Cell Culture
The human umbilical cord was gained from informed, healthy parturients, and MSC was isolated from the human umbilical cord and identified as described previously[22]. All clinical procedures followed the protocols approved by the ethics committee of Jiangsu University, and the methods were carried out by the approved guidelines. All participants have written consent for the present study. MSC was cultured in L-DMEM (Gibco, Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS) (Bovogen, Australia). Human immortalized L02 cells (Chinese Academy of Sciences) were maintained in RPMI 1640 containing 10% FBS (Bovogen, Australia). HEK293T cells (ATCC) were maintained in L-DMEM (Gibco, Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS) (Bovogen, Australia). Human immortalized HSC cell line LX-2 (Chinese Academy of Sciences) was maintained in H-DMEM (Gibco) containing 10% FBS (Bovogen, Australia). All cells were cultured at 37℃ with 5% CO2 and tested for mycoplasma contamination.
Isolation And Characterization Of Msc-ex
MSC-ex was isolated and purified as our previously established method[21]. MSC was cultured in an FBS-free medium, in which bovine exosomes and protein aggregates were removed by ultra-centrifugation at 100 000 ×g for 16 h at 4 ℃. 500 mL condition medium from MSC at passages 3 to 6 was collected, and centrifuged at 2000 ×g for 20 min to remove cell debris. Then, Supernatants were concentrated using a 100 KDa molecular weight cut-off (MWCO) ultrafiltration filter per the manufacturer’s instructions (Millipore, USA). After filtration with 0.22 µM filter membrane, the exosomes-enriched fraction was transferred to a 15ml sterile centrifuge tube. MSC-ex was precipitated from the concentrates using ExoQuick-TC extracellular vesicle (EV) isolation Kit following the protocol (System Biosciences, USA). The protein concentration of the extracted exosomes was quantified by a BCA protein assay kit (Pierce, ThermoFisher). The morphology of MSC-ex was observed by transmission electron microscopy (FEI Tecnai 12, Philips). The amount and size distribution of MSC-ex was measured by NanoSight tracking analysis (NTA) with NTA 3.1 Software (NanoSight, Malvern, UK).
Ccl4-induced Mouse Model Of Liver Fibrosis And Msc-ex Injection
All experiments involving animals were conducted according to the ethical policies and procedures approved by the ethics committee of the Jiangsu University ethics committee (Approval no. UJS-IACUC-AP-2020033127). BALB/c female mice, 4–5 weeks old, were treated with carbon tetrachloride (CCl4) (10%) for 6 weeks to induce liver fibrosis as described. To analyze the effect of MSC-ex on LOXL2 expression and liver fibrosis, mice were randomized into four groups: PBS group, mice injected with 1 mL PBS (n = 6); 3-aminopropionitrile fumarate salt (BAPN) group, mice treated with BAPN (125 mg/kg, Sigma-Aldrich, n = 6) once per day; and MSC-ex 12.5 mg/kg body weight (n = 6), 25 mg/kg body weight (n = 6) groups, mice treated with MSC-ex twice a week for four weeks. PBS, BAPN, and MSC-ex were administered by tail vein. At four weeks post MSC-ex injection, mice were sacrificed to collect blood and liver samples for further analysis.
MSC-ex labeling and tracking in mice and LX-2 Cells
MSC-ex was incubated with CM-Dir (Ruitai Biology, China) or PKH67 (Sigma-Aldrich, USA) for 30 min at 37 ℃ according to the manufacturer’s instructions. After washing with PBS, CM-Dir or PKH67 labeled MSC-ex were concentrated with a 100 KDa molecular weight cut-off (MWCO) ultrafiltration filter at 1000 ×g for 30min to remove the non-binding dye. For in vivo tracking of MSC-ex in mice, CM-Dir (Ruitai Biology, China) labeled MSC-ex were injected intravenously and analyzed using a Maestro In Vivo Imaging System (CRI, MA, USA). In vivo spectral imaging from 690–850 nm was performed using an exposure time of 150 ms per image frame. For the distribution of MSC-ex in LX-2, PKH67 labeled MSC-ex (PKH67-ex) was incubated with LX-2 cells at 37 ºC for 24 hr and observed with confocal microscopy.
Western Blot
Western blot
Whole-cell or MSC-ex lysates were prepared in RIPA lysis buffer (Beyotime, Shanghai, China). Protein concentration was determined using the BCA assay kit (Vazyme Biotech, Nanjing, China). Equal amounts of lysates were loaded and separated on a 10% or 12% SDS-PAGE gel. Standard Western blot was done using primary antibodies and a peroxidase-linked, species-specific, anti-mouse, anti-rat, or anti-rabbit IgG (CWBIO, China). The following primary antibodies were used: CD9 (1: 500, Bioworld, USA, BS3022), CD63 (1: 1000, Abcam, UK, ab271286), Calnexin (1: 2000, Sigma-Aldrich, USA, BS1438), TSG101 (1: 1000; Abcam, UK, BS91381), α-SMA(1: 1000; Bioworld, USA, BM0002), LOXL2 (1: 2000; Bioworld, USA, MB63843), YAP (1: 1000; Bioworld, USA, BS2000) and GAPDH (1: 2000; Abclonal, China, AC001). Proteins were detected with an ECL detection system (Amersham Pharmacia Biotech, Little Chalfont, UK). Western blot results were quantitated using ImageJ software; protein expression was normalized to GAPDH.
Quantitative Reverse Transcription Pcr
Total RNA of LX-2 cells and mouse livers were extracted with Trizol according to the manufacturer’s instructions as described earlier (Invitrogen). 1 µg of total RNA was used for the reverse transcription of RNA into cDNA in a reaction using the SuperScriptTM II RT kit according to the manufacturer’s instructions (Invitrogen). SYBR-Green I-based Real-Time PCR kit (Vazyme Biotech Co., Ltd, China) was used and relative quantitation of gene expression was determined by using the 2−ΔΔCT method and normalized to β-actin gene. The PCR primers were listed in Table 1 (Shanghai Bio-Engineering, China). The fluorescence signals were detected by CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA). MiScript primer assays were used for the semiquantitative determination of human miR-27b-3p (Qiagen GmbH, Germany). Relative gene expression normalized to U6 was calculated using the 2−ΔΔCt method. There were three or six replicates per group.
Elisa (Enzyme-linked Immunosorbent Assay)
Serum LOXL2 levels in fibrotic mice treated with MSC-ex or BAPN were determined using an ELISA kit (XinYu Biotech, Shanghai, China) according to the manufacturer’s instructions.
Immunohistochemistry And Immunofluorescence Of Liver Tissues
LOXL2, YAP, and α-SMA protein expressions were analyzed using MSC-ex or BAPN-treated mouse tissue samples. Mouse tissue sections (4 µm thick) of formalin-fixed, paraffin-embedded liver specimens were deparaffinized in xylene and rehydrated in graded alcohol. Standard immunohistochemical procedures were performed on liver tissue sections using anti-LOXL2 (1: 50; Santa Cruz Biotechnology, USA), anti-YAP (1: 50; Bioworld, USA), or anti-α-SMA antibody (1: 50; Bioworld, USA). Signals were visualized using 3, 3′-Diamino-benzidine tetrahydrochloride (Boster Biology, Wuhan, China). A positive reaction was indicated by a brown membrane, cytoplasmic, and/or nuclear staining according to different markers. The staining result of LOXL2, YAP, and α-SMA expression was determined by the percentage of positive cells by two investigators blinded to the data. Immunofluorescence staining was performed using anti-CD9 (1: 100, Bioworld, USA), anti-LOXL2 (1: 50), anti-YAP (1: 50), or anti-α-SMA antibody (1: 50). Negative controls with isotype IgG were run in parallel. Images were acquired using a laser scanning confocal microscope (Nikon, Tokyo, Japan).
Hematoxylin And Eosin (He) Staining
Formalin-fixed paraffin-embedded liver sections were stained with Masson Trichrome (MT) (Gefan, China) and Sirius Red (Chondrex, USA) according to the instruction of the manufacturer. To analyze hepatic collagen distribution, 10 fibrotic septa randomly selected from the right and left liver lobes of 6 individual mice/groups were assessed. Collagen extent was expressed as a percentage of stained area in each liver section.
Tgfβ Induced Lx-2 Activation And Msc-ex Treatment
LX-2 cells were cultured in a 6-well plate until reached approximately 50–60% confluence. Then cells were randomized into four groups: PBS, LX-2 treated with PBS, TGFβ: LX-2 treated with 10 ng/ml TGFβ, TGFβ/MSC-ex, LX-2 treated with 10 ng/ml TGFβ and 100 or 200 µg/ml MSC-ex, TGFβ/BAPN: LX-2 treated with 10 ng/ml TGFβ and 1.0 mg/ml BAPN. These cells were treated for 48 h and collected for further investigation.
Immunofluorescence Of Lx-2
LX-2 cells were fixed in 4% paraformaldehyde for 10 minutes and permeabilized with 0.1% Triton X-100 for 10 min at room temperature. For examining LOXL2, YAP, and α-SMA protein levels, LX-2 cells were blocked with 5% BSA and incubated with anti-LOXL2, anti-YAP, or anti-α-SMA primary antibody at 4 ˚C overnight; after incubation and washing, fluorescent-labeled secondary antibody was added with the necessary incubation and washing. Then the slides were counterstained with 4′, 6-diamidino-2-phenylindole (DAPI) for nuclear staining and examined under a laser scanning confocal microscope (Nikon, Tokyo, Japan).
Adenoviral Overexpression And Knockdown Of Yap
Adenoviruses expressing full-length human YAP (Ad-YAP), GFP alone (Ad-GFP), YAP shRNA (sh-YAP), and control shRNA (sh-Ctr) were constructed. Full-length human YAP cDNA was inserted into pAV(Exp)-CMV > YAP/HA-IRES-Egfp adenoviral vectors to generate Ad-YAP expression vectors. The adenoviral YAP shRNA vector was generated by the vector ADV1(U6/CMV-GFP) with YAP shRNA oligonucleotides. The shRNA oligonucleotide sequences are listed in Table 2. Recombinant adenovirus was produced by co-transfecting 293A cells as described previously. The efficiency of YAP overexpression and knockdown was evaluated by using quantitative Reverse Transcription PCR and western blot. For the preparation of YAP-modified 293T and LX-2 cells, Ad-YAP and sh-YAP transfected cells were collected for further study.
Table 1
Primers for Quantitative Real-time PCR
Genes
|
Primer Sequence (5′-3′)
|
Annealing Temperature (°C)
|
Product
size (bp)
|
Human LOXL2
|
For: CTGCAAGTTCAATGCCGAGT
|
60
|
149
|
Rev: TCTCCACCAGCACCTCCACTC
|
Human Col1A2
|
For: CTACTGGTGCCAGAGGACTT
|
58
|
138
|
Rev: TAGGGCCTCTCTTTCCTTCT
|
Mouse LOXL2
|
For: TTCTGCCTGGAGGACACTGAGT
|
58
|
139
|
Rev: TTCTGCCTGGAGGACACTGAGT
|
Mouse/Human
β-actin
|
For: CACGAAACTACCTTCAACTCC
|
56
|
265
|
Rev: CATACTCCTGCTTGCTGATC
|
LOXL2 ChIP
|
For: GGTTTGTCTCCTCAGGGAGTG
|
57
|
102
|
Rev: GCGAGCTGCAAAACAAGGGA
|
Table 2
Genes
|
Sequence (5′-3′)
|
sh-YAP
|
CCGGGCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGCTTTTTG
|
sh-Ctr
|
CCGGGCAAGCTGACCCTGAAGTTCATCTCGAGATGAACTTCAGGGTCACGTTGCTTTTTG
|
Promoter Activity Analysis
The LOXL2 promoter constructs pcDNA3.1-LOXL2-907 (pLOXL2-907), pcDNA3.1-LOXL2-826 (pLOXL2-826) and pcDNA3.1-LOXL2-328 (pLOXL2-328) were Chemically synthesized (GENERAL BIOL, Anhui, China). For the LOXL2 reporter assay, HEK293T and LX-2 cells were seeded in 24-well plates. The LOXL2 promoter constructs and Renilla luciferase reporter were cotransfected with plasmid DNA of pcDNA3.1-vector (p3.1), pcDNA3.1-YAP (pYAP), and in some experiments, control shRNA (sh-Ctr) or YAP shRNA (sh-YAP). Lipofectamine 2000 reagent (Life Technologies) was used according to the manufacturer’s instructions. Both firefly and Renilla luciferase activity were measured using a dual-luciferase assay system (Promega, Madison, USA) 48 hours after transfection, and the LOXL2 promoter activity was normalized with the Renilla luciferase activity. Three biological repeats were used for each sample in the dual luciferase reporter.
Chromatin Immunoprecipitation Quantitative Real-time Pcr (Chip-qpcr)
Chromatin immunoprecipitation (ChIP) assay was performed according to the manufacturer's instructions (Millipore, Billerica, MA). Briefly, formaldehyde was used to cross-link proteins with DNA, and 2×107 293T or LX-2 cells were lysed in sodium dodecyl sulfate lysis buffer. The cell lysate was sonicated to shear the DNA to 400- to 600-bp lengths. Chromatin samples were then precleared with a salmon sperm DNA/protein A agarose 50% slurry for 30 minutes at 4°C and immunoprecipitated overnight with anti-IgG or anti-YAP (Bioworld, USA, BS9920M). The purified DNA fragments were subjected to quantitative PCR using primers listed in Table 1. Four biological replications were included in each treatment.
Luciferase Reporter Assays
YAP was predicted as a target of miR-27b-3p by TargetScan (http://targetscan.org/). The 3'‑untranslated region (UTR) of the human YAP gene containing either wild-type (WT) or mutant-type (MT) binding sites of miR-27b-3p was synthesized and inserted in the pGL3 vector downstream of the firefly luciferase gene to form pGL3-YAP, named as YAP-WT and YAP-Mut. LX-2 cells (2.5×104 /well) were seeded in 24-well plates and were co-transfected with miR-27b-3p mimics or negative control (NC) miRNA mimics and control reporter plasmids pGL3, YAP-WT or YAP-Mut using Lipofectamine 2000. The Dual-Luciferase Reporter assay system (Promega, USA) was applied to examine the activities of Renilla and firefly luciferase-based on the manufacturer's protocols at 24 h post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity.
Fluorescence In Situ Hybridization (Fish)
Cy3-labeled miR-27b-3p probe sequence was purchased from GenePharma, China. 3×105 cells were cultured in 24-well glass slide plates. 4% paraformaldehyde was used to fix the cells. 15 min of TRITON X-100 treatment was followed by incubation with blocking solution for 30 min (37°C). Cy3-labeled miR-27b-3p fluorescent probe solution was incubated with cells in an in situ hybridizer for 14 h (37°C). Tween 20 was used to wash the cells. For liver tissue, 7 mm frozen liver tissue sections were digested with proteinase K and incubated in a blocking buffer for 30 minutes (37°C). Prepare the cy3-labeled miR-27b-3p fluorescent probe working solution at a volume ratio of 1:1. Incubate with liver tissue slices for 14h (37°C) in an in situ hybridization instrument. Wash sections with deionized formamide at 43°C to denature unhybridized probes. Sections were washed three times with sodium citrate buffer (60°C). FISH images were then captured by confocal microscopy.
Mir-27b-3p Mimics Or Inhibitors Transfection
Human miR-27b-3p mimics, negative control mimics, and miR-27b-3p inhibitors, negative control inhibitors were purchased from GenePharma, China. According to the instruction of the manufacturer, miR-27b-3p mimics (25 nM, 50 nM) and miR-27b-3p inhibitors (50 nM, 100 nM) were transiently transfected into LX-2 cells using Lipofectamine 2000 in Opti-MEM™ medium (Invitrogen, USA) at 70%-80% confluency in 6-well culture plates. At 4–6 h post-transfection, the culture medium was replaced with MEM with 10% FBS for another 48 h. The transfected cells were collected for further investigation.
Mir-27b-3p Knockdown Of Msc-ex
Negative control inhibitors, miR-27b-3p inhibitors (50 nM, 100 nM) were transiently transfected into MSC using Lipofectamine 2000 in Opti-MEM™ medium (Invitrogen, USA) at 70%-80% confluency in 6-well culture plates. At 4–6 h post-transfection, the culture medium was replaced with an FBS-free medium for another 48 h. Then total RNA of inhibitors transfected MSC was collected for miR-27b-3p quantification. miR-27b-3p inhibitors transfected MSC-ex (miR-27bin-ex) or negative control inhibitors transfected MSC-ex (NCin-ex) were isolated, purified, and washed as our previously established method. After concentration and structure identification, miR-27bin-ex or NCin-ex were stored at -70°C for further use. Then LX-2 cells were treated with NCin-ex (200 µg/ml) or miR-27bin-ex (2000 µg/ml) for 48 h and collected for further investigation.
Mir-27b-3p Mimics The Loading Of Exosomes
miR-27b-3p mimics were passively loaded into MSC-ex by the sonication method. MSC-ex was mixed with 50 nM miR-27b-3p mimics or negative control mimics and sonicated at 500 v, 2 kHz, 10% power, 6 cycles by 4 s pulse/2 s pause, cooled down on the ice for 2 min, and then sonicated again using Qsonica Sonicator Q700 (Misonix, USA). Then miR-27b-3p overexpressed MSC-ex (miR-27boe-ex) or negative control mimics overexpressed MSC-ex (NCoe-ex) were washed with PBS 3 times to remove residual miRNA. After concentration and structure identification, miR-27boe-ex or NCoe-ex were stored at -70°C for further use. Then LX-2 cells were treated with NCoe-ex (50 µg/ml) or miR-27boe-ex (50 µg/ml) for 48 h and collected for further investigation.
Statistical analysis
Statistical analyses were performed by using the GraphPad Prism version 8.3.0 version (San Diego, CA, USA). All the data is presented as mean ± SD. The Student’s t-test was used for comparisons between the two groups. One-way analysis of variance (ANOVA) followed by Dunnett was used for studies involving more than two groups. A two-sided P < 0.05 was considered statistically significant.