Biochemical and Molecular Evaluation of Drought Tolerance promising sugarcane (Saccharum spp.)

doi:10.21203/rs.3.rs-2630768/v1

Background:

(Saccharum. spp L.) Is an economic crop cultivated in the tropical and subtropical zones. Sugarcane crop faces all types of environmental constraints due to its long life cycle period. Among various stresses, drought creates major obstacle to sugarcane production. Sugarcane plant responds to such stress by activating various biochemical and molecular attributes. Therefore, this experiment was undertaken to elucidate a change in biochemical and differential expression profile of genes associated with drought under greenhouse condition by using ten sugarcane genotypes (GT.54 − 9, G.2009-11, K.81113, M.35–157, G.2003-49, G.84 − 47, G.2000-3, G.99–103, G.2004-27 and G.2003-47). Stress was imposed 120 days after planting by three stressed levels of water stress (87.5, 75 and 62.5%) according to Reference evapotranspiration (ET0).

Results:

The obtained results showed significant differences among productivity, biochemical and molecular responses in all genotypes. However, drought tolerant genotypes G.2004-27 and G.2003-47 were found better than others in maintaining an increase in biochemical antioxidant activities and molecular traits that resulted in better recovery and relatively high yield quality.

Conclusion:

The fact that sugarcane crop presents one of the largest and most intricate genomes of the plant kingdom, with diploid numbers ranging from 100 to 130 chromosomes, indicating a high ploidy level, as well as regular aneuploidy events. On the other hand drought stress can produce irreversible alterations that could induce plant death and causes several changes in sugarcane. Because of this complexity, the use of molecular tools represents an attractive approach for improving sugarcane breeding programs. Reverse transcription quantitative real-time PCR (RT-qPCR) is a good tool allowing the detection of variations in gene expression, including discreetly transcribed genes.

Saccharum. Spp

Reference evapotranspiration

Biochemical

Antioxidant

Gene expression

Sugarcane (Saccharum spp.) is an important sugar and industrial crop, cultivated in tropical and subtropical areas in more than 80 countries, mainly for sugar and biofuel production, [1]. Water deficit is the main factor that influences sugarcane varieties productivity, [2]. It also influences many biochemical and physiological processes [3]. The osmotic system considers one of the most efficient physiological mechanisms for maintaining cell turgidity under conditions of low hydric potential in the soil [4]. Osmoprotectant substances (proline, glycine betaine, and trehalose, among others) contribute to maintaining hydric balance and preserving the integrity of proteins, enzymes, and cell membranes [5].

Proline is the most studied osmoprotectant, due to its response sensitivity to adverse conditions [6]. Generally, the beneficial roles of proline have been widely reported [7]. It was observed that in plants under stress, proline content can increase up to 100 times, in comparison with that observed in plants cultivated under normal conditions [8]. Free proline accumulation under stress conditions may act as an osmotic adjustment mediator [9], a free radical scavenger is an important component of cell wall proteins. Other authors reported that proline metabolism leads to an increase in the quantity of reactive oxygen species (ROS) in mitochondria, [10]. Further, drought leads to oxidative stress wherein production of ROS is enhanced causing membrane damage and deactivation of many associated enzymes. To overcome abnormal changes, plants have developed both enzymatic and non-enzymatic detoxifications mechanism; non-enzymatic antioxidant can act in the elimination of ROS and inhibit damage caused by lipid peroxidation [11].

Drought stress tolerance in plants is governed by many genes hence considered a complex quantitative trait, to identify genes and pathways related to stress responses, profiling of differentially expressing gene(s) is considered an alternative way to understood to be used in identifying the tolerant lines. Furthermore, [12] reported that it is important to better understanding the mechanisms of such genes in related to drought tolerance so, there is a still need of studying such mechanisms of such drought associated genes of sugarcane exposed to drought at active growth stage

Cane yield and sugar yield

The highest cane yield (t/fed) was recorded in K.81113 (65.10 t/fed) and lowest cane yield was recorded in G.99-103 (42.44 t/fed) under the highest stressed irrigation level in 62.5% of ET0 (treatment-III); Highest reduction was observed in G.99-103 (22.27 %) in the three stressed irrigation levels 87.5 of ET0 (treatment I), 75% of ET0 (treatment II) and treatment III respectively. The minimum reduction was observed in G.2009-11 and M.35-157.

Drought stress reduced the average of cane yield by 46.67% as compared to control. However, the genotypes K.81113 and M.3-157 showed higher cane yield under drought stress as well as control. The highest sugar yield (t/fed) was observed in G.2009-11 in the treatments I and III and lowest (3.67 t/fed) in G.99-103 in treatment-III. The maximum reduction was observed in G.99-103 (22.27 %), and the minimum reduction was noticed in G.84-47 (-22.7) and G.2000-3 (-18.1).

Varietal variation of total biomass, cane and sugar yield

Water deficits at 120 days after planting (DAP) not significantly reduced total biomass at harvest, cane yield and sugar yield in all genotypes (Table 1, 2). When averaged across genotypes, water deficits reduced mean total biomass at cane yield and sugar yield by 51% and 55%, respectively. Genotypes (K.81113 and M.3-157) showed the highest cane yield, on the other hand (GT.54-9 and G.2009-11) showed the highest sugar yield, under the three treatments.

Table 1 Effect of three drought treatments on cane yield of ten sugarcane genotypes according to ET0

Genotypes	Cane Yield (ton/fed)
	control	87.5% (I)	75% (II)	62.5% (III)	RED
GT.54-9	57.67	57.40^ns	63.57^ns	60.77^ns	-5.04
G.2009-11	59.50	64.27^ns	56^ns	57.40^ns	0.47
K81113	67.27	65.57^ns	44.10^c	65.10^ns	13.4
M.35-157	60.20	57.40^a	65.80^ns	64.03^ns	-3.67
G.2003-49	49	49^ns	66.50^ns	49^ns	-11.8
G.84-47	46.90	55.83^ns	64.40^ns	52.50^ns	-22.7
G.2000-3	46.20	62.13^ns	49^ns	52.57^ns	-18.1
G.99-103	59.03	52.50^ns	42.70^ns	42.44^ns	22.27
G.2004-27	58.80	42.70^ns	36.40^c	62.17^ns	19.91
G.2003-47	53.90	31.50^c	48.30^ns	59.03^ns	14.15

Different lowercase letters in the same species within a column indicate significant differences (P ≤ 0.05) by Turkey's test. Control is 100% of ET0, 87.5% is treatment I stressed level of ET0, 75% is treatment II stressed level of ET0, 62.5% is treatment III stressed level of ET0,RED Reduction of Drought

Table 2 Effect of three drought treatments on sugar yield of ten sugarcane genotypes according to ETC

	Sugar Yield (ton/fed)
Genotypes	control	87.5% (I)	75% (II)	62.5% (III)	RED
GT.54-9	6.74	5.01^ns	6.82^ns	7.07^ns	6.52
G.2009-11	5.79	7.25^ns	4.97^ns	7.36^ns	-12.6
K81113	7.30	6.75^ns	5.15^ns	6.30^ns	16.98
M.35-157	5.69	6.38^ns	5.34^ns	6.94^ns	-9.31
G.2003-49	5.16	5.91^ns	5.70^ns	5.13^ns	-8.13
G.84-47	3.76	5.56^ns	6.81^ns	4.45^ns	-48.9
G.2000-3	4.79	6.00^ns	4.28^ns	4.26^ns	-1.04
G.99-103	7.12	4.04^c	3.55^c	3.67^c	47.33
G.2004-27	4.76	3.32^ns	3.22^ns	5.86^ns	13.23
G.2003-47	4.33	2.93^ns	3.94^ns	4.81^ns	10.16

Different lowercase letters in the same species within a column indicate significant differences (P ≤ 0.05) by Turkeys' test (HSD). Control, treatment I, treatment II and treatment III

Biochemical observations

proline Accumulation

In our experiment, proline accumulation by all genotypes had ranged from 0.03 to 0.32 with a general mean of 0.102 mg g-1 dry weight in control samples and 0.03 to 0.11 with the mean of 0.052 in treatment-I, whereas, it was found to be ranged from 0.02 to 0.15 with the mean of 0.053 mg g-1 dry weight in treatment-II and ranged from 0.04 to 0.13 with a mean of 0.084 mg g-1 dry weight in treatment-III, (Table 3).

Proline mg g-1 in most genotypes was significantly decreased by increasing water deficit from 100 to 87.5 % of ET0. Also, the same trend was obtained when stress increased from 87.5 to 75 % of ET0. On contrary the proline content was increased in some genotypes when increasing water deficit from 75% to 62.5% of ET0.

The interaction between irrigation water stress treatments and sugarcane genotypes in (Table 4) cleared that, some genotypes differed significantly with commercial variety (GT.54-9) in proline content. Under water stress treatments, the genotypes K.81113, G.2004-27, G.99-103, G.2003-47, G.2009-11and G.2000-3 were found to be accumulating lesser amount of proline at the treatments-I and II. The highest increase was observed at treatment III. The higher proline content were obtained by genotypes G.2003-47 and G.2003-49 were higher than commercial genotype GT.54-9 by 0.02 mg g-1, under used higher water stress treatment III.

Table 3 Analysis of the free proline for ten sugarcane genotypes when subjected to a water deficit

	Proline (mg gm^-1) Dry weight.
Genotypes	control	87.5% (I)	75% (II)	62.5% (III)	RED
GT.54-9	0.32	0.11^a	0.15^b	0.11^a	61.46
G.2009-11	0.11	0.03^a	0.04^ab	0.06^c	60.60
K.81113	0.05	0.03^ns	0.02^ns	0.04^ns	40
M.35-157	0.03	0.08^c	0.05^ns	0.09^c	-144.4
G.2003-49	0.06	0.05^ns	0.06^ns	0.13^b	-33.33
G.84-47	0.08	0.06^ns	0.06^ns	0.06^ns	25
G.2000-3	0.11	0.03^a	0.03^a	0.05^c	66.67
G.99-103	0.09	0.04^c	0.03^c	0.06^ns	51.85
G.2004-27	0.08	0.04^c	0.03^c	0.11^ns	25
G.2003-47	0.09	0.05^c	0.06^ns	0.13^c	11.11

Different lowercase letters in the same species within a column indicate significant differences (P ≤ 0.05) by Turkeys' test (HSD). Control, treatment I, treatment II and treatment III

Content of phenolic, flavonoids and HPLC characterization of phenolic compounds

The results of the HPLC phenolic profiles revealed that the infusion contains several compounds like (gallic acid, protocateuic acid, catechin acid, esculatin acid, vanilic acid, pyrochatechol acid coumarine acid, cinnamic acid, 4,3- indole butyl acetic acid and naphthyl acetic acid ). Total phenolic content ranged from 9.4464 mg 100gm^-1DM in control genotype G.2004-27 to 1048.919 mg 100gm^-1DM in control genotype g.2003-49 equivalent in leaves (Table 4).

Table 4 Phenolic and flavonoids composition of some sugarcane genotypes leaves

ETC	Total phenolic compounds ( mg 100gm^-1DM )
ETC	control	87.5% (I)	75% (II)	62.5% (III)	RED
GT.54-9	341.22	17.378^b	6.153^ab	1.378^a	-92.7
G.2009-11	245.278	17.681^b	4.703^a	172.225^c	-20.6578
K.81113	174.39	18.435^ab	11.262^a	308.99^b	94.2124
M.35-157	360.56	9.604^ab	1.955^a	243.239^c	-29.3327
G.2003-49	1048.919	14.076^ab	9.59^a	272.054^c	-71.8072
G.84-47	657.711	11.968^a	10.537^a	344.45^c	-44.2073
G.2000-3	112.552	12.174^ab	1.076^a	210.373^b	98.68416
G.99-103	140.165	7.778^ab	5.253^a	225.47^c	-20.757
G.2004-27	9.961	0^c	9.125^ns	206.587^a	2065.566
G.2003-47	14.242	10.2^ns	0^c	266.765^a	1844.706

Averages followed by different letters differ by Turkey test p < 0.05

At control level, the total phenolic content ranged from 1048.919 mg 100gm^-1DM which was decreased to 14.076and 9.59 mg 100gm^-1DM respectively at the treatments-I and II. On aversely, treatment-III showed an increase in phenolic. The genotype G.2004-27 not contained any quantity of phenolic content in treatment-1 compared to other genotypes (Table 5). Maximum phenolic (344.45%) was released by G.84-47 at treatment III and the minimum phenolic was released by G.2004-27 and G.2003-47 (0.00%) at treatment I and II (Fig.1).

Peroxidase activity (POD)

Peroxidase, representing efficient scavenging machinery under drought stress, it recorded an increased activity more than 35% in comparison to control, (Table 5). The maximum increase was found in K.81113 (0.99%) followed by G.2009-11(0.73%) while the other seven genotypes were showed decrease in activity ranged from 61.11% to 91.9%. The least amount of increase in peroxidase activity was recorded in genotype G.2004-27 followed by M.35-157 and G.2000-3 with the percent of 44.4, 60 and 72.7% (Table 5), respectively.

The peroxidase activity was found to be ranged from (0.09 to 0.99), (0.11 to 0.27), (0.10 to 0.37) and (0.08to 0.38) with a general mean of 0.312, 0.18, 0.178 and 0.143 (moll/mg fresh weight /min) in controlled condition, treatment-I, treatment- II and treatment- II respectively. The highest POD (0.27, 0.37, 0.38 μmol/mg fresh weight /min) were found in GT.54-9, G.84-47, and G.2000-3 under (treatment-I), (treatment-II), and (treatment-III) respectively The highest average percent increase in POD was found in M.35-157 and G.2004-27 with the value of 53.33% and 33.33% under the three treatments. . However, the maximum reduction percent in POD 79.45% and 78.78% observed to be in genotypes G.2009-11and K.81113under all the three water stress treatments, respectively, (Table 5).

Table 5 three treatments on peroxidase enzyme (POD) under drought stress conditions in ten sugarcane genotypes

ETC	Peroxidase ( μmol/mg fresh weight /min)
ETC	control	87.5% (I)	75% (II)	62.5% (III)	RED
GT.54-9	0.14	0.27^a	0.17^c	0.12^b	-33.3
G.2009-11	0.73	0.11^ab	0.23^c	0.09^a	80.36
K.81113	0.99	0.23^bc	0.21^b	0.08^a	82.50
M.35-157	0.10	0.14^b	0.16^a	0.16^a	-53.3
G.2003-49	0.36	0.18^bc	0.16^b	0.14^a	55.6
G.84-47	0.16	0.22^c	0.37^a	0.09^b	-41.7
G.2000-3	0.22	0.19^c	0.14^b	0.38^a	-7.58
G.99-103	0.15	0.20^a	0.14^c	0.12^b	-2.22
G.2004-27	0.09	0.13^b	0.10^c	0.13^b	-33.3
G.2003-47	0.18	0.13^bc	0.10^a	0.12^b	35.18

Averages followed by different letters differ by Turkey test p < 0.05

Quantitative-Real time PCR (qRT-PCR)

Expression of proline oxidase (POX)

Proline oxidase transcripts displayed variable expression with different concentration of water stress in leaves tissues of all genotypes (Fig. 1). Although the POX transcript displayed an up-regulation compared with the control expression in the leaves at (100%) of ET0 in the eight genotypes GT.54-9, G.2009-11, M.35-157, G.84-47, G.84-47, G.99-103, G.2003-47 and G.2004-27 there was clear down-regulation of the transcripts in the leaves at all stressed levels. There was an observably reduction of POX in GT.54-9, G.2009-11, K.81113, G.84-47, G.2000-3, G.99-103 and G.2004-27 and GT.54-9, G.2009-11, G.99-103 and G.2000-3 at the treatments-I and II, respectively.

At the treatment-III the reduction was observed in G.2009-11, M.35-157, G.84-47, G.2003-49, G.2000-3, G.99-103, G.2003-47 and G.2004-27. It is worthy to mention that K.81113 the only genotype had the highest induction in treatment-II followed by G.2003-47, G.2003-49, M.35-157 and G.2004-27 respectively. The up-regulation increased noticeably in the three genotypes M.35-157, G.2003-49 and G.2003-47 and only in K.81113 at the treatments-I and III respectively (Fig. 1)

Expression of Sucrose synthase (SCSuSy1)

Sucrose synthase (ScSuSy1) transcripts displayed variable expression with different concentration of water stress in leaves tissues of all genotypes (Fig. 2). Although the ScSuSy1 transcript displayed a regular up-regulation compared with the control expression in the leaves at (100%) of ET0 in all ten genotypes, there was clear down-regulation of the transcripts in the leaves at treatments-I and III in the four genotypes GT.54-9, G.2009-11, K.81113 and G.2000-3, while at the highest stressed level treatment-III the down-regulation was in the same genotypes in addition to G.99-103.

Although the reduction in ScSuSy1 was approximately in the same range in all genotypes, there was noticeable increase in up-regulation at all the treatments in the seven genotypes GT.54-9, G.2003-49, M.35-157, G.84-47, G.2003-49 and G.2004-27 except the genotype G.99-103was increased only in treatments-I and II.

POX and ScSuSy1transcripts displayed an up regulation compared with the control expression in the leaves, five genotypes M.35-157, G.2003-49, G.84-47, G.2003-47 and G.2004-27 revealed a highly transcriptional profile under treatment-II.

The observed reduction in cane yield of about 25% in certain varieties under sub-tropical conditions have been observed by [13] while, [14]observed decreased from 60 to 20% in cane yield affected by most adversely available soil moisture Sugarcane exhibited varietal biochemical responses when exposed to abiotic stresses towards the level of proline accumulation these biochemical responses have been proposed as biochemical markers for drought sensitivity test [15].

Majority of plant species when submitted to drought stress, use many molecular, biochemical and physiological processes to increase synthesis and facilitate accumulation of compatible solutes (osmoprotectants) also over expression of several genes responsible for the deactivation of harmful substances formed during the stress period [16] also (ROS) scavenging system is activated [17]. Proline contribute to the reduction in the damage caused by the accumulation of ROS and is associated with drought tolerance in sugarcane [18]. Our result coincides with preceding works which indicated that proline accumulation was increased in water stressed sorghum [19].

Among various secondary metabolites phenolic are believed that they have an important role in plants exposed to abiotic stresses [20] For example, increased accumulation of soluble phenolic was reported to be importantly correlated with the heat and salt tolerance in sugarcane [21], In contrast to our study, water deficit stress caused a higher decrease in total phenolic in the most of genotypes, showing a negative relationship between drought resistance and accumulation of total phenolic in sugarcane genotypes. But in another study, drought reduced polyphenols in all maize genotypes irrespective of their degree of drought resistance[22].

The higher increase in activity of peroxidase enzyme plays an important role in plant’s adaptability and survival in water stress [23]. Our results showed significant change in peroxidase activity in all sugarcane genotype groups, these results are in confirmation of the study done by [16].

Our result reported decrease in POD activity in seven genotypes ranged from 61.11–91.9%, wherein, [24] found in their study that the sensitive genotypes showed higher activity of this enzyme. On the other hand, the results of levels of Proline oxidase and Sucrose synthase are in agreement with [12]who mentioned that the expression of these stress-response genes encoding proline biosynthesis in sugarcane plants under water deficit was associated with both sucrose accumulation different transcriptional profile which correlated with sucrose accumulation.

In conclusion, the examined sugarcane genotypes exhibited significant difference in their contents of total phenolics as well as their scavenging capacities against free radicals, proline, and peroxidase. However, according to the productivity, biochemical and molecular data we can conclude that G.2004-27 and G.2003-47were the most promising drought tolerant sugarcane genotypes.

The objective of this study was therefore to evaluate the response of different ten sugarcane genotypes in response to different drought stress conditions:

to investigate the effect of drought on cane yield and sugar yield
to evaluate the biochemical characters and,
to explore molecular changes along with expression patterns of gene(s) associated with drought tolerance in sugarcane genotypes

Experimental details

The experiment was conducted in greenhouse at sugar crop institute, Sabahia Agricultural Research Station, Alexandria (30.06263 'N latitude and 31.24967 'E longitude), with an altitude of 10 meters above sea level), with Split plot in completely randomized blocks design with 3 replications each in drought using a small pot experiment and three bud setts used for planting.

In this environment, all recommended cultural practices, viz., fertilizers, plant protection, irrigation has been applied to obtain maximum potential yield of the variety. Generally, at every seven day we supplied irrigation in crop up to first onset of rainfall on basis of soil moisture content (SMC). Even during rainy season, field was critically observed for SMC and supplied irrigation accordingly. Above said activities have been performed up to maturity stage of the crop.

Irrigation treatments

The total amount of irrigation water was calculated by Food and Agricultural Organization [25] (PM) penman monteith method .The potential evapotranspiration was calculated according to procedure,[26].

The water requirement of sugarcane was calculated daily, as the sum of water loss through transpiration and soil evaporation based on the crop water requirement (ETcrop)

Drought conditions

In this experiment, drought was artificially imposed according to Reference evapotranspiration, (ET0), of the crop up to maturation stage, (12 month). The crop was planted in month of April so that tillering stage gets exposed to drought experiment in month of August to April (2020- 2021). During artificially imposed stress, to avoid all seepage and water infiltration, polythene sheet was laid out at a depth of 5 m around the drought field.

Productivity parameters

Cane yield (ton/fed)

Was determined from the weight of all pots of each plot converted into ton per fed

Sugar yield (tons/fed)

Was calculated according to the following equation: Sugar yield (ton/fed) = Cane yield (ton/fed) × Sugar recovery%.

Biochemical parameters measurement

Determination of Non‑enzymatic Antioxidant Contents

Free Proline content Using 3% sulphosalicylic acid, proline was extracted and was estimated by the colorimetric method of [27] with some modifications the Absorbance of the chromosphere was recorded using Thermo Scientific UV–Vis spectrophotometer at 520 nm, Level of proline was expressed in mg proline g^-1 dry weight.

Total phenolic compounds The pellet was extracted with 5 mL 80% (v/v) methanol at 70_C for 1 h with continual shaking, and centrifuged (15 000 g for 15 min at 2_C) whilst the supernatant dried in moving air. Dry residues were re-dissolved in 0.2 mL acetonitrile and used for HPLC analysis [28].

Assays of Enzymatic Antioxidant Activities

Peroxidase (POD) was extracted according to enzymes extraction method and then activity was estimated at 25°C in a 3.0- ml cuvette containing 60 mM potassium phosphate buffer (pH 6.1), 16 mM guaiacol, 2.0 mM H2O2 and 0.1 ml diluted (10 times) enzyme extract [29]The increase in absorbance was recorded at 470 nm spectrophotometerically, over a period of 10 min.

Molecular

Quantitative-Real time PCR (qRT-PCR)

The transcript levels of Proline oxidase and Sucrose synthase (an osmoproctant and responsive for accumulation of sucrose under drought stress), (Table 6) were quantified using quantitative real-time (qRT-PCR) in ten sugarcane genotypes under the three drought stress treatments.

Total RNA isolation

Leaves tissues of control and treated sugarcane cuttings were stored at −80°C. The frozen tissues were thawed on ice and 100 mg of each frozen sample was used for RNA extraction. Quantitative real-time polymerase chain reaction using SYBR green I depend on cDNA synthesis conditions by method of [30].

Table 6 Name and sequence of primers used in Quantitative-Real Time PCR (qRT- PCR) analysis.

Gene	Primer sequence (5′–3′) Forward	Reverse	Accession number	References
GAPDH	CACGGCCACTGGAAGCA	TCCTCAGGGTTCCTGATGCC	CA254672	[31]
POX	CGAGCGTGTGCATCAAGATC	GTCTTCCATGGCAGGTTGAAC	XM_002467483	[32]
ScSuSy1	TGGTCCGGCTGAGATCATC	TCCAGTGGCTCGAATCTGTCTG	AGI56230.1	[33]

Calculation of relative gene expression

The Comparative Threshold Cycle (CT) values were exported into a spreadsheet and the relative expression of each sample was calculated according to the method of [34] , glyceraldehyde 3-phosphate dehydrogenase (GAPDH ), (Table 6) was the reference gene to normalize expression values in the different samples [35]., [31]. At first, the CT values of the target gene were normalized to that of the reference gene (GAPDH) for both control and test sample, where Δ CT (test) = CT (target, test) – CT (reference, test), Δ CT (control) = CT (target, control) – CT (reference, control). Second, Δ CT of the test sample was normalized to the Δ CT of the control sample, where ΔΔ CT (test) = Δ CT (test) − Δ CT (control). Finally, the relative gene expression was calculated as follows: 2−ΔΔCT = Normalized gene expression. Relative transcript levels (RTL) were calculated as follows: RTL =2-ΔCt, ΔCT = CT (target gene) − CT (constitutive control gene).

The result obtained is the fold increase (or decrease) of the target gene in the test sample relative to the control and is normalized to the expression of the reference gene. Normalizing the expression of the target gene to that of the reference gene compensates for any difference in the amount of the sample tissue.

Statical analysis

The results obtained from different experiments were expressed as mean values ± standard deviation (SD). The significance of the difference between mean values was determined at P < .05 using Minitab and Genstat 10th addition windows software. (VSN International Ltd. Herts, UK) programs. One way analysis of variance (ANOVA) for all experimental data was performed using SPSS 20 Statistical Analysis Software following the methods of [36].

Abbreviation	Synonymous
ETO	RefRReference evapotranspiration
RT-qPCR	Quantitative real-time PCR
ROS	Reactive oxygen species
DAP	Days after planting
POD	Peroxidase
POX	proline oxidase
ScSuSy1	Sucrose synthase 1
SMC	Soil Moisture Content
PM	Penman Monteith
ET crop	Crop Water Requirement
CT	Comparative Threshold Cycle
GAPDH	Glyceraldehyde 3-phosphate dehydrogenase
RTL	Relative transcript levels

Ethics approval and consent to participate

All methods complied with relevant institutional, national, and international

guidelines and legislation.

Consent for publication

Not applicable.

Availability of data and materials

All the data generated or analyzed during the current study were included in the manuscript. The raw data is available from the corresponding author on reasonable request.

Competing interests

The author(s) declare no conflicts of interest.

Funding

Not available any source for supporting this paper.

Authors' contributions

A.A, A.E, A.S, A.M and E.M conceived the research. A.S, E.M and A.M performed the experiments. A.A, A.S and A.M developed the experimental materials. A.S and E.M performed the productivity assessment. A.S performed the biochemical assessment. A.M and A.S performed the molecular assessment and A.A and A.S wrote the manuscript.

All authors read and approved the final manuscript.

Acknowledgements

"Not applicable "for that section.

Ethics approval and consent to participate

"Not applicable" in this section.

Consent for publication

“Not applicable” in this section.

Availability of data and materials

The authors confirm that all methods were carried out in accordance with

relevant guidelines and regulations

Carlin SD, Santos DMMd: Indicadores fisiológicos da interação entre déficit hídrico e acidez do solo em cana-de-açúcar. Pesquisa agropecuária brasileira 2009, 44:1106-1113.
Montesinos‐Pereira D, Barrameda‐Medina Y, Romero L, Ruiz J, Sánchez‐Rodríguez E: Genotype differences in the metabolism of proline and polyamines under moderate drought in tomato plants. Plant Biology 2014, 16(6):1050-1057.
Reddy AR, Chaitanya KV, Vivekanandan M: Drought-induced responses of photosynthesis and antioxidant metabolism in higher plants. Journal of plant physiology 2004, 161(11):1189-1202.
Pintó-Marijuan M, Munné-Bosch S: Ecophysiology of invasive plants: osmotic adjustment and antioxidants. Trends in Plant Science 2013, 18(12):660-666.
Ahanger MA, Tyagi SR, Wani MR, Ahmad P: Drought Tolerance: Role of Organic Osmolytes, Growth Regulators, and Mineral Nutrients. In: Physiological Mechanisms and Adaptation Strategies in Plants Under Changing Environment: Volume 1. Edited by Ahmad P, Wani MR. New York, NY: Springer New York; 2014: 25-55.
Abbas S, Ahmad S, Sabir S, Shah A: Detection of drought tolerant sugarcane genotypes (Saccharum officinarum) using lipid peroxidation, antioxidant activity, glycine-betaine and proline contents. Journal of soil science and plant nutrition 2014, 14(1):233-243.
Bajji M, Lutts S, Kinet JM: Physiological Changes after Exposure to and Recovery from Polyethylene Glycol-induced Water Deficit in Callus Cultures Issued from Durum Wheat (Triticum durum Desf.) Cultivars Differing in Drought Resistance. Journal of Plant Physiology 2000, 156(1):75-83.
Verbruggen N, Hermans C: Proline accumulation in plants: a review. Amino Acids 2008, 35(4):753-759.
Molinari HBC, Marur CJ, Daros E, De Campos MKF, De Carvalho JFRP, Filho JCB, Pereira LFP, Vieira LGE: Evaluation of the stress‐inducible production of proline in transgenic sugarcane (Saccharum spp.): osmotic adjustment, chlorophyll fluorescence and oxidative stress. Physiologia Plantarum 2007, 130(2):218-229.
Liang X, Zhang L, Natarajan SK, Becker DF: Proline Mechanisms of Stress Survival. Antioxidants & Redox Signaling 2013, 19(9):998-1011.
Das K, Roychoudhury A: Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Frontiers in environmental science 2014, 2:53.
Iskandar HM, Casu RE, Fletcher AT, Schmidt S, Xu J, Maclean DJ, Manners JM, Bonnett GD: Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms. BMC Plant Biology 2011, 11(1):1-14.
Yadav R, Prasad S: Moisture use characteristics of sugarcane genotypes under different available soil moisture regimes in alluvial entisols. The Journal of Agricultural Science 1988, 110(1):5-11.
Gomathi R, Krishnapriya V, Arunkumar R, Govindaraj P, Ram B: Physiological traits imparting drought stress tolerance to promising sugarcane (Saccharum spp.) clones. Plant Physiology Reports 2020, 25(3):509-515.
Cia MC, Guimarães A, Medici L, Chabregas S, Azevedo R: Antioxidant responses to water deficit by drought‐tolerant and‐sensitive sugarcane varieties. Annals of Applied Biology 2012, 161(3):313-324.
Jain R, Chandra A, Venugopalan VK, Solomon S: Physiological changes and expression of SOD and P5CS genes in response to water deficit in sugarcane. Sugar Tech 2015, 17(3):276-282.
Kar RK: Plant responses to water stress: role of reactive oxygen species. Plant signaling & behavior 2011, 6(11):1741-1745.
Guimarães ER, Mutton MA, Mutton MJR, Ferro MIT, Ravaneli GC, Silva JAd: Free proline accumulation in sugarcane under water restriction and spittlebug infestation. Scientia agricola 2008, 65:628-633.
Munawarti A, Taryono T, Semiarti E, Sismindari S: Morphological And Biochemical Responses Of Saccharum Spontaneum L. Accessions To Drought Stress. Journal of Tropical Life Science 2014, 4(1):61-66.
Ruiz JM, Romero L: Bioactivity of the phenolic compounds in higher plants. Studies in natural products chemistry 2001, 25:651-681.
Wahid A, Ghazanfar A: Possible involvement of some secondary metabolites in salt tolerance of sugarcane. Journal of Plant Physiology 2006, 163(7):723-730.
Ali Q, Ashraf M, Anwar F: Seed composition and seed oil antioxidant activity of maize under water stress. Journal of the American Oil Chemists' Society 2010, 87(10):1179-1187.
Gill SS, Tuteja N: Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant physiology and biochemistry 2010, 48(12):909-930.
Sharma P, Jha AB, Dubey RS, Pessarakli M: Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. Journal of botany 2012, 2012.
Sentelhas PC, Gillespie TJ, Santos EA: Evaluation of FAO Penman–Monteith and alternative methods for estimating reference evapotranspiration with missing data in Southern Ontario, Canada. Agricultural water management 2010, 97(5):635-644.
Allen RG, Pereira LS, Raes D, Smith M: Crop evapotranspiration-Guidelines for computing crop water requirements-FAO Irrigation and drainage paper 56. Fao, Rome 1998, 300(9):D05109.
Bates LS, Waldren RP, Teare I: Rapid determination of free proline for water-stress studies. Plant and soil 1973, 39(1):205-207.
Santiago R, De Armas R, Legaz M, Vicente C: Changes in phenolic acids content, phenylalanine ammonia-lyase and peroxidase activities in sugarcane leaves induced by elicitors isolated from Xanthomonas albilineans. Australasian Plant Pathology 2009, 38(4):357-365.
Castillo FJ, Penel C, Greppin H: Peroxidase Release Induced by Ozone in Sedum album Leaves: Involvement of Ca2+. Plant Physiology 1984, 74(4):846-851.
Lekanne Deprez RH, Fijnvandraat AC, Ruijter JM, Moorman AFM: Sensitivity and accuracy of quantitative real-time polymerase chain reaction using SYBR green I depends on cDNA synthesis conditions. Analytical Biochemistry 2002, 307(1):63-69.
Iskandar HM, Simpson RS, Casu RE, Bonnett GD, Maclean DJ, Manners JM: Comparison of reference genes for quantitative real-time polymerase chain reaction analysis of gene expression in sugarcane. Plant Molecular Biology Reporter 2004, 22(4).
Delauney AJ, Verma DPS: Proline biosynthesis and osmoregulation in plants. The plant journal 1993, 4(2):215-223.
Thirugnanasambandam PP, Mason PJ, Hoang NV, Furtado A, Botha FC, Henry RJ: Analysis of the diversity and tissue specificity of sucrose synthase genes in the long read transcriptome of sugarcane. BMC Plant Biology 2019, 19(1):1-14.
Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods 2001, 25(4):402-408.
Bottcher A, Cesarino I, Brombini dos Santos A, Vicentini R, Mayer JLS, Vanholme R, Morreel K, Goeminne G, Moura JCMS, Nobile PM: Lignification in sugarcane: biochemical characterization, gene discovery, and expression analysis in two genotypes contrasting for lignin content. Plant Physiology 2013, 163(4):1539-1557.
Sokal RR, Rohlf FJ: The comparison of dendrograms by objective methods. Taxon 1962:33-40.

No competing interests reported.

Biochemical and Molecular Evaluation of Drought Tolerance promising sugarcane (Saccharum spp.)

Status:

Version 1

Abstract

Background:

Results:

Conclusion:

Figures

Background

Results

Discussions

Conclusion

Materials And Methods

abbreviations

Declarations

References

Additional Declarations

Status:

Version 1