Abnormal changes of IL3/IL3R and its downstream signaling pathways in the prion infected cell line and in the brains of scrapie infected rodents

doi:10.21203/rs.3.rs-2634283/v1

Download PDF

Research Article

Abnormal changes of IL3/IL3R and its downstream signaling pathways in the prion infected cell line and in the brains of scrapie infected rodents

https://doi.org/10.21203/rs.3.rs-2634283/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 07 Aug, 2023

Read the published version in Molecular Neurobiology →

You are reading this latest preprint version

Interleukin 3 (IL-3) plays an important role in hematopoiesis and immune regulation, brain IL-3/IL-3R signaling has been shown to involve in the physiological and pathological processes of a variety of neurodegenerative diseases, but its role in prion diseases is rarely described. Here, the changes of IL-3/IL-3R and its downstream signaling pathways in a scrapie infected cell line and in the brains of several scrapie infected rodent models were evaluated by various methods. Markedly decreased IL-3Rα were observed in the brains of scrapie infected rodents at terminal stage and in the prion infected cell model, which showed increased in the brain samples collected at early and middle stage of infection. The IL-3 levels were almost unchanged in the brains of scrapie infected mice and in the prion infected cell line. Morphological assays identified close co-localization of the increased IL-3Rα signals with NeuN- and Iba1-positive cells, whereas co-localization of IL-3 signals with NeuN- and GFAP-positive cells in the scrapie infected brain tissues. Some downstream components of IL-3/IL-3R pathways, including JAK2-STAT5 and PI3K/AKT/mTOR pathways, were downregulated in the brains of scrapie infected rodents at terminal stage and in the prion infected cells. Stimulation of recombinant IL-3 on the cultured cells showed prion that the prion infected cells displayed markedly more reluctant responses of JAK2-STAT5 and PI3K/AKT/mTOR pathways than the normal partner cells. These data suggest that although prion infection or PrP^Sc accumulation in brain tissues does not affect IL-3 expression, it significantly downregulates IL-3R levels, thereby inhibiting the downstream pathways of IL-3/IL-3R and blocking the neuroregulatory and neuroprotective activities of IL-3.

prion

IL-3

IL-3R

JAK2-STAT5

PI3K/AKT/mTOR

Prion disease is a kind of fatal degenerative encephalopathy that attacks the central nervous system in humans and many animals, also known as transmissible spongiform encephalopathies (TSEs), such as Creutzfeldt-Jakob disease (CJD), fatal familial insomnia (FFI), Gerstmann-Sträussler-Scheinker syndrome (GSS), and Kuru in humans, scrapie in sheep, bovine spongiform encephalopathy (BSE) in cattle, and chronic wasting disease (CWD) in elk [1]. The typical neuropathological features of prion disease include aggregation of amyloid, vacuole-like denaturation, loss of neurons, and activation of glial cells [2, 3]. Numerous studies have demonstrated that in the early stage of prion infection, microglia are activated and acquire phagocytic phenotype, which produce a variety of anti-inflammatory factors to help alleviate the inflammatory response to PrP^Sc. However, along with the infection, the activated microglia gradually convert to the proinflammatory phenotype, secreting proinflammatory factors and causing neuronal damage [4]. Therefore, the status of microglia plays an important role in the pathogenesis of prion diseases.

Interleukin 3 (IL-3) plays a robust role in hematopoiesis and immune regulation [5]. The biological activity of IL-3 is mediated mainly by binding to the specific receptor IL-3R on cell surface, which is a heterodimer composed of α and β subunits. The α subunit of IL-3R is responsible for the specific binding of IL-3 and the β subunit is responsible for the recognition of the binding [6]. Several pathways, e.g., JAK2/STAT5, PI3K/AKT/PKB, and Ras/Raf/MAP, are considered as the downstream pathways of IL-3/IL-3R signaling [7]. Brain IL-3/IL-3R signaling has been shown to involve in the physiological and pathological processes of a variety of neurodegenerative diseases, revealing a neuroprotective role in Alzheimer's disease (AD) [8, 9]. IL-3 exerts strong macrophage activation that is associated with T cell-dependent immune responses [10, 11]. The astrocyte-derived IL-3 is able to stimulate the growth and proliferation of microglia in vitro [12]. Recently, McAlpine and colleagues have found that in AD brains, astrocytes constitutively produce IL-3 and subsequently induce transcriptional and morphological changes and functional programming in microglia. Such acute immune response program is conducive to remove Aβ and tau aggregation and to limit the pathological progress and cognitive decline of AD [13]. However, the changes of IL-3/IL-3R and related signaling pathways in prion disease are rarely reported.

Prion disease shares a series of pathophysiological similarities as AD, among them one of the core contents is deposits of the misfolded proteins in the tissues of central nerve system (CNS). In the present study, the potential changes of IL-3/IL-3R signaling in prion infection were evaluated in several prion infected rodent models and a prion infected model. We found that the IL-3Rα levels decreased in the brains of scrapie infected animals at terminal stage and in prion infected cell line, whilst revealed an increased status in the middle stage of infection. The IL-3 levels were almost unchanged both in the brains of scrapie infected rodents and in prion infected cell line. Double stained IFAs illustrated morphological co-localization of IL-3Rα with NeuN- and Iba1-positive cells, whereas co-localization of IL-3 with NeuN- and GFAP-positive cells in the brain tissues. Some components in the downstream pathways of IL-3/IL-3R signaling were downregulated in the brains of scrapie infected rodents at the terminal stage and in the prion infected cells. Although treatment of recombinant IL-3 upon prion infected cells can induce corresponding responses of the downstream pathways in vitro, but markedly less active compared to its normal partner cells.

Ethics statement

Usage of animal samples in this study was approved by the Ethical Committee of the National Institute for Viral Disease Prevention and Control, China CDC. Animal housing and experimental protocols were in accordance with the Chinese Regulations for the Administration of Affairs Concerning Experimental Animals.

Cell culture

Cell line SMB-S15 and its normal partner cell line SMB-PS were acquired from Roslin Institute, UK [14]. Cell line SMB-S15 was originally established by culturing the brain tissues from a mouse infected with scrapie strain Chandler, in which PrP^Sc replicates persistently by cell passage. Cell line SMB-PS was established by treating SMB-S15 cells with pentose which was free of prion replication [15]. Microglia cell line BV2, mouse neuroblastoma cell line N2a, and human neuroblastoma cell line SH-SY5Y were kept in housing. Cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 33°C in a humidified incubator with 5% CO₂.

Preparation of cell lysates

Cells were harvested and centrifugated with low speed centrifugation at 500×g for 10 min. The pellets were resuspended in a cold lysis buffer (P0013B, Beyotime, China) supplemented with the protease inhibitor cocktails set III (535140, Merck, USA), and maintained on ice for 30 min. The supernatants were harvested and aliquoted for further study after determination of the protein concentration by a BCA method (71285-3, Merck, USA).

Brain samples of scrapie infected mouse models

The brain samples of C57BL/6 mice inoculated intracerebrally with mouse-adapted scrapie strains 139A and ME7, as well as the hamsters inoculated intracerebrally with hamster-adapted scrapie agent 263K, were enrolled in this study. The clinical, neuropathological and pathogenic features of these infected experimental rodents were described elsewhere[16]. The average incubation times of 139A-, and ME7-infected mice were 183.9 ± 23.1 and 184.2 ± 11.8 days, and that of 263K-infected hamsters was 66.7 ± 1.1 days, respectively. Age matched healthy animals were used as control.

Preparation of brain homogenates

Brain homogenates were prepared based on the protocol described previously [17]. Whole brain tissues from the 263K-infected hamsters and controls were washed in TBS (10 mM Tris-HCl, 133 mM NaCl, pH 7.4) for three times, and then 10% (w/v) brain homogenates were prepared in cold lysis buffer (100 mM NaCl, 10 mM EDTA, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, 10 mM Tris, pH 7.5) with protease inhibitor cocktail set III (Merck, 535140, USA). The tissue debris was removed with low speed centrifugation at 2000×g for 10 min and the supernatants were collected for further study.

Western blots

Aliquots of brain homogenates or cell lysates were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and electro-transferred onto nitrocellulose membranes. Membranes were blocked with 5% (w/v) skimmed milk in 1 × Tris-buffered saline containing 0.1% Tween 20 (TBST) at room temperature (RT) for 30 min and incubated with various primary antibodies against PrP (1:1000, 6D11, Santa Cruz, USA), IL-3Rα (1:1000, 141039, USBiological, USA), IL-3R\({\alpha }\) (1:500,40185, SAB, USA), IL-3 (1:1000,503901, Biolegend, USA), JAK2 (1:250, sc-390539, Santa Cruz, USA), p-JAK2 (1:1000, YP0115, Immunoway, USA), STAT5 (1:250, sc-74442, Santa Cruz, USA), p-STAT5 (1:250, sc-81524, Santa Cruz, USA), PI3K (1:1000, 4257T, Cell Signaling Technology, USA), mTOR (1:1000, 2952T, Cell Signaling Technology, USA), p-mTOR (1:1000,2448, Cell Signaling Technology, USA), p-mTOR (1:1000, 2481, Cell Signaling Technology, USA), AKT (1:500, sc-5298, Santa Cruz, USA) and β-actin (1:5000, TA-09, ZSGB-BIO, China) at 4°C overnight. After washing with TBST, membranes were subsequently incubated with individual HRP-conjugated secondary antibodies and reactive signals were developed using a commercial ECL kit. Images were captured by ChemiDocTM XRSC Imager (Bio-Rad, USA). To detect the presences of PK resistant PrP^Sc, the cell lysates were digested with a final concentration of 20 µg/ml PK at 37°C for 60 min prior to Western blots. The PK digestion was stopped by incubating the samples at 100°C for 10 min.

Immunofluorescence assay (IFA)

Brain tissues of normal and scrapie infected rodents were fixed in 10% buffered formalin solution and paraffin sections (5 µm in thickness) were prepared routinely. Subsequently, brain sections were subjected to permeate with 0.3% Triton X-100 in PBS for 30 min and blocked with normal goat serum for 1 h. After blocked, sections were incubated with 1:200-diluted anti-IL-3Rα (141039, USBiological, USA), 1:200-diluted anti-IL-3 (1:1000,503901, Biolegend, USA), 1:200-diluted anti-NeuN (MAB377, Merck, USA), 1:200-diluted anti-GFAP (GTX-34759, GeneTex, USA), 1:200-diluted anti-Iba1 (SAB2702364, Merck, USA), in dilution solution (PBS with 2% BSA and 0.3% Triton X-100) at 4°C overnight. The sections were subsequently incubated with 1:200-diluted Alexa Fluor 488-labeled goat-derived anti-rabbit (A11034, Invitrogen, USA) and Alexa Fluor 568-labeled goat-derived anti-mouse (A11031, Invitrogen, USA) secondary antibodies at 37°C for 1 h. After removing secondary antibodies, DAPI were used to stain the nucleus at final concentration of 1 mg/ml at RT for 30 min. Slices were sealed, the images of the targeting proteins were viewed and analyzed using a confocal microscopy (LEICA, TCS/SP8, Germany). The integral optical density (IOD) values of each field-specific fluorescence staining were collected. The IOD values of the specific stainings were determined relative to that of DAPI-specific staining.

Quantitative real-time PCR (qPCR)

Real-time PCR was performed with Power SYBR Green PCR master mix (Applied Biosystems, TSE202, USA) in an ABI 7900HT Fast Sequence Detector (Applied Biosystems, USA). Total RNA was extracted from brain tissues and cultured cells with Trizol reagent (15596026, Gibco, USA) and then subjected to first-strand cDNA synthesis with reverse transcription system (11752050, Invitrogen, USA) according to the manufacturer’s protocols. The specific primers were designed based on the sequences of mouse IL-3, IL-3Rα, and GAPDH genes in GenBank (NM_000588.4, NM_008369, and M88109.1). The primer sequences are as follows: IL-3 (forward:5′-GCCAGGGGTCTTCATTCGAG-3′; reverse:5′TTCCACGGTTCCACGGTTAG-3′), IL-3Rα (forward:5′- ATGGCCGCCAACCTGTGGCTC − 3′; reverse: 5′GCAGGACCGAGCCGCACATCA − 3′), and GAPDH (forward:5′-TTTGCAGTGGCAAAGTGGAG-3′; reverse: 5′GATGGGCTTCCCGTTGATGA-3′). PCR amplification was performed in triplicate with a total of 40 cycles (30 s at 95°C, 30 s at 60°C, and 60 s at 72°C). The comparative Ct (the fractional cycle number at which the amount of amplified target reached a fixed threshold) method was used for the relative quantitative detection of the expressions of the target gene. The relative Ct for the target gene was subtracted from the Ct for the GAPDH gene using the comparative Ct method (2^-△△Ct).

Cell viability assay

Cell viability was determined using the CCK-8 cell counting kit (CK04, Dojindo, Japan). Briefly, 4,000 cells per well were plated in a 96-well plate and incubated overnight for adherence. According to the assigned protocol, 10 µl CCK-8 reagent was added in each well at 37°C for 4 h. Absorbance was measured at 450 nm with a spectrophotometer. Each experiment was performed in triplicate and repeated two times.

Statistical analysis

Quantitative analysis of the images of immunoblot and the colocalized degree in IFA were carried out using software Image J. Quantification of IFA was represented as IOD that is the sum of the reaction intensities of all selected objects in the field of view. The Pearson’s correlation coefficient (r) represented the degree of the colocalization in IFA and were described as strong (r > 0.8), medium (0.5 < r < 0.8), weak (0.3 < r < 0.5) and no correlation (0.2 < r < 0.4). Intensity of fluorescence was performed and analyzed by Operetta (PerkinElmer, USA). Data were presented as the mean + SEM. The p values for differences between two groups were determined by two-tailed Student’s t test. The p values were described as *** (p < 0.001), ** (p < 0.01), * (p < 0.05) and ns (not significant).

IL-3Rα decreases in the brains of scrapie infected rodent models at terminal stage and in a prion infected cell model

To address the potential changes of IL-3 receptor in the CNS tissues during prion infection, the brain samples of several scrapie infected mouse models collected at terminal stage (approximately 180 days post-infection, dpi) were enrolled into this study. A 47-kDa large band was detected in mouse brain homogenates in the IL-3Rα specific Western blots, whose intensities in the brains of 139A and ME7 infected mice were markedly weaker than that of normal control (Fig. 1A). IL-3Rα specific IFAs of brain sections illustrated obviously weaker specific signals (green) in the regions of cortex and hippocampus of 139A and ME7 infected mice, showing significantly low IOD values compared to that of normal mice (Fig. 1B). Western blots with anti-IL-3Rα of 263K infected hamsters at final stage (approximately 80 dpi) revealed significantly weaker blots compared to that of normal ones (Fig. 1C). Remarkable weaker signals (red) were also observed in the images of cortex and hippocampus of 263K infected hamsters in IL-3Rα specific IFAs (Fig. 1D).

Subsequently, the levels of IL-3Rα in the prion infected cell model were evaluated. qRT-PCR assays showed that the transcriptional levels of IL-3Rα (relative Ct values) in the prion infected cell line SMB-S15 were lower than that of control cell line SMB-PS (Fig. 2A). Remarkably weaker IL-3Rα band in Western blot (Fig. 2B) and lower IL-3Rα signal intensity in the image IFA (Fig. 2C) were also identified in the cell line SMB-S15. Those data strongly indicate a decreased level of IL-3Rα not only in the brains of scrapie infected rodent models at terminal stage, but also in the cultured cells with persistent propagation of PrP^Sc.

Brain IL-3Rα increases in the middle stage and decreases in the late stage during scrapie infection

To analyze the dynamic alteration of brain IL-3Rα in the period of prion infection, the brain samples of 139A and ME7 infected mice collected on 80, 120, 150 and 180 dpi, as well as those of 263K infected hamsters collected on 20, 40, 60 and 80 dpi were subjected into IL-3Rα specific Western blots. Compared to those of the brains at terminal stage (180 dpi), the IL-3Rα blots in the preparations of 120 and 150 dpi of 139A (Fig. 3A) and ME7 infected (Fig. 3B) mice were clearly stronger. Quantitative evaluations of the average gray values of the blots after normalized with that of β-actin showed that the higher levels of brain IL-3Rα of both in 139A and ME7 infected mouse models were identified in the samples of 120 and 150 dpi during infection, even the levels of IL-3Rα at relatively early stage were higher than that of terminal stage. Similar alterative pattern of brain IL-3Rα was also identified in the tests of 263K infected hamsters (Fig. 3C), that higher IL-3Rα levels were observed in the samples of 40 and 60 dpi while that of 80 dpi (terminal stage) was the lowest. It seems that brain IL-3Rα increases in the early stage, reaches to the peak in the middle and middle-late stage, and dropped down in the late stage of prion infection.

IL-3Rα distributes widely in NeuN- and Iba1-positive cells but not in GFAP-positive cells in CNS tissues

It is known that IL-3 receptor can be identified in different types of tissues and cells [18]. IFAs of IL-3Rα in different cultured cells verified specific positive green signals, including microglia cell line BV2, mouse neuroblastoma cell line N2a and human neuroblastoma cell line SH-SY5Y (Supp Fig. 1). To access the distribution of IL-3Rα in different types of cells in CNS tissues of normal and prion infected mice, the brain slices of 139A, ME7 mice at terminal stage and normal mice were double-stained with anti-IL-3Rα, together with anti-NeuN, anti-GFAP or anti-Iba1, immunofluorescently. Confocal microscopy illustrated clear overlapped signals (yellow) of IL-3Rα in NeuN- (Fig. 4A) and Iba1- (4C) positive cells but not in GFAP- (4B) positive cells in the regions of cortex and hippocampus. Besides, the NeuN-positive signals in normal brains and GFAP- and Iba1-positve signals in scrapie infected brains were markedly strong. It implies that IL-3Rα colocalizes mainly in neurons and microglia morphologically, both in normal and prion infected mouse brains.

IL-3 remains almost unchanged in the brains of scrapie infected mouse models and prion infected cell model

To see whether the brain IL-3 changes during prion infection, the brain homogenates of 139A and ME7 infected mice collected at terminal stage, controlled with that of normal mice, were subjected into Western blots with anti-IL-3. It showed that the brain levels of IL-3 of both 139A and ME7 infected mice were similar as that of normal control, without statistical difference in the quantitative assays (Fig. 5A). IL-3 specific IFAs also illustrated the similar signal (red) intensity between infected and normal mice, both in the regions of cortex and hippocampus (Fig. 5B). Subsequently, the IL-3 levels of SMB-S15 and SMB-PS cells were tested by Western blot. Comparable signal intensity was observed in those two SMB cell lines, without statistical difference in the quantitative assays (Fig. 5C).

Further, the IL-3 levels in the brain samples of 139A and ME7 infected mice collected at different time-points during incubation period were tested. Western blots revealed quite similar IL-3 levels among the tested samples without statistical difference in the quantitative assays, although the signals in the 150 dpi samples of ME7 infected mice slightly higher (Fig. 5D). IL-3 specific ELISA tests identified the similar profiles, that the IL-3 levels in the brain tissues of various time-points of 139A and ME7 infected mice were comparable without statistical difference (Fig. 5E).

IL-3 signals overlapped with astrocytes and neurons but not with microglia morphologically

To access the distributions of IL-3 in various types of cells in the CNS tissues, the brain sections of normal and scrapie infected mice collected at terminal stage were employed into IFAs double-strained with anti-IL-3, together with anti-NeuN, anti-GFAP or anti-Iba1. Obviously large amounts of yellow signals were detected in the merged images co-stained with anti-NeuN (Fig. 6A) and anti-GFAP (Fig. 6B) in the brains of infected and normal mice, showing strong and middle-strong correlations in the Pearson’s correlation coefficient tests. On the contrary, limited yellow signals were detectable in the slices co-stained with anti-Iba1, with significantly less values in the Pearson’s correlation coefficient tests (Fig. 6C). It implies strong colocalization of IL-3 with astrocytes and neurons but weak colocalization with microglia in CNS tissues morphologically.

Some downstream components of IL-3/IL-3R pathway are downregulated in the brains of scrapie infected rodents at terminal stage and the prion infected cells

To test the possible influence of the reduction of IL-3R on the downstream pathways, some essential components were selected and their levels in the brains of scrapie infected rodents at terminal stage and the prion infected cells were analyzed by Western blots, including JAK2 and phosphor-JAK2 (p-JAK2), STAT5 and phosphor-STAT5 (p-STAT5) in the pathway of JAK2-STAT5, as well as PI3K, mTOR and phosphor-mTOR (p-mTOR) in the pathway of PI3K-AKT-mTOR. Decreases of JAK2 and p-JAK2 in the brains of 139A infected mice and in SMB-S15 cells, as well as decreases of STAT5 and p-STAT5 in SMB-S15 cells, were noticed in the individual Western blots, with significance compared to their normal controls in quantitative assays (Fig. 7A). Significant reductions of PI3K in SMB-S15 cells, reductions of mTOR and p-mTOR in 263K infected hamsters and SMB-15 cells, were also identified in Western blots (Fig. 7B). It indicates that the downstream pathways of JAK2-STAT5 and PI3K-AKT-mTOR may downregulate along with the reduction of IL-3R in the prion infected brain tissues in vivo and the cultured cells in vitro.

Treatment of recombinant IL-3 upon prion infected cells induces less active response in vitro

To see whether SMB-S15 cells with downregulated IL-3R still have the reactivity to the stimulation of IL-3, SMB-S15 and -PS cells were exposed to a commercial recombinant IL-3 (rIL-3). CCK8 assays verified that the cell viability of those two SMB cell lines did not change significantly in the conditions of 20, 50 and 100 ng/ml rIL-3 (Fig. 8A). After exposed to 50 ng/ml rIL-3, cells were harvested 5, 10, 30, 60, 120 min post-treatment separately. Western blots of the extracted cell lysates showed that the signals of the tested downstream components were increased at different levels in those two SMB cell lines after exposed to rIL-3, including JAK2, AKT, p-mTOR and p-ERK (Fig. 8B). Quantitative assays revealed that compared to the values of each blot without rIL-3 treatment (set as 1.0), the increasements of all tested proteins in rIL-3 treated SMB-PS cells were much notable and maintained at high levels for relatively long time, while that in SMB-S15 cells were remarkably limited and dropped down quickly (Fig. 8C). It indicates a hampered reaction in prion infected cells to the stimulation of rIL-3, possibly associated with its downregulated level of cellular IL-3Rα.

In the present study, the changes of brain IL-3/IL-3Rα levels during prion infection in several prion infected rodent models have been assessed. Decreased IL-3Rα and unchanged IL-3 in the infected brains have been proposed with various methods. Similar profile of IL-3/IL-3Rα is also observed in a prion infected cell line. In line with the depression of IL-3/IL-3Rα signaling, some downstream components are downregulated in the brains of scrapie infected rodents at terminal stage and in the prion infected cell model. Stimulation of recombinant IL-3 induces remarkably less response of the downstream components of IL-3/IL-3Rα pathway in the prion infected cells compared to the normal ones. Apparently, IL-3/IL-3Rα signaling is downregulated in the cells and tissues with active propagation of prions.

IL-3 is a multifunctional cytokine implicated in inflammatory and autoimmune diseases, functioning via binding with its sole receptor IL-3Rα [19]. In neurodegenerative diseases, IL-3 has been shown to prevent amyloid-induced neuronal death [20] and the delayed neuronal death in the hippocampal CA1 region [21]. IL-3 can induce the expression of CD40 and major histocompatibility complex (MHC) Class II antigens, and promote the migration and phagocytosis of microglia cells (Appel et al. 1995; Alderson et al. 1993). A recent study on AD verifies that IL-3 secreted by astrocytes can combine with IL-3Rα on the surface of microglia to regulate the reprogramming of microglia, immune response, motor response of microglia, and promote microglia to gather around Aβ and phagocytose Aβ, thus, ameliorating the pathological damage of AD [13]. In an AD mouse model, the level of brain IL-3Rα shows upregulating trend [13], which seems to be opposite to the observations at terminal stage of prion infection in this study. Actually, our data here demonstrate the increased brain IL-3Rα levels in the prion infected rodents at the early and middle stage, which may highlight an activating situation of IL-3/IL-3Rα pathway. Such time-related alteration of brain IL-3Rα may also reflect a dynamically changing pathological process during prion infection.

The distributions of IL-3 and IL-3Rα vary among the three types of brain cells according to our IFA data here, that IL-3 signals mainly locate in microglia and neurons while IL-3Rα locates in neurons and astrocytes. Early studies have showed that IL-3-like factors are synthesized by astrocytes [22] and work as growth factors for microglia and macrophages [12]. IL-3 is also produced by neurons in the CNS of mice [23]. Large amounts of IL-3Rα overlap in the activated microglia in prion infected animals indicate again the robust role of IL-3/IL-3Rα signaling in activation for microglia. IL-3Rα is found in the cultured neuron cells, showing significantly lower amount in the cells with prion propagation. Possibly, one may speculate that the upregulation of brain IL-3Rα in the early stage of prion infection benefit to the proliferation of microglia cells. Decrease of IL-3Rα in the end stage of infection may be largely due to the severe loss of neurons with PrP^Sc deposit. IL-3 levels maintain almost unchanged in the prion infected brains collected at various time-points and in the prion-infected nerve cells in vitro. Recently, a study of flow cytometry of whole brain tissue in IL-3 conditional knockout mice (Il3^GFPfl/fl) has revealed that the pathological changes in AD mice does not affect IL-3 expression in astrocytes [13]. Combined with our data, it seems that the overall level of IL-3 in CNS is less affected by prion infection.

Several IL-3/IL-3Ra signaling mediated pathways in prion infected cell line are downregulated. JAK2-STAT5 signaling is one of the well-known pathways in inducing microglia activation [7]. Decreased levels of JAK2 and STAT5, particularly their phosphorylated forms, strongly reflect a suppressive status of JAK2-STAT5 signaling in prion infected cells. PI3 kinase and mTOR/p-mTOR, two key components of PI3K/AKT/mTOR pathway that is mediated by a number of growth factors and involves in cell survival [24], are also decreased in the prion infected cells. Numerous biological factors and pathways are abnormally altered in the prion infected cell line, which can be converted, at least partially, by removal of prion replication in vitro.[25, 26] Although the changes of the proteins in JAK2-STAT5 and PI3K/AKT/mTOR pathways can be influenced by many other factors and signalings, well-coincidental of decreases of those pathways with decrease of IL-3Ra in prion infected cell line indicates a causal relationship. Such relationship is further verified by the assays of the stimulation of recombinant IL-3 on prion infected neural cells, showing markedly reluctant response of JAK2-STAT5 and PI3K/AKT/mTOR pathways than the normal partner cells. Moreover, similar alteration in those two pathways are found in the brain tissues of several prion infected animal models at the end stage. Based on the above results, we may assume that although prion infection or PrP^Sc accumulation does not affect the expression of IL-3, it significantly downregulates the IL-3R level, which subsequently leads to repression on the downstream pathways of IL-3/IL-3R in neurons particularly and block of the neuroregulatory and neuroprotective activities of IL-3.

Neuroinflammation is one of the hallmarks in different neurodegenerative diseases, including prion disease, mostly represented by the upregulations of inflammatory cytokines or chemokines and their receptors in the infected brains, e.g., IP-10/CXCR3 and M-CSF/CSF1R [27, 28]. Contrary to the increases of many inflammatory factors, the pathophysiological significance of the repression of brain IL-3/IL-3R during prion infection is still not well understood. The possible role of IL-3/IL-3R signaling in brain immunomodulation and the possible differential expression of IL-3R in different brain cells and in different time-points of prion infection need more detailed analysis. Further bioassays with IL-3/IL-3R transgenic mice may help to explore the contribution of downregulation of IL-3/IL-3R pathway in the pathogenesis of prion disease.

Ethics Approval

Not applicable.

Consent to Participate

Not applicable.

Consent for Publication

Not applicable.

Availability of Data and Materials

The datasets generated for this study are available on request to the corresponding.

Conflict of Interest

We declare no competing interests.

Funding

This work was supported by SKLID Development Grant (2021SKLID504, 2019SKLID401, 2019SKLID603).

Author Contributions

XXJ and CC contributed to study design, performed assays and data analysis and prepared the manuscript. CH, ZYC and WWZ assisted with the assays of cultured cells. WYZ, QF, RHA, and XL assisted with WB and IFA analysis assays. KX, QS assisted with statistical analysis. CC and XPD contributed to design, study concept and manuscript preparation.

Acknowledgements

This work was supported by SKLID Development Grant (2021SKLID504, 2019SKLID401, 2019SKLID603).

Baldwin KJ, Correll CM (2019) Prion Disease. Semin Neurol 39(4):428–439. 10.1055/s-0039-1687841
Prusiner SB (1998) Prions. Proc Natl Acad Sci U S A 95(23):13363–13383. 10.1073/pnas.95.23.13363
Wadsworth JD, Collinge J (2011) Molecular pathology of human prion disease. Acta Neuropathol 121(1):69–77. 10.1007/s00401-010-0735-5
Aguzzi A, Zhu C (2017) Microglia in prion diseases. J Clin Invest 127(9):3230–3239. 10.1172/JCI90605
Mindur JE, Swirski FK (2019) Growth Factors as Immunotherapeutic Targets in Cardiovascular Disease. Arterioscler Thromb Vasc Biol 39(7):1275–1287. 10.1161/ATVBAHA.119.311994
Appel K, Buttini M, Sauter A, Gebicke-Haerter PJ (1995) Cloning of rat interleukin-3 receptor beta-subunit from cultured microglia and its mRNA expression in vivo. J Neurosci 15(8):5800–5809. 10.1523/JNEUROSCI.15-08-05800.1995
Natarajan C, Sriram S, Muthian G, Bright JJ (2004) Signaling through JAK2-STAT5 pathway is essential for IL-3-induced activation of microglia. Glia 45(2):188–196. 10.1002/glia.10316
Kiddle SJ, Thambisetty M, Simmons A, Riddoch-Contreras J, Hye A, Westman E, Pike I, Ward M, Johnston C, Lupton MK, Lunnon K, Soininen H, Kloszewska I, Tsolaki M, Vellas B, Mecocci P, Lovestone S, Newhouse S, Dobson R, Alzheimers Disease Neuroimaging I (2012) Plasma based markers of [11C] PiB-PET brain amyloid burden. PLoS ONE 7(9):e44260. 10.1371/journal.pone.0044260
Zambrano A, Otth C, Maccioni RB, Concha II (2010) IL-3 controls tau modifications and protects cortical neurons from neurodegeneration. Curr Alzheimer Res 7(7):615–624. 10.2174/156720510793499011
Frendl G, Beller DI (1990) Regulation of macrophage activation by IL-3. I. IL-3 functions as a macrophage-activating factor with unique properties, inducing Ia and lymphocyte function-associated antigen-1 but not cytotoxicity. J Immunol 144(9):3392–3399
Frendl G (1992) Interleukin 3: from colony-stimulating factor to pluripotent immunoregulatory cytokine. Int J Immunopharmacol 14(3):421–430. 10.1016/0192-0561(92)90172-h
Frei K, Bodmer S, Schwerdel C, Fontana A (1986) Astrocyte-derived interleukin 3 as a growth factor for microglia cells and peritoneal macrophages. J Immunol 137(11):3521–3527
McAlpine CS, Park J, Griciuc A, Kim E, Choi SH, Iwamoto Y, Kiss MG, Christie KA, Vinegoni C, Poller WC, Mindur JE, Chan CT, He S, Janssen H, Wong LP, Downey J, Singh S, Anzai A, Kahles F, Jorfi M, Feruglio PF, Sadreyev RI, Weissleder R, Kleinstiver BP, Nahrendorf M, Tanzi RE, Swirski FK (2021) Astrocytic interleukin-3 programs microglia and limits Alzheimer's disease. Nature 595(7869):701–706. 10.1038/s41586-021-03734-6
Clarke MC, Haig DA (1971) Multiplication of scrapie agent in mouse spleen. Res Vet Sci 12(2):195–197
Birkett CR, Hennion RM, Bembridge DA, Clarke MC, Chree A, Bruce ME, Bostock CJ (2001) Scrapie strains maintain biological phenotypes on propagation in a cell line in culture. EMBO J 20(13):3351–3358. 10.1093/emboj/20.13.3351
Shi Q, Zhang BY, Gao C, Zhang J, Jiang HY, Chen C, Han J, Dong XP (2012) Mouse-adapted scrapie strains 139A and ME7 overcome species barrier to induce experimental scrapie in hamsters and changed their pathogenic features. Virol J 9:63. 10.1186/1743-422X-9-63
Hu C, Chen C, Xia Y, Chen J, Yang W, Wang L, Chen D-D, Wu Y-Z, Fan Q, Jia X-X, Xiao K, Shi Q, Chen Z-B, Dong X-P (2022) Different Aberrant Changes of mGluR5 and Its Downstream Signaling Pathways in the Scrapie-Infected Cell Line and the Brains of Scrapie-Infected Experimental Rodents. Front Cell Dev Biology 10. 10.3389/fcell.2022.844378
Huang SCZ, Yu JF, Young D, Bashey A, Ho AD, Law P (1999) Correlation between IL-3 receptor expression and growth potential of human CD34 + hematopoietic cells from different tissues. Stem Cells 17(5):265–272. 10.1002/stem.170265
Fogha J, Bayry J, Diharce J, de Brevern AG (2021) Structural and evolutionary exploration of the IL-3 family and its alpha subunit receptors. Amino Acids 53(8):1211–1227. 10.1007/s00726-021-03026-3
Zambrano A, Otth C, Mujica L, Concha II, Maccioni RB (2007) Interleukin-3 prevents neuronal death induced by amyloid peptide. BMC Neurosci 8:82. 10.1186/1471-2202-8-82
Wen TC, Tanaka J, Peng H, Desaki J, Matsuda S, Maeda N, Fujita H, Sato K, Sakanaka M (1998) Interleukin 3 prevents delayed neuronal death in the hippocampal CA1 field. J Exp Med 188(4):635–649. 10.1084/jem.188.4.635
Frei K, Bodmer S, Schwerdel C, Fontana A (1985) Astrocytes of the brain synthesize interleukin 3-like factors. J Immunol 135(6):4044–4047
Konishi Y, Kamegai M, Takahashi K, Kunishita T, Tabira T (1994) Production of interleukin-3 by murine central nervous system neurons. Neurosci Lett 182(2):271–274. 10.1016/0304-3940(94)90814-1u
Dudek H, Datta SR, Franke TF, Birnbaum MJ, Yao R, Cooper GM, Segal RA, Kaplan DR, Greenberg ME (1997) Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science 275(5300):661–665. 10.1126/science.275.5300.661
Chen C, Shi Q, Xiao K, Zhou W, Gao C, Gao L, Han J, Wang J, Dong X (2022) Activation of Innate Immunity and Autophagy in Brain Tissues with Prion Disease and Degradation of Abnormal PrPs in Cells - China's Studies. China CDC Wkly 4(33):735–740. 10.46234/ccdcw2022.153
Shi Q, Chen C, Xiao K, Zhou W, Gao C, Gao L, Han J, Wang J, Dong X (2022) Extensive Disturbances of Intracellular Components and Dysfunctions of Biological Pathways in the Brain Tissues During Prion Infection - China's Studies. China CDC Wkly 4(33):741–747. 10.46234/ccdcw2022.154
Chen J, Chen C, Hu C, Liu L, Xia Y, Wang L, Yang W, Wu HY, Zhou W, Xiao K, Shi Q, Wu Y, Chen ZB, Dong XP (2020) IP10, KC and M-CSF Are Remarkably Increased in the Brains from the Various Strains of Experimental Mice Infected with Different Scrapie Agents. Virol Sin 35(5):614–625. 10.1007/s12250-020-00216-3
Xia Y, Chen C, Chen J, Hu C, Yang W, Wang L, Liu L, Gao L-P, Wu Y-Z, Chen D-D, Shi Q, Chen Z-B, Dong X-P (2022) Enhanced M-CSF/CSF1R Signaling Closely Associates with PrPSc Accumulation in the Scrapie-Infected Cell Line and the Brains of Scrapie-Infected Experimental Rodents. Mol Neurobiol 59(10):6534–6551. 10.1007/s12035-022-02989-y

S1.tif

Download PDF

Journal Publication

published 07 Aug, 2023

Read the published version in Molecular Neurobiology →

Editorial decision: Major Revisions Needed
27 Jun, 2023
Reviewers agreed at journal
12 Jun, 2023
Reviewers invited by journal
17 Apr, 2023
Editor assigned by journal
06 Mar, 2023
First submitted to journal
01 Mar, 2023

You are reading this latest preprint version

Abnormal changes of IL3/IL3R and its downstream signaling pathways in the prion infected cell line and in the brains of scrapie infected rodents

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Ethics statement

Cell culture

Preparation of cell lysates

Brain samples of scrapie infected mouse models

Preparation of brain homogenates

Western blots

Immunofluorescence assay (IFA)

Quantitative real-time PCR (qPCR)

Cell viability assay

Statistical analysis

Results

IL-3 signals overlapped with astrocytes and neurons but not with microglia morphologically

Treatment of recombinant IL-3 upon prion infected cells induces less active response in vitro

Discussion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1