Preparation and microstructure of LN
Ligustrazine (C8H12N12, purity ≥ 98%) was provided by Tokyo Chemical Industry (Japan). The LN was prepared as our previous studies reported[23][24]. Appropriate amount of ligustrazine and PLA (1 : 4) were taken and dissolved in the acetone solution. The mass concentration of PLA in the acetone solution should be 20 g/L. This solution was called oil phase. 0.25% poloxamer solution with four times volume of the oil phase was used as the water phase. Then, the oil phase was poured rapidly into the water phase at a high agitation speed at 30 ℃, and the two phases were kept stir for 70 min until the acetone was evaporated. Finally, 1 mg/mL ligustrazine nanoparticles were got. One-drop sample of the above LN was dripped onto the copper grid with a thin carbon film. After the drop was air-dried, phosphotungstic acetate solution was applied to stain for 5 min. The microstructure of LN was visualized under the high resolution transmission electron microscope (HRTEM, Japan).
Determination of entrapment efficiency (EE) and loading capacity (LC)
LN was centrifuged at 25, 000 r/min for 60 min and the supernatant was harvested to measure EE and LC. About 0.2 mL supernatant mixed with 4.8 mL methanol were used to calculate the contents of free ligustrazine in the supernatant under the high performance liquid chromatography (HPLC), which was regarded as Wf. And 0.2 mL LN mixed with 0.5 mL N, N-dimethylformamide and 4.3 mL methanol were applied to calculate the total amount of LN under HPLC, which was named as Wt. EE and LC were calculated as follows[25]:
EE (%) = [(Wt - Wf) / Wt] × 100%
LC (%) = [(Wt - Wf) / Wn] × 100%
Whereas, Wn was the weight of LN after lyophilization.
In vitro drug release
Due to ligustrazine was lipid-soluble drugs, phosphate buffer was used as release medium. The phosphate buffer was prepared as follows: 1.36 g potassium dihydrogen phosphate mixed with 79 mL 0.1 mol/L sodium hydroxide solution, which were diluted in deionized water up to 200 mL. Then the mixed solution was re-suspended with 0.25% poloxamer. 1 mL LZ was added in a membrane dialysis bag in 30 mL above release medium at PH = 7.4 at room temperature with stirring constantly. During this time, 1 mL Dialysis buffer was taken out of the bag every five minutes, and the same volume release medium at same temperature was added. The concentration of the released drug were calculated by HPLC.
Animal model preparation and group assignment
Totally, twenty-four health male adult Sprague-Dawley rats (weighting 220 ± 20 g) were provided by Experiment Animal Center of Nanjing University of Chinese Medicine. The rats were all housed in a controlled condition with temperature (18–25℃) and relative humidity (65–70%) on a reverse 12 h light/dark circle. After acclimating for one week. The rats were randomly divided into 4 groups of 6 rats each, that is sham, model, LN and SH groups. The study protocol was approved by the Ethics Committee of Nanjing University of Chinese Medicine (No.ACU171112).
The PPA model was prepared as previous study reported[26][27]. In brief, all rats were fasted for 12 h but allowed to drink water before the experiment. All surgical procedures were conducted under aseptic conditions. After anesthetized with 1-1.5% isoflurane, rats were skin prepared and supine position fixed. A 1.5-2 cm incision was made on the midline of the lower abdomen. The cecum was rubbed smoothly and repeatedly by a file until petechiae appeared on the serosa layer. Then the injured cecum were replaced into the abdominal cavity, and sewed layer by layer. The cecum of rats in sham group were only exposed in the air for 5 min without rubbing. In the LZ and SH groups, 5 ml/kg LN and 0.5 ml/kg sodium hyaluronate (SH) gel (Baoshilun Furuida Pharmaceutical Co., Ltd.) was sprayed on the injured cecum and surrounding area before closing the abdominal cavity, respectively. All rats were anesthetized with 1-1.5% isoflurane on the 7th day after operation and an inverted U-incision was used to open the abdominal cavity. The blood samples, and cecum tissues especially adhesive sites were collected for the following analysis. After hemostasis was done completely, the abdominal wall was closed. All rats were then euthanized by sodium pentobarbital (200 mg/kg).
Adhesion grading and evaluation
The degree of adhesion was determined using five-stage adhesion score system[13][28][29] by two independent investigators in a blinded way. This scoring system included five stages adhesion scores range from 0 to 4. Grade 0 represents no adhesion areas; grade 1 represents 0–25% zones with thin, avascular and transparent adhesion, indicating a milder inflammatory response; grade 2 represents 25–75% zones with thick, avascular and opaque adhesion, meaning a mild inflammatory reaction; grade 3 represents 50–75% thick, capillaries, opaque adhesion, and sharp dissection required, indicating a moderate response; grade 4 represents 75–100% thick, opaque adhesion with large vessels, and sharp dissection required, meaning a severe reaction.
Masson’s trichrome (MT) staining
A portion of the cecum specimens were placed in 10% formaldehyde for 24 h, and dehydrated using graded ethanol. Then, the tissues were embedded in paraffin, cut into 4 µm thick sections. After the sections were heated and dewaxed, they were stained with MT (Leagene Biotechnology, Beijing) according to routine protocols. Different microscope fields were chosen randomly by microscope (DM2500; Leica, Germany) to evaluate the inflammation.
Enzyme-linked immunosorbent assay (ELISA)
Blood and tissue samples were harvested respectively. The cecum tissue were stored in -80℃ for the following analysis. The blood samples were centrifuged at 3000 rpm for 20 min. Afterward, the supernatant were collected and stored in 4℃ for the subsequent analysis. The concentrations of IFN-γ, IL-12, IL-4 and IL-6 in the cecum tissue and serum were determined by ELISA kit (JinYiBai, Nanjing) according to the instructions. The optical density values with a wavelength of 45 nm were determined by the enzymatic analyzer (Tecan Integral F50, Swiss).
Western blotting (WB)
Protein from cecum tissues were extracted by a lysis buffer. The concentration of proteins were measured by BCA kit (Beyotime, Shanghai). The protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Bio-Rad, USA). After transferred onto the polyvinylidene fluoride membranes (Millipore, USA), the membranes were blocked in the blocking buffer for 1 h at 37℃, incubated with the primary antibodies at 4℃ overnight. The primary antibodies included anti-TLR4 (1:200 dilution), MyD88 (1:200 dilution), NF-κB (1:200 dilution), β-actin (1:2000 dilution), which were all provided from Santa Cruz Biotechnology (USA). Then, the membranes were rinsed and incubated with the second antibodies for 80 min at 37℃. Finally, the protein expression was imaged by the Chemiluminescence Imaging System (Bio-Rad, USA), and bands were measured by ImageLab Software.
Immunohistochemistry
After the cecum tissues were fixed in 10% formaldehyde for 24 h and embedded in paraffin wax, the tissues were cut into sections. These sections were developed using Diaminobenzidine tetrahydrochloride (DAB) kits (CWBIO, Beijing). The sections of 4-µm thickness were incubated with NF-κB (1:200 dilution) overnight at 4℃. Second antibody and color were all conducted according to the DAB kits’ instruction. Views were randomly visualized under a microscope (DM2500; Leica, Germany).
Quantitative reverse transcription (qRT-PCR)
Total RNA from the cecum samples were extracted by Trizol reagent (Invitrogen, USA). Nanodrop 2000 was applied to determine the RNA concentration. Based on the manufacturer’s instruction of RevertAid𝑇M, cDNA was synthesized in a reverse transcript manner. According to the standard protocol, the qRT-PCR was performed using SYBR𝑇M Green Mater Mix (Thermo, USA). The relative changes of mRNA expression were analyzed by the comparative Ct method as previously described[30]. The primers were presented in Table 1.
Table 1
the primers used for qRT-PCR
Gene | Primers Sequence |
TLR4 | F 5’-3’ TGAATCCCTGCATAGAGGTA |
R 5’-3’GACCGTTCTGTCATGGAAGG |
MyD88 | F 5’-3’GTAGCCAGCCTCTGAAAC |
R 5’-3’AGCCAGGATGATGTCTAC |
NF-κB | F 5’-3’AGTTGAGGGGACTTTCCCAGGC |
R 5’-3’GATTCGAGTATTAGTTCATGGA |
β-actin | F 5’-3’TCCTCACTGAGGCCCCGC |
R 5’-3’CTGCCCCATGCCATTCTC |
Statistical analysis
All experiments were performed in triplicate. All data were analyzed using SPSS 22.0 and were presented as mean ± standard deviation. Multiple comparisons were performed using one-way analysis of variance followed by LSD test. A level of P < 0.05 was regarded as statistically significant.