Mouse models and treatment
C57BL/6 mice (8 weeks old), Cx3cr1Cre mice and AIM2fl/fl were all male and provided from the Model Animal Research Center of Nanjing University. AIM2fl/fl mice were crossed with the Cx3cr1Cre transgenic mice to generate AIM2-cKO mice. The construction of AIM2 overexpression lentivirus as well as control lentivirus was completed by GeneChem Corporation (Shanghai, China). For virus injection into the hippocampal region, mice were anaesthetized and placed in a stereotaxic frame. The coordinates were 1.82 mm posterior to the bregma, 1.13 mm lateral to the midline and 1.25 mm below the surface of the skull. Human Aβ1−42 (Millipore, Darmstadt, Germany) was prepared as previously described and 4 µg Aβ1−42 was injected into the hippocampal region of AIM2-cKO mice and AIM2fl/fl mice using stereotaxic apparatus. Behavioral experiments and electrophysiological recordings were performed 2 weeks after injection. All experiments related to animals were approved by the Institutional Animal Care and Use Committee (IACUC) of Nanjing University.
Behavioural Experiments
Open field
The open-field test for the assessment of mobility and anxiety was performed as previously described. Each individual mouse from the different groups was placed in a 48 cm × 48 cm ×36 cm open field box that was divided into 16 squares of equal area and recorded for 10 min. The open field area was cleaned with 75% ethanol to minimize olfactory cues. Locomotor activity measurements and time spent in the center and corner zone were quantified by ANY-maze software (Stoelting, USA).
New Object Recognition (Nor)
Novel object recognition (NOR) test was conducted to measure the recognition memory of mice in a nontransparent box measuring 30 × 30×45 cm high. Prior to testing, mice were habituated to the behavioral testing environment for 3 consecutive days (10 min per day). The mice were placed in the box containing two identical objects (A and B) placed symmetrically during the 10-min training session. During the test session, one of the two identical objects (B) was replaced with a novel object (C) and the mice were allowed to freely explore the objects for 5 min. The time spent in exploring the novel object was analyzed and the discrimination index was calculated as time spent in exploring the novel object / total time spent in exploring objects during the test phase.
Morris Water Maze
The Morris water maze test was performed to evaluate spatial learning and memory of the mice as previously described. Briefly, the mice were trained to find the hidden platform submerged 1cm below the surface for 5 consecutive days. The latency in the training stage was recorded and analyzed using ANY-maze software. For probe trials, the mice were allowed to swim for 60 s freely with the platform removed. Then the swimming speed, platform crossings, the escape latency and time spent in the target quadrant were recorded.
Quantitative Real-time Pcr
The Total RNA from treated cells and tissue was extracted using Trizol reagent kit (Invitrogen, USA) according to the standard protocol. The cDNA was synthesized from total RNA by PrimeScript RT Reagent kit (Takara). Quantitative PCR analysis was performed using an ABI 7500 PCR instrument (Applied Biosystems) with the SYBR Green PCR kit (Takara). The relative expression levels of each gene shown were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primers used were as follows:
Gene | Primer |
GAPDH | F: GCCAAGGCTGTGGGCAAGGT R: TCTCCAGGCGGCACGTCAGA |
AIM2 | F: CTCAGGAAGGAAGACAAGA R: GATTCAACATCAACCACAAC |
C1Q | F: CACCGTGCTTCAGCTGCGACGAG R: TTGCGGGGTCCTTTTCGATCCAC |
C3 | F: ACTGTGGACAACAACCTACTGC R: GCATGTTCGTAAAAGGCTCGG |
Western Blotting
Western blotting
Brain tissues were lysed with RIPA buffer plus protease inhibitor. The protein concentration was measured using the BCA Assay (Thermo Fisher Scientific). Equal amounts of protein samples were subjected to 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membrane (EMD Millipore). Membranes were blocked for 2 h at room temperature using 5% non-fat milk in Tris-Buffered Saline Tween 20 (TBST), subsequently incubated overnight at 4°C with the following primary antibodies: mouse anti-MAP 2 (1:1000, Abcam, ab11267), rabbit anti-MAP 2 (1:1000, Bioworld, BS3487), rabbit anti-PSD 95 (1:1000, Abcam, ab18258), mouse anti-PSD 95 (1:1000, Abcam, ab2723), rabbit anti β-actin (1:1000, Bioworld, AP-0060), and rabbit anti-AIM2 (1:500, Abcam, ab119791). The membranes were then incubated for 2 h at room temperature with HRP-conjugated secondary antibodies (1:5000). Bands of western blotting were visualized in a Gel-Pro system (Tanon Technologies, Shanghai, China), and protein density was analyzed and quantified using ImageJ software.
Immunofluorescence Staining
For sectioning, the tissues were embedded in OCT and sectioned coronally at 20µm thickness. Brain sections were permeabilized using PBS containing 0.25% triton X-100 (PBST) and blocked with 2% BSA at room temperature for 2 h. Subsequently, the brain sections were incubated with primary antibodies as follows at 4°C overnight: rabbit anti IBA-1 (1:500, Abcam, ab178846); mouse anti-AIM2 (1:200, Santa Cruz Biotechnology, sc-515514); rat anti-CD68 (1:500, Abcam, ab53444); mouse anti-PSD 95 (1:1000, Abcam, ab2723); chicken anti-MAP 2 (1:1000, Abcam, ab5392); rat anti-C1q (1:500, Abcam, ab11861); rat anti-C3 (1:500, Abcam, ab11862). The sections were then incubated with secondary antibodies (Invitrogen, 1:500) at room temperature for 2 h and counterstained with DAPI (1:1000, Bioworld, Louis Park, MN, USA) for 20 min. The images were captured using a fluorescence microscope (Olympus IX73) or confocal laser-scanning microscope (Olympus FV3000) and analyzed with Image J software. Three-dimensional (3D) reconstruction was obtained using the Imaris software (Bitplane).
Electrophysiology
Acute hippocampal slices (300 µm) were prepared as described previously. Before recordings, the slices were incubated in circulating artificial cerebrospinal fluid (ACSF) gassed with 95% O2 and 5% CO2 at room temperature for at least 2 h. Slices were then transferred into the microelectrode array continuously perfused with oxygenated ACSF (32°C) at a flow rate of 2 ml/min. Field excitatory post-synaptic potentials (fEPSPs) from the stratum radiatum of CA1 were recorded using MEA-2100-60-System (Multi Channel Systems, Reutlingen, Germany). To evaluate the input-output relationships, the slope of fEPSPs was recorded. For LTP experiments, half of the maximum evoked response was utilized as the stimulation intensity. After 30 min of stable baseline fEPSPs, the LTP was induced with high-frequency stimulation (100 Hz, three trains, 1-s duration, 10-s interval). We measured the initial slopes of fEPSP and normalized them to the average fEPSP slope during baseline period. Data acquisition was done on the LTP-Director software and data analysis with the LTP-Analyzer software.
Golgi Staining And Sholl Analysis
Golgi staining was performed with a FD Rapid Golgi stain kit (FD Neurotechnologies, Columbia, USA). The brains were immersed in a 1:1 mixture of solutions A and B at room temperature in the dark for 14 days and then transferred into solution C for at least 3 days. Afterwards, coronal brain slices (100 µm) were sectioned with cryostat microtome (Leica, Wetzlar, Germany) and stained according to manufacturer’s protocol. Images were acquired using Olympus IX73 and analyzed with ImageJ software (Fiji, NIH).
Statistical analysis
All statistical analysis results were presented as means ± SEM, and the analysis was performed with SPSS 17.0 software (SPSS, Chicago, IL, USA). An unpaired Student’s t test was employed to compare the two datasets, while one-way or two-way analysis of variance (ANOVA) with the Bonferroni post hoc test was used for comparisons between more than two groups. The statistical significance was assumed when the P-value was < 0.05.