2.1 Cell culture
The thyroid cell line Nthy-ori 3-1 (JN-2993, Shanghai Ji Ning Industrial Co., Ltd., China), and several human thyroid carcinoma cell lines including SW579 (HTB-107, ATCC, USA), TPC-1 (CC-Y1522, Shanghai Enzyme Research Biotechnology Co., Ltd., China), BCPAP (HTX-1878, Shenzhen Haodi Huatuo Biotechnology Co., Ltd., China) and K1 (HTX-2011, Shenzhen Haodi Huatuo Biotechnology Co., Ltd., China) were obtained. The cells were maintained in RPMI 1640 medium (Gibco, Thermofisher, NY, USA) with 10% fetal bovine serum (Sigma-Aldrich, St. Louis, MO, USA), and cultured at 37 °C in 5% CO2 .
2.2 RT-PCR
Total RNAs were extracted through Trizol (15596018, Invitrogen, Carlsbad, CA, USA). RNAs were then reversely transcribed into cDNA by reverse transcription kit (Applied Biosystems, Waltham, MA, USA). The Mastercycler® nexus X2 (Eppendorf, Hamburg, Germany) was used for qRT-PCR following the manufacture’s protocol. The cycling conditions for PTCSC3 and S100A4 are as follows: 95 °C for 5 min, 40 cycles of 95 °C for 30 s, 60 °C for 60 s. Using GAPDH as an internal reference. Relative expressions were calculated via the 2-ΔΔCt method. The sequences of primers are listed as follows:.
PTCSC3 Forward: 5′- TCAAACTCCAGGGCTTGAAC -3′
Reverse: 5′- ATTACGGCTGGGTCTACCT -3′
S100A4 Forward: 5′- TCAGAACTAAAGGAGCTGCTGACC-3′
Reverse: 5′- TTTCTTCCTGGGCTGCTTATCTGG -3′
GAPDH Forward: 5′- AGCCCATCACCATCTTCCAG -3′
Reverse: 5′- CCTGCTTCACCACCTTCTTG -3′
2.3 Cell transfection for PTCSC3 and grouping
Thyroid carcinoma cells with the highest differential expression of PTCSC3 were selected for transfections. The cells were digested with trypsin (Invitrogen, Carlsbad, CA, USA) and 2×105 cells in logarithmic phase of growth were used for seeding into six-well plates. After 24 h, the cell growth was observed under inverted microscope until the cell density reached 80-90%. The cells were divided into five group: control group (no treatment), PTCSC3 overexpression negative control group (NC1), PTCSC3 overexpression group (PTCSC3), PTCSC3 inhibitor negative control group (NC1) and PTCSC3 inhibitor group (si-P). The lentivirus plasmids were constructed by Shanghai Genechem Co., Ltd. The transfection efficiency was tested by RT-PCR after 24h.
2.4 CCK8
Logarithmic cells were seeded into 96-well plates with 2×104/ml with 100 μl of medium added to each well. After culture for 24h, 48h, 72h and 96h at 37 ℃ and 5% CO2. Then 10 μl CCK-8 solution was added to each well (tonghua institute of chemistry, Japan) and mixed well for further culture for 4h. The absorbance (OD) of each well at 450 nm was measured by the microplate reader.
2.5 Clone formation assay
The density was modulated to 250 cells/ml, and 2ml cells were added to each well of the six-well plate. The cells were incubated at 37℃ and 5%CO2 for 2-3 weeks, then fresh medium was changed every three days. The cells were fixed with methanol, 1ml gemsa solution was added to each well, and the cells were stained for 30min. The cells were washed with ultrapure water for 2 times, and the water around the dish was sucked off with a filter. Take pictures with a camera.
2.6 Transwell assay
Invasion: pre-cooled RPMI1640 medium was mixed with Matrigel (solebau, Beijing) at 1:1, and evenly spread at the bottom of the upper chamber of Transwell at 50μl per well (Corning Life Sciences, Corning, NY). And 100 μl lung cancer cell suspension (5×104) were added to each well and incubated at 37℃ for 4h. In the lower chamber, 600 μl RPMI1640 medium was added and incubated at 37℃ and 5% CO2 for 72h. The chamber was removed, washed twice with PBS, and fixed at 4℃ with 5% glutaraldehyde. It was washed with PBS twice, added 0.1% crystal violet (Beijing solabao) for 30min, washed with PBS twice. Five fields (400×) were randomly selected under an inverted microscope (Olympus, Japan) to calculate the mean value. Migration: no Matrigel was used in Transwell chamber. Other steps were the same as invasion.
2.7 Tube formation assay
Firstly, 50 µL Matrigel (BD Bioscience, USA) was applied to 96-well plates and cured at 37℃ for 1h. Then, HUVECs were digested and centrifuged at 1000rpm for 5min. The cell supernatants (4×104 cells/wells) were resuspended and inoculated on the matrix glue, placed in the medium, and incubated at 37℃ in an incubator with 5% CO2 (Thermo, USA) for 48h. The digital images were obtained by counting under an inverted microscope using the digital Camera system on the microscope (Jenoptik ProgRes Camera, Germany).
2.8 Flow cytometry
After treatment, the cells were cultured for 24 hours then collected. The cells were resuscitated by precooling with 1×PBS (4℃), centrifuged at 1000rpm for 5-10 minutes, and washed. Then 300 μl of 1×Binding Buffer was added to suspend the cells. Annexin V-APC of 5 μl was added and mixed, then incubated for 15 minutes at room temperature without light. Five minutes before loading, 5 μl of PI was added for dyeing, and 200 μl of 1×Binding Buffer was added before loading. The samples were finally detected by flow cytometry (Beckman Coulter, Brea, CA, USA) and analyzed by CellQuest software (BD Bioscience, San Diego, CA).
2.9 Western blot
After cell lysis, the supernatant was taken after centrifugation (2000rpm, 20min). The BCA kit (Solarbio, Beijing, China) was used to measure the protein concentration. And 40 L of protein samples were mixed with 10% SDS gel buffer at 1∶1 then heated at 95℃ for 5min to denature the protein. PVDF membrane (Merck, Darmstadt, Germany) was transferred at a voltage of 80V for 30min and sealed with TBST solution containing 5% skim milk powder at 4℃ for 1h. Rabbit anti-human Bax (1:500, orb224426, Biorbyt, Cambridge, UK) and Bcl-2 (1:500, orb226346, Biorbyt, Cambridge, UK), Cleaved caspase-3 (1:500, orb126597, Biorbyt, Cambridge, UK), S100A4 (1:500, orb254558, Biorbyt, Cambridge, UK), β-actin (1:2000, orb178392, Biorbyt, Cambridge, UK) polyclonal antibodies were diluted with TBST solution containing 3% bovine serum protein at 4℃ overnight. After rewarming, horseradish peroxidase-labeled goat anti-rabbit IgG (1:1000, ABIN101988, linates-online, Aachen, Germany) were incubated for 1h, washed and colored with ECL luminescent substrate for 3-5min. Protein expression level was standardized by β-actin. And gray level was scanned and quantified by Image J (NIH) software.
In the nude mice experiment, the primary antibodies were rabbit anti-human VEGF (1:500, orb27288, Biorbyt, Cambridge, UK) and MMP-9-9 (1:500, orb227878, Biorbyt, Cambridge, UK) polyclonal antibodies. The other steps are the same as above.
2.10 Cell transfection for PTCSC3 and S100A4, and grouping
(1) Control group; (2) PTCSC3 overexpression group (PTCSC3); (3) S100A4 silence negative control group (NC3); (4) S100A4 silence group (si-S); (5) PTCSC3 overexpression+S100A4 overexpression negative control group (P+NC4); (6) PTCSC3 overexpression+S100A4 overexpression group (P+S). The transfection efficiency of S100A4 was determined by qRT-PCR, and the above experiments were repeated.
2.11 Construction and grouping of nude mice with xenograft tumors
Twenty-four SPF Balb/c female nude mice, 16-18g, 4 weeks old, purchased from Charles River. License number SCXK (Beijing) was 20160006. The nude mice were fed in the aseptic, independent and air supply isolation cage at air laminar flow purification room, where kept the constant temperature (26-28℃) and humidity (relative humidity 40%-60%). Feed, drinking water and bedding material were sterilized. Animal experiments followed the guidelines of NIH (NIH pub.no.85-23, revised 1996), which have been approved by the animal protection and use committee of the 960th Hospital of the PLA Joint Logistics Support Force. Cells in the logarithmic growth phase were digested with 0.25% trypsin. Cells were collected and counted. The concentration was adjusted to 2.5×106 /ml. And 0.2 ml was inoculated on the right forelimb close to soft skin on the back of the nude mice. Twenty-four nude mice were randomly divided into (1) Control group. (2) PTCSC3 overexpression group (PTCSC3); (3) S100A4 silence group (si-s); (4) PTCSC3 overexpression + S100A4 overexpression group (P+S), 6 in each group.
2.12 Tumor volume calculation
Vernier calipers were used to measure tumor length (L) and short diameter (W) every 7 days to calculate tumor volume. Tumor volume (V) = (long diameter × short diameter 2) /2. After 35 days, the nude mice were anesthetized by intraperitoneal injection of 0.6% pentobarbital sodium (40mg/kg). The mice were sacrificed by neck dissection. The tumor tissue was collected and weighed. The tumor tissue was fixed in 4% paraformaldehyde and embedded in paraffin for 24 hours. Part of the tissues was placed in the freezer tube and stored in the refrigerator at -80℃.
2.13 Immunochemistry
After routine sections of the tumor tissue, the toasted slides were dewaxed with xylene and hydrated with gradient ethanol solution. And 3% H2O2 methanol solution was used to inactivat for 20min, followed by high-temperature antigen thermal repair in citrate buffer (pH6.0) for 10min and 5%BSA for 20min. Rabbit anti-human Ki67 (1:200, orb88614, Biorbyt, Cambridge, UK) polyclonal antibodies were added and reacted overnight at 4℃. After rewarming, horseradish peroxidase-labeled goat anti-rabbit IgG (1:1000, ABIN101988, linats-online, Germany) were incubated with secondary antibodies. The sections were stained, redyed, dehydrated, transparent and sealed. After observation under a ×400 optical microscope (Olympus, Japan), AperioImagescope11.1 software was used to count, and the result was expressed as the percentage (%) of positive cells. Microvascular density (MVD) was calculated by immunohistochemistry of CD31 (1:200, orb88916, Biorbyt, Cambridge, UK) in tumor blood vessels. MVD was calculated by reference to Weidner count. High-vascular density area (hot-spot) was selected at 100× field. MVD of 5 fields was counted at 400× field. The mean value was taken as the MVD value of the tumor.
2.14 TUNEL
The thickness of the section was 4 μm. After conventional dewaxing of xybenzene and dehydrating with gradient ethanol, apoptosis detection kit (No.: ZK-8005, ZSGB-BIO, China) was used for quantitative detection of apoptosis by TUNEL. Five fields were randomly selected under a 400-x optical microscope (BX50 /Olympus, Japan). Cell lines were identified as apoptotic cells with brown or tan granules and apoptotic cell morphological characteristics. Apoptotic index (AI) was calculated to reflect the degree of apoptosis. Apoptotic index = (number of apoptotic positive cells /total number of cells) ×100%
2.15 Statistical analysis
SPSS 19.0 was used for data processing. Data analysis results were presented as mean±SD. T test was used for data analysis between two groups. ANOVA was used for data analysis between multiple groups. And Dunnett-t test was used for subsequent analysis. The relationship between the expression difference in PTCSC3 and S100A4 and the clinicopathological characteristics of papillary thyroid carcinomas patients was analyzed by chi-square test. The correlation between PTCSC3 and S100A4 expression was analyzed by Pearson correlation analysis. P <0.05 indicated that the difference was statistically significant.