Animals.
Experiments were conducted in male Wistar rats (200-250 g) (Charité-Universitätsmedizin Berlin, Campus Benjamin Franklin, Berlin, Germany). Rats were housed individually in cages and maintained on a 12 h light/dark schedule with food pellets and water ad libitum. Room temperature was maintained at 22 ± 0.5 °C and at a relative humidity between 60 and 65%. Experiments and animal care were performed according to the European Directive (2010/63/EU) introducing new animal welfare and care guidelines and were approved by the local animal care committee of the Senate of Berlin, Germany (Landesamt für Arbeitsschutz, Gesundheitsschutz und Technische Sicherheit, Berlin). All efforts were made to minimize the number of animals used and their suffering.
Induction of inflammation.
Under brief anesthesia with isoflurane (Willy Rüsch GmbH, Böblingen, Germany), rats received an intraplantar (i.pl.) injection of 0.15 ml FCA into the right hind paw. This treatment consistently produces a localized inflammation of the inoculated paw as reflected with an increase in paw volume, paw temperature and infiltration with various types of immune cells as previously described by [18].
Surgery to implant i.t catheter
The intrathecal catheterization (i.t) was performed as previously described [19, 20]. Briefly, an incision was made at the L3–L4 level. The catheter was inserted through needle at the L4-L5 vertebra. Keeping the angle of the needle parallel with the dorsal surface, the catheter was carefully pushed upward to reach L4 at the lumbar enlargement. The needle was carefully removed and the catheter was sealed with glue to the tissue to secure it. Then, saline was injected intrathecally in a volume of 10 µl to flush the catheter. Another skin incision was made at the neck of the animal and the catheter was tunnelled under the skin and pulled out at the neck after which incisions were sutured. Animals showing signs of neurological damage were immediately excluded from the study. The intrathecal location of the catheter was confirmed by administration of 10µl of lidocaine 2% flushed with 10µl of saline. Lidocaine but not saline caused reversible bilateral hindlimb paresis. The animals were allowed 2 days to recover. Drugs were injected intrathecally in a volume of 10 µl followed by 10 µl of vehicle to flush the catheter. All rats were investigated for correct catheter position in relation to the spinal cord on post-mortem laminectomy.
Drugs
The following drugs were used: rat/human CRF (Sigma-Aldrich, St. Louis, MO); CRF-R2 agonist urocortin-2 (Ucn-2), CRF-R2 antagonist K41498; CRF-R1 antagonist NBI35965 (Bio-Techne GmbH, Wiesbaden-Nordenstadt, Germany). Doses were calculated as the free base and drugs were dissolved in isotonic saline as vehicle. Volumes of i.t. drug administration was (10 µl). For each dose a separate group of animals (n=6) was used. Drugs were administered during brief isoflurane anesthesia
CRF-R1 and CRF-R2 mRNA detection by conventional PCR
PCR analysis for CRF-R1 and CRF-R2 specific mRNA from rat dorsal root ganglia was performed as described previously [21]. Total RNA was extracted from L3-5 dorsal root ganglia of Wistar rats (n=5 per experimental group) using RNeasy Kit (Qiagen, Hilden, Germany). 0,5µl (25pmol) oligo dT and 2µl (200pmol) random primers were added up to 1 μg total RNA, incubated at 37°C for 15 min, then at 85°C for 5 sec, finally at 4°C for transfer onto ice (according to TaKaRa® manual). cDNA was stored at −20 °C. The following specific primers were used: for CRF-R1, forward primer: ACACTACCATGTTGCAGTC, reverse primer: GAACATCCAGAAGAAGTTGG (Ensembl, Accession Nr: NM_030999); for CRF-R2, forward primer: CACACTGTGAACCCATTT TGG, reverse primer: GATGAGTTGCAGCAGG (Ensembl, Accession NM_022714). Conventional PCR was performed with a Maxima Hotstart Green Enzyme kit (Thermo Fisher Scientific GmbH Berlin, Germany). Amplification was carried on an Eppendorf PCR-Cycler Vapo.Protect (Eppendorf Vertrieb Deutschland GmbH, Wesseling-Berzdorf) out for 40 cycles, each consisting of 30 sec at 95 °C and of 30 sec at 60°C and 30 sec at 72°C. Specific bands were visualised on 2% agarose gel plus 0.01% ethidium bromide; the entire PCR product of 20 μl migrated for 40 min at 100 V in the BioRad chamber system with 1x TAE buffer. The imaging was performed on a Gel Doc EZ Imager (Bio-Rad Laboratories GmbH, Feldkirchen, Germany).
Radioligand Binding Assay
The following experiments should identify CRF1 or CRF2 specific binding sites in membrane preparations of rat spinal cord similar to our previous binding studies [22, 23]. Membrane preparations from Wistar rat atria were prepared by homogenizing them in cold assay buffer (50 mM Tris-HCl, 1 mM EGTA, 5 mM MgCl2, pH 7.4) and were centrifuged at 48,000×g at 4 °C for 20 min. The pellet was resuspended in assay buffer followed by 10 min incubation at 37 °C to remove endogenous ligands. The homogenates were centrifuged again and resuspended in assay buffer. Membranes were aliquoted and stored at -80 °C [23].
Displacement binding experiments were performed using [125]-iodinated CRF (Specific Activity 1.0 nmol, PerkinElmer, Germany). 200 µg of membrane protein was incubated with [125]-iodinated CRF (1.0 µmol) displaced with 10-13 – 10-5 M of CRF-R2 antagonist K41498 or CRF-R1 antagonist NBI35965 for 1 h at 22 °C in a total volume of 1 ml of binding buffer (50 mM Tris-HCl, 5 mM EDTA, 5 mM MgCl2, 100 mM NaCl, 0.2% bovine serum albumin). Nonspecific binding was defined as radioactivity remaining bound in the presence of 10 µM unlabeled CRF. At the end of the incubation period, bound and free ligands were separated by rapid filtration over GF/C filters under vacuum using a Brandel cell harvester (Gaithersburg, MD, USA). Filters were washed three times with 4 ml of cold buffer (50 mM Tris-HCl, pH 7.4). Bound radioactivity was determined by liquid scintillation spectrophotometry after overnight extraction of the filters in 3 ml of scintillation fluid [23]. All experiments were performed in duplicate and carried out at least four times. Nonspecific binding was subtracted from all [125]-iodinated CRF data. IC50 values in saturation binding assays were determined by nonlinear regression analysis of concentration-effect curves using GraphPad Prism (GraphPad Software Inc., CA, USA).
Algesiometric testing
Nociceptive thresholds were assessed by paw pressure test (modified Randall-Selitto test). Animals (n=6 per group) were gently restrained under paper wadding and incremental pressure was applied via a wedge-shaped, blunt piston onto the dorsal surface of the hind paw by means of an automated gauge (Ugo Basile). The pressure required to elicit paw withdrawal, the paw-pressure threshold (PPT), was determined. A cutoff of 250 g was used. Three consecutive trials, separated by intervals of 10 s, were conducted and the average was determined. Baseline PPT were tested before and 4 days after inoculation with FCA. The same procedure was performed on the contralateral side; the sequence of sides was alternated between subjects to preclude order effects. In all behavioral experiments, drugs were prepared by a different person (M. Sh.) and the examiners (B.N. and L.L.) were unaware of the treatment that each animal received by chance.
Western blot
Spinal cord from adult rats were solubilized and extracted for immunoblotting investigations as previously described [24]. Briefly, the samples were homogenized in boiling SDS sample buffer (100 mM Tris, 2% SDS, 20% glycerol). The protein concentration was measured using a BCA assay (Pierce, Rockford, IL, USA). 2-Mercaptoethanol and bromophenol blue were added before loading. The extracts were separated using SDS-PAGE (10%) using 80 µg protein per lane and then transferred onto nitrocellulose filters. The filters were blocked in 2.5% milk for 1 h and incubated with rabbit polyclonal CRF-R1 antibody raised against synthetic 17 amino acid peptide from N-Terminus extracellular domain of CRF-R1 (MBL, Wobum, MA, USA; MC-1778) or rabbit polyclonal CRF-R2 antibody raised against synthetic peptide corresponding to the extracellular N-terminal domain of CRF-R2 (Sigma; St Louis, MO, USA, C4241) (1:2.000, in 2.5% milk) overnight at 4 °C. After incubation with the secondary antibody (peroxidase-conjugated goat anti-rabbit, 1:40,000, Jackson ImmunoResearch, West Grove, PA) for 2h at ambient temperature, reactive protein bands were digitally visualized using ECL solutions (SuperSignal West Pico, Thermo Scientific) in ChemiDoc MP Imager. Finally, the blots were reprobed with monoclonal mouse anti-GAPDH antibody (1:20,000; Sigma Aldrich) as an internal standard. Experiments were performed in groups of 4 animals.
The Western blot bands specific for CRF-R1 (56 kDa) or CRF-R2 (38 kDa) according to their data sheet were quantified by Java Image processing and analysis software (ImageJ, open-source image software downloaded from the web# [25, 26].
Receptor selectivity
The most effective dose of i.t. CRF was administered together with different doses of CRF-R2 antagonist K41498 (0.75, 1.5, 3, 5 nmol) or CRF-R1 antagonist NBI35965 (0, 0.001, 0.002, 0.004 nmol) to determine the receptor selectivity of CRF-mediated antinociceptive effects. Then, the most effective dose of i.t. CRF-R2 antagonist urocortin II (0.78 pmol) was administered alone or together with different doses of corresponding CRF-R2 antagonist K41498 (0.75, 1.5, 3, 5 nmol) to determine the receptor selectivity of CRF2-mediated antinociceptive effects.
To examine whether CRF-elicited antinociception is opioid-mediated, the most effective doses of i.t. CRF agonist (0.002 nmol) or CRF-R2 agonist Ucn-2 (0.75 pmol) were administered together with the opioid receptor antagonist naloxone (0.05, 1, 3 mg).
Tissue preparation
Four days after FCA inoculation, rats were deeply anesthetized with isoflurane and transcardially perfused with 100 ml warm saline, followed by 300 ml 4% (w/v) paraformaldehyde in 0.16 M phosphate buffer solution (pH 7.4). After perfusion, spinal cord (L4-5) and brain were removed, postfixed in the same fixatives for 90 min, and then cryoprotected overnight at 4°C in PBS containing 10% sucrose. The tissues were then embedded in tissue-Tek compound (OCT, Miles Inc. Elkhart, IN) and frozen. Spinal cord and brain were serially cut at 40 µm on cryostat. Every fourth section of spinal cord and brain was collected in PBS (floating sections).
Immunofluorescence staining
For single or double immunofluorescence, tissue sections were processed as described previously [17]. Briefly, coronal or parasagittal spinal cord and brain sections were incubated with rabbit polyclonal antibody against CRF-R1 or CRF-R2 alone or in combination with guinea pig polyclonal antibody against CGRP (1:1000, Peninsula Laboratories, Belmont, CA), mouse monoclonal antibody against ENK (1:1000) or guinea pig polyclonal antibody against MOR (1:1000, Chemicon International, MA) as well as with guinea pig polyclonal antibody against CGRP in combination with rabbit anti-rat MOR (dilution of 1:1000) overnight at 4 Co. After incubation with primary antibodies, the tissue sections were washed with PBS and then incubated with Texas Red conjugated goat anti-rabbit antibody (Vector Laboratories) in combination with Alexa Fluor 488 goat anti-guinea pig or anti-mouse antibody (Invitrogen, Germany). Thereafter, sections were washed with PBS, and the nuclei stained bright blue with 4'-6-Diamidino-2-phenylindole (DAPI) (0.1 µg/ml in PBS) (Sigma). Finally, the tissues were washed in PBS, mounted in vectashield (Vector Laboratories) and imaged on a confocal laser scanning microscope, LSM510 (Carl Zeiss, Göttingen, Germany).
Specificity controls
To demonstrate specificity of staining, the following controls were included as mentioned in detail elsewhere [17, 27-29]: (i) preabsorption of diluted antibody against ENK, MOR with a synthetic peptide for ENK (Peninsula laboratories) or MOR (Gramsch Laboratories), respectively. (2) omission of either the primary antisera or the secondary antibodies.
Analysis of data
Data were analysed using one-way ANOVA followed Dunnett’s post hoc test. For data not normally distributed, Kruskal-Wallis One Way Analysis of Variance on ranks was performed, followed by Dunnett’s or Tukey post hoc test. Dose-response curves were analyzed by one-way ANOVA followed by linear regression. Differences were considered significant if P< 0.05. All tests were performed using Sigma Stat 2.03 (SPSS Science, Chicago, IL) software. Data are expressed as means ± SD or means ± s.e.m.