) therapy decreases cerebral ischaemia/reperfusion injury via TLR3-mediated prevention of Fas/FADD interaction. J Cell Mol Med 19 (3):555–565. doi:10.1111/jcmm.12456
Zhang Y, Liu M, Zhang Y, Tian M, Chen P, Lan Y, Zhou B (2022) Urolithin A alleviates acute kidney injury induced by renal ischemia reperfusion through the p62-Keap1-Nrf2 signaling pathway. Phytother Res 36 (2):984–995. doi:10.1002/ptr.7370
Zhou B, Liu J, Kang R, Klionsky DJ, Kroemer G, Tang D (2020) Ferroptosis is a type of autophagy-dependent cell death. Semin Cancer Biol 66:89–100. doi:10.1016/j.semcancer.2019.03.002

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Microglia-derived exosomal miR-302a-3p suppresses ferroptosis to alleviate cerebral ischemia/reperfusion injury by inhibiting neuronal ferritinophagy via regulating the Keap1/Nrf2 axis Running title: The effect of BV2-Exo on cerebral I/R injury

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1 Cell culture

2.2 Extraction and identification of BV2-Exo

2.3 Construction of OGD model and intervention

2.4 Construction of cerebral I/R model and intervention

2.5 Behavioral test

2.6 Western blot

2.7 Quantitative real-time polymerase chain reaction (RT-qPCR)

2.8 2,3,5-Triphenyltetrazolium chloride (TTC) staining

2.9 Hematoxylin-eosin (HE) staining

2.10 Immunofluorescence (IF) staining

3. Results

3.1 Extraction and identification of BV2-Exo

3.2 Cerebral I/R induced ferroptosis in hippocampal neurons

3.3 Exosomal miR-302a-3p reduced ferroptosis in hippocampal neurons

3.4 Exosomal miR-302a-3p inhibited ferroptosis in hippocampal neurons by inhibiting ferritinophagy

3.5 Exosomal miR-302a-3p regulated the Keap1/Nrf2 axis

3.6 Exosomal miR-302a-3p alleviated ferroptosis via regulating the Keap1/Nrf2 axis to inhibit ferritinophagy in hippocampal neurons

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1