Cannabidiol treatment of proliferating 3T3-L1 pre-adipocytes affects mature cell size and expression of acyltransferases involved in lipid droplet synthesis

doi:10.21203/rs.3.rs-2689027/v1

Download PDF

Research Article

Cannabidiol treatment of proliferating 3T3-L1 pre-adipocytes affects mature cell size and expression of acyltransferases involved in lipid droplet synthesis

https://doi.org/10.21203/rs.3.rs-2689027/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The phytocannabinoid cannabidiol (CBD) has been demonstrated to possess anti-inflammatory, anti-seizure, anti-oxidant, and proposed anti-obesity effects. Therapeutic modalities that improve the size of existing adipocytes through a reduction in hypertrophy, or result in increased hyperplasia (increased cell number) and decreased hypertrophy (enlarged cell size) during adipogenesis can result in smaller adipocytes that maintain insulin sensitivity, reducing the incidence of dysfunctional adipose tissue. The effect of timing CBD treatment to the proliferation (mitotic expansion) phase or the differentiation phase of pre-adipocytes on hyperplasia, hypertrophy, and expression of genes involved in triacylglycerol synthesis has not been investigated. We aimed to determine how exposing 3T3-L1 pre-adipocytes to CBD during the expansion or differentiation phase affected proliferation, cell size, and expression of enzymes involved in triacylglycerol synthesis.

Methods

Cells were treated with CBD at doses of 0.2 µM (low [CBD]) or 20 µM (high [CBD]) for measurement of cell viability and proliferation. Additionally, pre-adipocytes were exposed to CBD during proliferation and before stimulation of differentiation (expansion phase) or during the differentiation protocol (differentiation phase) and cell size, total lipid deposition and gene expression of acylglycerophosphate acyltransferase-2 (AGPAT2), diacylglycerol acyltransferase-2 (DGAT2), and glycerol-3-phosphate acyltransferase-3 (GPAT3) were quantified in the mature, lipid-storing adipocytes.

Results

The high CBD dose reduced cell viability and completely inhibited differentiation of pre-adipocytes into mature adipocytes when cells were treated during the differentiation period. Treatment of cells with the high CBD dose during the mitotic clonal expansion period significantly reduced but did not inhibit differentiation of the cells into the mature phenotype. The low CBD dose did not affect cell viability and resulted in increased proliferation and smaller mature adipocytes that did not differ from control cells with regards to lipid droplet deposition but that exhibited changes in gene expression of AGPAT and GPAT.

Conclusions

Our results suggest that a low (0.2 µM), physiologically achievable dose of CBD affects mature adipocyte cell size and gene expression of acyltransferases involved in triacylglycerol synthesis and that these effects are dependent on timing the CBD exposure to the cell’s mitotic clonal expansion phase.

cannabidiol

adipocytes

obesity

3T3-L1

adipogenesis

Cannabidiol (CBD) is one of the most abundant non-psychotropic phytocannabinoids from the Cannabis sativa plant. It has recently gained popularity as a supplement due to its reported anti-inflammatory, anti-oxidant, and anti-seizure effects (Burstein, 2015; Atalay et al., 2019; Britch et al., 2021). Phytocannabinoids can interact with the body’s endocannabinoid system (ECS) through the cannabinoid receptors (CB1 and CB2), and through interactions with receptors from the expanded ECS, which include the transient receptor potential vanilloid (TRPV) channels, serotonin (5-HT1A) receptors, and peroxisome proliferator activated receptor-g (PPAR-g). Cannabidiol is a negative allosteric regulator of the CB1 receptor (Lapraire et al., 2015), one of the most abundant G protein-coupled receptors in the central nervous system (Kendall and Yudowski, 2017), although this molecule demonstrates highest affinity for receptors of the expanded ECS. The expanded ECS, also referred to as the endocannabinoidome, controls processes related to appetite, energy balance, metabolism, thermogenesis, and inflammation (Aizpurua-Olaizola et al., 2017).

Despite its reported anti-inflammatory and anti-seizure effects, the effects of CBD on parameters related to adiposity have not been fully elucidated. While in vitro experiments with 3T3-L1 cells, a well-established murine pre-adipocyte model, suggest that this phytocannabinoid exerts lipolytic effects (Silvestri et al., 2015), these effects seem to be related to the increase in genes related to adipocyte browning (Parray and Yun, 2016). Treatment of 3T3-L1 cells with CBD resulted in increased metabolic activity in these cells through an enhancement of lipolysis and thermogenesis, related to an elevation in expression of proteins involved in entry and oxidation of fatty acids in the mitochondria, including CPT1, ACSL, UCP1, and PGC-1a, and suggesting a browning of the adipocytes (Parray and Yun, 2016). In humans, Cavalheiro et al. (2022) reported that an exhaustive review of literature yielded that cannabis users have a lower body mass index compared to non-users. These reports of the potential beneficial effects of CBD on parameters related to obesity are offset by inconsistency in results from in vivo experiments with rodent models and human pilot studies. Wierucka-Ryback (2014) and colleagues reported that CBD injections resulted in differential effects on body weight and food intake depending on if rats were eating a high-fat vs a high-sucrose diet. On the other hand, intraperitoneal CBD injections resulted in no effect on body weight in mice in the 12 hours following injection (Riedel et al., 2009), while prolonged (13 d) treatment decreased body weight in rats (Ignatowska-Jankowska et al, 2011). A pilot study on the safety and efficacy of several phytocannabinoids on glycemic and lipid parameters on type 2 diabetic subjects reported that CBD did not affect body weight, visceral adiposity, or any lipid parameters tested (Jadoon et al., 2016).

Development of adipose tissue (adipogenesis) commences in utero with adipocytes developing from differentiated progenitor or mesenchymal cells (Orsso et al., 2020). The increase in adipogenesis that is observed starting between the 14th and 24th week of gestation occurs through proliferation and differentiation of these progenitor cells, and the increased size of mature, lipid-storing adipocytes (Lecoutre et al., 2018; Orsso et al., 2020). Proliferation of pre-adipocytes (hyperplasia) and enlargement in cell size through lipid droplet size increase (hypertrophy) both contribute to the increases in fat mass observed when caloric intake exceeds caloric expenditure. In adults, most increases in fat mass occurs through adipocyte hypertrophy since adipocyte number is determined before adolescence and remains relatively constant in life (Spalding et al., 2008). If hypertrophy outbalances hyperplasia the result are large, dysfunctional adipocytes that are more likely to lose insulin sensitivity (Kim et al., 2015), become hypoxic and apoptotic, and increase the release of pro-inflammatory mediators that recruit macrophages into the area, setting the stage for an inflammatory loop (Caldari-Torres and Beck, 2022).

Hypertrophy of adipocytes correlates with an increase in triacylglycerol synthesis, the major lipid stored in adipocyte lipid droplets. Triacylglycerols synthesis occurs through a complex set of biochemical pathways, with the final enzymatic reactions being catalyzed by acyltransferase enzymes that attach long-chain fatty acids to a glycerol backbone. The rate-limiting step in these acyltransferase reactions is mediated by glycerol-3-phosphate acyltransferase (GPAT), the enzyme that catalyzes the first step in de novo triacylglycerol synthesis through the acylation of glycerol-3-phosphate to create lysophosphatidic acid (Shan et al., 2010). GPAT3 is the major isoform expressed in adipocytes and plays a crucial role in adipogenesis, displaying an ~ 60-fold increase in expression during adipocyte differentiation (Shan et al., 2010). Other acyltransferases can also contribute to control of adipogenesis. Loss of function of 1-acylglycerol-3-phosphate-O-acyltransferase-2 (AGPAT2), which catalyzes the conversion of lysophosphatidic acid into phosphatidic acid, resulted in disrupted adipogenesis in 3T3-L1 cells (Subauste et al., 2012).

Although the effects of phytocannabinoids on parameters related to adiposity are a novel and exciting area of research, there are no current reports comparing the effects of CBD exposure on adipogenesis and associated processes in proliferating pre-adipocytes vs differentiating adipocytes. This project aimed to investigate the effect of CBD incubation during the mitotic clonal expansion and the differentiation phase of 3T3-L1 adipocytes on cell hyperplasia and hypertrophy. Specifically, we were interested in the effects of this phytocannabinoid on cell proliferation as a measure of hyperplasia, and cell size and expression of enzymes involved in triacylglycerol synthesis as a measure of lipid droplet synthesis and hypertrophy.

2.1. Reagents and materials

The murine fibroblast (3T3-L1, cat no. CL-173) immortalized cell line was purchased from ATCC (Manassass, VA). Phosphate buffered saline (PBS), Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), hematoxylin dye, and penicillin-streptomycin were purchased from Fisher Scientific (Pittsburg, PA). TPP polystyrene 6-well and 100 mm plates were from Midwest Scientific (Fenton, MO). Trypan blue, Oil Red O (ORO) dye, TRI reagent, insulin, dexamethasone (DEX), d-biotin, 3-isobutyl-1-methylxanthine (IBMX), and trypsin-EDTA 0.25% were purchased from Sigma-Aldrich (St Louis, MO). CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) was obtained from Promega (Madison, WI). Cannabidiol (CBD, item number 90080; Cayman Chemical Company, Ann Arbor, MI) was dissolved in 99% ethyl alcohol at a 2.5 µg/µl concentration. The spectrophotometer was manufactured by BioTek (Winooski, VT) and the MyGo Mini S Real-Time PCR Instrument was from IT-IS Life Science LTD (Dublin, Ireland). Primers for quantitative RT-PCR were purchased from Integrated DNA Technologies (Coralville, IL) and the AzuraQuant™ 1-Step Green LoRox kit was from Azura Genomics (Raynham, MA).

2.2. 3T3-L1 cell culture and differentiation

Cells were incubated in 100 mm dishes at 37˚C in a 5% CO₂ humidified atmosphere and were kept at less than 60–70% confluency during sub-culturing. Cells were passaged using trypsin-EDTA. The complete growth medium (CGM) used on the cells during expansion consisted of DMEM, 10% (v/v) heat-inactivated FBS, 1% antibiotics (100 U/ml penicillin and 100 µg/ml streptomycin), and 0.008 µg/ml D-biotin. Differentiation into the adipocyte phenotype was performed as described by Zebisch et al. (2012) with addition of CBD during either the mitotic clonal expansion or differentiation period. Details of the differentiation process are described in sub-sections 2.5 and 2.6.

2.3. Measures of cell viability

To measure the effect of CBD on 3T3-L1 cell viability, we treated cells with a low (0.2 µM) and a high (20 µM) dose of CBD for 24 and 48 h and quantified total live and percent (%) live cells via Trypan blue exclusion method. Briefly, cells were seeded in 6 well-plates at a 0.4 x 10⁵ cells/ml density in CGM supplemented with vehicle (EtOH) or CBD (0.2 µM or 20 µM) and allowed to incubate for 24 or 48 h. At the end of the incubation, cells were washed twice with 1X PBS and collected via trypsinization. Trypsin was inactivated via addition of CGM which contained serum. A 100 µl sample was collected from each well, mixed with 100 µl of Trypan blue, and total and % live cells were quantified using an automated cell counter (Countess II by Thermo Fisher Scientific, Pittsburgh, PA).

2.4. MTS assay

Cells were diluted and seeded in 96-well plates at a density of 1 x 10⁴ cells/well with the corresponding concentration of CBD (0.2 µM or 20 µM) or with vehicle (ethanol; control) in octuplicates. Cells were incubated for 24 and 48 h, at which time points cell proliferation was measured using an MTS assay. After addition of the MTS reagent cells were incubated for 2 h and proliferation was quantified spectrophotometrically at A490.

2.5. Effect of CBD addition during the cell expansion period on 3T3-L1 differentiation

To test the effect of 3T3-L1 exposure to CBD during the mitotic expansion period on the differentiation of the cells into the mature adipocyte phenotype, cells were seeded into 6-well plates at a 0.4 x 10⁵ cells/ml density in CGM supplemented with vehicle (EtOH) or CBD (0.2 µM or 20 µM). After 48 and 96 h, cells were washed twice with 1X PBS and fresh complete growth medium supplemented with vehicle or CBD was added. Two days after the second feeding with vehicle or CBD, cells were washed with 1X PBS and treated with a differentiation cocktail of complete growth medium with the addition of 0.5 mM IBMX, 1 µM DEX, and 20 µg/ml insulin. Forty-eight hours after addition of the differentiation cocktail, the cells were washed with 1X PBS and treated with post-differentiation medium consisting of growth medium supplemented with 20 µg/ml insulin. Treatment with post-differentiation medium was performed every forty-eight hours for a total of three times (Fig. 1a).

2.6. Treatment of 3T3-L1 cells with CBD during the differentiation period

To test the effect of 3T3-L1 exposure to CBD during the differentiation period on the differentiation of the cells into the mature adipocyte phenotype, cells were seeded into 6-well plates at a 0.4 x 10⁵ cells/ml density in complete growth medium. After 48 h and 96, cells were washed twice with 1X PBS and complete growth medium was added again. Forty-eight hours after the second feeding, cells were overconfluent and had lost the fibroblast phenotype. At this point, cells were washed with 1X PBS and treated with a differentiation cocktail of CGM supplemented with 0.5 mM IBMX, 1 µM DEX, 20 µg/ml insulin, and vehicle (ethanol) or 0.2 or 20 µM of CBD. Forty-eight hours after addition of the differentiation cocktail, the cells were washed with 1X PBS and treated with post-differentiation medium consisting of CGM with 20 µg/ml insulin and vehicle or CBD. Treatment with post-differentiation medium supplemented with vehicle or CBD was performed every forty-eight hours for a total of three times (Fig. 1b).

2.7. Cell staining and microscopy for cell size measurement

At the end of the differentiation period mature adipocytes containing lipid droplets could be visualized using an inverted microscope. Two days after the last post-differentiation feeding, cells were stained with Oil Red O (ORO) and hematoxylin to stain the lipid droplets and nuclei, respectively, according to the manufacturer’s instructions (Sigma-Aldrich, St. Louis, MO). Briefly, cells were washed twice with 1X PBS and then fixed by treatment with 1% paraformaldehyde for 60 min at room temperature. Next, cells were washed twice with water and incubated in 60% isopropanol for 5 min. The 60% isopropanol was discarded, then ORO was added to each well. The plate was incubated at 37℃, after which time the dye was discarded and wells were washed with water until the background was clear. Nuclei were stained by addition of hematoxylin for 1 min, after which time the solution was discarded, and the cells were washed with water until the background was clear.

Microscopic images were obtained using an Olympus BX51 microscope under 20X magnification and a PAXcam 3 camera. Two pictures were taken of each well. Cell size was quantified by measuring the area and diameter of 2 randomly selected adipocytes (2 cells per picture; 4 pictures per well) using ImageJ software.

2.8. Oil red O extraction and quantification of lipid deposition

Lipid droplet deposition was quantified through spectrophotometric analysis of ORO staining as described by Manickam et al. (2010). The ORO dye was extracted with 99% isopropanol and the isopropanol-dye solution was analyzed spectrophotometrically at A520 to quantify total lipid deposition.

2.9. RNA isolation and gene expression quantification

Two days after the last post-differentiation feeding, total cellular RNA was isolated from vehicle and CBD-treated mature adipocytes using TRI reagent according to the manufacturer’s instructions (Sigma-Aldrich, St. Louis, MO). RNA concentration and purity (A_{260 nm}/A _{280 nm}) was quantified using an Epoch Microplate Spectrophotometer with the Take3 Micro-Volume Plate adapter (BioTek, Santa Clara, CA). 30 ng of RNA were used for a one-step qPCR reaction, using the AzuraQuant Green 1-Step qRT-PCR Kit (Azura Genomic, Raynham, MA). The final reaction volume of 20 µl contained 10 µl of AzuraQuant™ Green One-Step qPCR Mix LoRox, 1 µl of 20x RTase, 0.8 µl of 10 µM forward primer and 0.8 µl of 10 µM reverse primer, and 30 ng of template RNA, with PCR-grade water making up the rest of the volume. Parameters utilized included one initial cycle at 50˚C for 10 minutes, one cycle of enzyme activation at 95˚C for 2 minutes, and 35 amplification cycles (95˚C, 5 sec; 60˚C, 25 sec). The oligonucleotide sequence of the forward and reverse primers used for amplification are presented in Table 1. The PCR reactions were performed using a fluorometric thermal cycler (MyGo Mini S; IT-IS Life Science Ltd., Drumcondra, Dublin). The ddCt method was used to determine relative quantification, and values were normalized to non-POU domain-containing octamer-binding protein (NONO), which was determined to be a highly suitable reference gene for 3T3-L1 cells undergoing mitotic clonal expansion as well as terminal differentiation (Arsenijevic et al., 2012). The genes of interest were acylglycerophosphate acyltransferase-2 (AGPAT2), diacylglycerol acyltransferase-2 (DGAT2), and glycerol-3-phosphate acyltransferase-3 (GPAT3). The individual Ct values are means of duplicate or triplicate measurements.

Table 1

Primer sequences used for real-time quantitative PCR
Gene	Primer sequence (5'-3')
NoNo	F: TGCTCCTGTGCCACCTGGTACTC
	R: CCGGAGCTGGACGGTTGAATGC
AGPAT2	F: AGCGGACAGAAGAAACTGGAGG
	R: TTAGCTCACGCTTGGCGATCTG
DGAT2	F: CTGTGCTCTACTTCACCTGGCT
	R: CTGGATGGGAAAGTAGTCTCGG
GPAT3	F: AGTGAGCTGGTGCATCTGACCT
	R: GATTGGCGACACAGATACCTCC

2.10. Statistical analyses

Statistical analyses were performed on JMP Pro 16.2 (Cary, NC). Effects of CBD concentration on total cell numbers, % live cells, cell proliferation, cell diameter, cell area, lipid deposition, and gene expression of enzymes involved in triacylglycerol synthesis (AGPAT, DGAT, GPAT) were analyzed using a full-factorial model. The sources of variation included experiment, treatment, experiment x treatment interaction. When treatment effects were detected, means were separated using post-hoc Tukey-Kramer HSD or Student’s t-tests. The level of significance was defined at p < 0.05. Experimental results are expressed as mean ± SE.

3.1. Effect of CBD on 3T3-L1 cell viability

In order to determine the effects of CBD on 3T3-L1 cell viability, we performed experiments testing a low and a high dose (0.2 and 20 µM) of the phytocannabinoid for 24 and 48 h. Cell viability was determined by taking into account % live cells and total cells (live + dead) at the end of the 24 and 48 h incubation periods. The high dose (20 µM) of CBD significantly decreased % live cells at both the 24 and 48 h time points compared to cells treated with vehicle and decreased total number of cells at 48 h (supplementary Fig. 1). These results suggest that the high dose of CBD decreases 3T3-L1 cell viability, while the low dose is well tolerated and presents no cytotoxic effects.

3.2. Effect of CBD on 3T3-L1 metabolic activity and cell proliferation

The MTS assay directly measures cell metabolic activity and is therefore an indicator of cell viability and cell proliferation. Cells treated with the low CBD dose for 24 h demonstrated an increase in cell metabolic activity, suggesting an increase in cell proliferation (Fig. 2). Discrepancies between the results of the MTS assay and the total number of cells and % live cells determined by Trypan blue assay can be attributed to differences in methodology. The methodology for the MTS assay requires 96-well plates and a lower seeding number which prevents the cells from reaching confluency. The higher seeding number utilized in the total and % live assays allows the cells to become confluent by the end of the incubation period, which results in contact inhibition. The MTS results indicate an increase in cell proliferation in CBD-treated cells compared to vehicle-treated cells.

3.3. Timing of CBD exposure affects mature 3T3-L1 adipocyte size but not total lipid deposition

To test the hypothesis that CBD incubation would affect cell size and total lipid deposition in mature 3T3-L1 adipocytes, we subjected 3T3-L1 pre-adipocytes to a commonly utilized differentiation protocol (Zebisch et al., 2012) and treated the cells with CBD either during the proliferation (expansion) period or during the differentiation period. Forty-eight hours after the end of the differentiation protocol, lipid droplets were stained with ORO, pictures of the cells were taken for adipocyte cell size measurement (ImageJ, NIH) and ORO dye was extracted using isopropanol for spectrophotometric analysis as previously described (Manickam et al., 2010).

Regardless of timing of CBD exposure (expansion vs differentiation), we did not observe a difference in total lipid deposition in cells treated with 0.2 µM CBD compared to vehicle-treated cells. Cells treated with the high dose of CBD (20 µM) had an observable decrease in total % of differentiated cells when treated during the mitotic expansion period and demonstrated a complete inhibition of differentiation when exposed to CBD during the differentiation period. The inhibition of cell differentiation is probably linked to the reduction in cell viability observed in pre-adipocytes treated with the 20 µM CBD dose. The significant reduction in ORO absorbance in the cells treated with the high CBD dose is explained by the reduction in adipocyte differentiation, as only differentiated, mature cells deposit large lipid droplets that would be stained by the ORO (Fig. 3). Based on these results, only the 0.2 µM concentration was included in subsequent analyses.

Quantification of ORO provides a measure of total lipid deposition in the cell population, but it does not provide a measure of cell size. Although we did not observe differences in total lipid deposition between control and 0.2 µM CBD-treated cells, we considered the possibility that cell size could have been affected by this phytocannabinoid, as more, smaller cells could deposit the same amount of total lipids as fewer, larger cells. We determined average cell size in control and 0.2 µM CBD-treated cells by quantifying cell area and diameter. Timing of CBD addition had a significant effect on cell diameter (timing*treatment, p = 0.002) and cell area (timing*treatment, p = 0.008). In general, cells treated with 0.2 µM CBD during the differentiation phase were larger compared to those treated during the mitotic expansion phase (diameter: 49.26 ± 1.57 vs 39.02 ± 1.81 µm; area: 1754.45 ± 117.70 vs 1098.66 ± 135.91 µm) (full-factorial ANOVA; p < 0.0001 [diameter], p = 0.0004 [area]) (Fig. 4). The smallest cell size was observed in cells exposed to 0.2 µM CBD during the expansion phase. These cells exhibited a reduction in cell diameter compared to control cells or cells treated with CBD during the differentiation phase, as well as a reduction in area compared to cells treated with vehicle or CBD during the differentiation phase. Timing of CBD addition (mitotic clonal expansion vs differentiation) has differential effects on cell size, with addition of the phytocannabinoid to pre-adipocytes during the expansion period resulting in significantly smaller mature adipocytes, while no effect on cell size was observed when addition was performed during the differentiation period. Interestingly, the difference in cell size did not correlate with a difference in total lipid deposition, suggesting that exposure of pre-adipocytes to 0.2 µM CBD during the expansion period results in smaller adipocytes that deposit the same amount of lipid droplets overall compared to control cells and to cells treated with CBD during the differentiation period.

3.4. CBD affects the expression of genes involved in triacylglycerol synthesis in mature 3T3-L1 cells

As adipocyte size is related to synthesis and storage of triacylglycerols in lipid droplets, we were interested in determining if CBD exposure affected the expression of genes for enzymes involved in triacylglycerol synthesis. We quantified the expression of three of the four enzymes involved in the Kennedy pathway, the triacylglycerol biosynthesis pathway that predominates in adipose tissue. Specifically, we quantified gene expression of GPAT3, considered the rate-limiting enzyme in this pathway (Wendel et al., 2009), as well as AGPAT2, and DGAT2. Based on our findings which demonstrated no difference in total lipid deposition between control cells and those treated with 0.2 µM CBD but a difference in cell size between these two groups when cells were treated with CBD during the expansion period, we expected CBD to affect gene expression patterns of triacylglycerol biosynthesis enzymes when cells were treated with the phytocannabinoid during the mitotic expansion but not the differentiation phase.

Addition of CBD to cells during the mitotic clonal expansion phase resulted in a significant decrease in relative expression of AGPAT2 compared to vehicle-treated cells (vehicle: 1.121 ± 0.178, CBD: 0.456 ± 0.178 2^DDCt; full-factorial ANOVA, p = 0.023). Expression of GPAT3 significantly increased in cells treated with CBD during the expansion phase (vehicle: 1.004 ± 0.081, CBD: 1.348 ± 0.081 2^DDCt; full-factorial ANOVA, p = 0.012) (Fig. 5 top panel), while DGAT2 gene expression tended to also increase in this group (vehicle: 1.003 ± 0.104, CBD: 1.296 ± 0.104 2^DDCt; full-factorial ANOVA, p = 0.07). Relative expression of genes for AGPAT2, DGAT2, and GPAT3 were not significantly affected by incubation with 0.2 µM CBD during the differentiation period (Fig. 5 bottom panel; full-factorial ANOVA, p = 0.27) although a numeric decrease was observed for all three genes. An increase in expression of the rate-limiting enzyme in triacylglycerol synthesis in the group that demonstrated the smallest cell size could signify a compensatory action in this lipid biosynthesis pathway. The decrease in expression of AGPAT2 might explain the reduction in cell size, as a decrease in lipid droplet deposition would result in smaller adipocytes. Additionally, increases in AGPAT2 expression are necessary for adipogenesis and the inhibition of this increased expression early in the cell’s life cycle could be dampening the adipogenic process. We did not observe significant differences in gene expression in the cells treated with CBD during the differentiation period, which agrees with our observation regarding a lack of difference in cell size in this treatment group compared to control cells.

In this study, we present evidence that a 0.2 µM concentration of CBD affects the development of 3T3-L1 pre-adipocytes into the mature, lipid-storing form, and results in smaller cells with an altered gene expression profile of enzymes involved in lipogenesis, compared to control cells. This effect was only observed when the cells were treated with CBD during the mitotic clonal expansion phase and not during the differentiation phase. These results highlight the potential for CBD to result in major changes in gene expression in the pre-adipocyte stage that could carry over to the mature adipocytes. While most studies that have explored the effects of CBD on 3T3-L1 cells have treated post-confluent pre-adipocytes or fully differentiated adipocytes, we treated pre-confluent pre-adipocytes for our expansion timing experiments. These cells most closely resemble the stem cells that give rise to adipose tissue in a human or mouse model. During adipogenesis, these cells are subject to epigenetic modifications, including the presence of bivalent histones (H3K4me3 and H3K27me3) that pause adipogenic genes during lineage commitment (Lecoutre et al., 2018). Following lineage commitment, the process of terminal differentiation ensues, resolving the bivalent state to give way to an active state, which is then followed by a wave of transcription factors that reorganize the chromatin to close regions of genes related to the pluripotent state and open regions involved in the second transcription factor wave (Lecoutre et al., 2018). Two major transcription factors of the second wave are PPAR-g and C/EBPa (Lefterova et al., 2014) which activate the expression of genes related to mature adipocytes, including glucose transporter type 4 (GLUT-4), leptin, and fatty acid synthase. Based on our findings, we surmise that treatment of pre-confluent pre-adipocytes with CBD resulted in epigenetic modifications that exerted stronger effects on the final, mature adipocyte phenotype than treatment of post-confluent pre-adipocytes during the differentiation period. Although other reports have demonstrated more pronounced effects of phytocannabinoids on increased metabolic activity and reduced lipogenesis in undifferentiated pre-adipocytes compared to differentiated adipocytes (Ramlugon et al., 2018), these experiments have treated post-confluent cells. We believe our results are the first report of the effect of CBD treatment of pre-confluent adipocytes on lipid deposition and cell size of mature adipocytes.

Considering that control and CBD-treated cells did not differ in lipid deposition as quantified by ORO extraction, and that the average size of CBD-treated cells was significantly smaller than control cells, we propose that CBD increases hyperplasia and decreases hypertrophy in the 3T3-L1 cell line, resulting in more, smaller adipocytes that deposit the same total quantity of lipid in droplets as control cells. The results of our MTS assay showed an increase in absorbance, which correlates with higher metabolic activity and therefore indirectly assesses cell proliferation, in cells treated with 0.2 µM of CBD for 24 h compared to control cells. Ramlugon and colleagues (2018) reported an increase in glucose uptake in pre-adipocytes and mature adipocytes treated for seven days with 10 µM CBD compared to cells treated with rosiglitazone, a PPAR-g agonist typically used to induce pre-adipocyte differentiation into the mature phenotype. This increase in glucose uptake was observed along with a decrease in fat accumulation, specifically in the pre-adipocytes, leading the researchers to state that cannabinoids promote lipolysis while improving glucose uptake and suggesting an increase in metabolic activity of the cells.

We also observed that CBD affected expression of genes involved in lipogenesis, including GPAT3, which along with fatty acid synthase, is one of the two critical enzymes involved in lipogenesis (Sul et al., 1998), and these effects were dependent on the timing of CBD addition. Interestingly, GPAT3 gene expression increased in the group that resulted in the smallest cell size (treatment during mitotic clonal expansion). Along with an increase in GPAT3, this group also demonstrated a significant decrease in expression of AGPAT2, which has been shown to be necessary for lipogenic differentiation, as AGPAT2^−/− mice present with lipodystrophy due to adipocyte death (Cautivo et al., 2016) and AGPAT2 mRNA and protein levels increase markedly during differentiation of 3T3-L1 cells (Subauste et al., 2012). We hypothesize that these effects are related to CBD’s reported ability to increase the transcriptional activity of PPAR-g (Esposito et al., 2011; Hedge et al., 2015), a nuclear receptor that plays a crucial role in the regulation of glucose homeostasis, lipoprotein metabolism, and inflammation (Hedge et al., 2015). Our results suggest that the transcriptional changes that result in the browning of adipocytes when exposed to CBD may also be driving the decrease in hypertrophy we observed when treating expanding pre-adipocytes with a low dose of CBD. A study on CBD’s ability to promote browning of 3T3-L1 adipocytes described how this phytocannabinoid induced the brown fat phenotype through induction of brown fat-specific genes and proteins with a concurrent increase in expression of PPAR-g and PI3K (Parray and Yun, 2016). Brown adipose tissue plays a major role in thermogenesis through the generation of heat that is associated with the oxidation of fatty acids mobilized from triacylglycerol stored in lipid droplets. Induction of genes and proteins associated with the brown fat phenotype can therefore explain the reduced cell size observed in CBD-treated cells. It is possible that the observed increase in GPAT3 in mature adipocytes treated with CBD during clonal expansion could be accompanied by enhanced metabolic activity due to increased lipolysis, which is a potential area for further study.

Although previous studies have documented an inhibition in lipid accumulation in 3T3-L1 cells treated with CBD, this effect was observed at higher doses than were utilized in our study. Parray and Yun (2016) reported an elevation in proteins involved in lipolysis, fatty acid oxidation, and mitochondrial biogenesis, as well as a down-regulation of enzymes involved in lipogenesis, which resulted in a significant reduction in lipid accumulation in cells treated with 10 µM CBD compared to control cells. Increased lipolysis in adipocytes was also observed by Silvestri et al. (2015) after treating fully mature 3T3-L1 cells with 5 and 10 µM doses of CBD. In humans, plasma CBD concentrations of ~ 1 µM are achievable in subjects supplementing with realistic doses of CBD (1500 mg/day) (Taylor et al., 2018). Unfortunately, no research on the pharmacokinetics of CBD in mouse models exist, making it difficult to extrapolate doses achievable in humans to murine cell models. Regardless, we consider a CBD concentration of 0.2 µM to be physiologically achievable in both humans and rodents.

Increases in adiposity can result in obesity and correlated co-morbidities due to the meta-inflammation that is associated with enlarged adipose tissue. Hypertrophic adipocytes lose insulin sensitivity, release inflammatory adipokines, and commence an inflammatory loop that attracts immune cells to the area, increasing their infiltration into this tissue (Caldari-Torres and Beck, 2022). Expansion of adipose tissue can occur due to hyperplasia of pre-adipocytes, hypertrophy of existing adipocytes, or a combination of both. Previous research has reported on the effects of CBD on parameters related to hyperplasia, including cell viability and metabolic activity/proliferation assays (Parray and Yun, 2016; Ramlugon et al., 2018; Raup-Konsavage et al., 2020), as well as hypertrophy in mature adipocytes (Silvestri et al., 2015; Ramlugon et al., 2018), but to our knowledge no research has examined the effects of timing of CBD incubation on hypertrophy of the mature cells.

In the United States the FDA has approved “Epidiolex", which contains a purified form of CBD, for the treatment of seizures associated with various syndromes in patients 1 year of age or older (GW Biosciences, 2018). With adipogenesis still occurring at significant rates in early childhood it is imperative that the effects of CBD on adipose cell proliferation and development be elucidated. While strategies that aim to regulate the size and number of adipocytes might be considered a therapeutic approach to treating obesity (Chang & Kim, 2019), we also need to consider how CBD could affect the development of adipose tissue in patients using this phytocannabinoid for its anti-seizure effects. Adipogenesis starts in utero and continues throughout infancy, with a continuous increase in adipose tissue development occurring during early and late childhood (Orsso et al., 2020) that is dependent on both the proliferation of pre-adipocytes and their differentiation into the mature phenotype. Exposure to physiologically relevant doses of CBD during these time periods could result in changes in patterns of adipogenesis with unknown consequences.

Our results on the effects of a low CBD dose (0.2 µM) on cell size and expression of genes involved in lipogenesis suggest that this phytocannabinoid possesses the ability to affect parameters related to adiposity and that these effects are more pronounced when treatment is administered to pre-confluent pre-adipocytes. CBD promoting hyperplasia and decreasing hypertrophy of mature adipocytes potentially correlates with an improved adipose inflammatory profile. Studies on the effects of physiologically achievable doses and plasma concentrations of CBD on adipogenesis in human in vivo and in vitro models are needed to elucidate this molecule’s role on adiposity control.

5-HT1A

serotonin

ACSL

long chain fatty acyl-CoA synthetase

AGPAT2

acylglycerophosphate acyltransferase-2

CBD

cannabidiol

C/EBPa

CCAAT/enhancer-binding protein alpha

CGM

complete growth medium

CPT-1

carnitine palmitoyltransferase 1

DEX

dexamethasone

DGAT2

diacylglycerol acyltransferase-2

DMEM

Dulbecco’s modified Eagle medium

ECS

endocannabinoid system

EtOH

ethanol

FBS

fetal bovine serum

GLUT-4

glucose transporter type 4

GPAT

glycerol-3-phosphate acyltransferase-3

IBMX

3-isobutyl-1-methylxanthine

MTS

3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium

ORO

oil red O

PBS

phosphate buffered saline

PGC-1a

peroxisome proliferator-activated receptor-gamma coactivator-1alpha

PPAR-g

peroxisome proliferator activated receptor-gamma

TRPV

transient receptor potential vanilloid

UCP1

uncoupling protein 1

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and material

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors have no relevant financial or non-financial interests to disclose.

Funding

This study was supported by the Denison University Biology Department, Provost’s Office, and Lisska Center for Scholarly Engagement.

Authors' contributions

We confirm that the manuscript has been read and approved by all named authors and that there are no other persons who satisfied the criteria for authorship but are not listed. We further confirm that the order of authors listed in the manuscript has been approved by all of us.

Conceptualization: CCT

Data Curation: CCT, MH, DK, YX

Formal Analysis: CCT

Funding Acquisition: CCT, MH, DK, YX

Investigation: CCT, MH, DK, YX

Methodology: CCT, MH, YX

Project Administration: CCT

Resources: CCT

Supervision: CCT

Visualization: CCT

Validation: CCT

Writing – original draft: CCT

Writing – review & editing: CCT

Acknowledgements

We are indebted to Dr. Andy McCall of Denison University’s Biology Department for his help with the statistical analyses and Dr. Joe Reczek from the Chemistry Department for the use of his microscope.

Aizpurua-Olaizola O, Elezgarai I, Rico-Barrio I, Zarandona I, Etxebarria N, Usobiaga A. Targeting the endocannabinoid system: future therapeutic strategies. Drug Discov Today. 2017;22:105.
Arsenijevic T, Grégoire F, Delforge V, Delporte C, Perret J. Murine 3T3-L1 adipocyte cell differentiation model: validated reference genes for qPCR gene expression analysis. PLoS One. 2012;7:e37517.
Atalay S, Jarocka-Karpowicz I, Skrzydlewska E. Antioxidative and Anti-Inflammatory Properties of Cannabidiol. Antioxidants (Basel). 2019;25:21.
Britch SC, Babalonis S, Walsh SL. Cannabidiol: Pharmacology and Therapeutic Targets. Psychopharmacology (Berl). 2021;238:9.
Burstein S. Cannabidiol (CBD) and its analogs: a review of their effects on inflammation. Bioorg Med Chem. 2015;23:1377.
Caldari-Torres C, Beck J. Effects of co-incubation of LPS-stimulated RAW 264.7 macrophages on leptin production by 3T3-L1 adipocytes: a method for co-incubating distinct adipose tissue cell lines. Bull Natl Res Cent. 2022;46:57.
Cautivo KM, Lizama CO, Tapia PJ, Agarwal AK, Garg A, Horton JD, et al. AGPAT2 is essential for postnatal development and maintenance of white and brown adipose tissue. Mol Metab. 2016;5:491.
Cavalheiro EKFF, Costa AB, Salla DH, Silva MR da, Mendes TF, Silva LE da, et al. Cannabis sativa as a Treatment for Obesity: From Anti-Inflammatory Indirect Support to a Promising Metabolic Re-Establishment Target. Cannabis Cannabinoid Res. 2022;7:135.
Chang E, Kim CY. Natural Products and Obesity: A Focus on the Regulation of Mitotic Clonal Expansion during Adipogenesis. Molecules. 2019;24:1157.
Esposito G, Scuderi C, Valenza M, Togna GI, Latina V, De Filippis D, et al. Cannabidiol reduces Aβ-induced neuroinflammation and promotes hippocampal neurogenesis through PPARγ involvement. PLoS One. 2011;6:e28668.
Gorelick J, Assa-Glazer T, Zandani G, Altberg A, Sela N, Nyska A, et al. THC and CBD affect metabolic syndrome parameters including microbiome in mice fed high fat-cholesterol diet. J Cannabis Res. 2022;4:27.
GW Biosciences. (2018). Epidiolex. Retrieved April 25, 2019, from www.fda.gov/.
Hegde VL, Singh UP, Nagarkatti PS, Nagarkatti M. Critical Role of Mast Cells and Peroxisome Proliferator–Activated Receptor γ in the Induction of Myeloid-Derived Suppressor Cells by Marijuana Cannabidiol In Vivo. J Immun. 2015;194:5211.
Ignatowska-Jankowska B, Jankowski MM, Swiergiel AH. Cannabidiol decreases body weight gain in rats: Involvement of CB2 receptors. Neurosci Lett. 2011;490:82.
Jadoon KA, Ratcliffe SH, Barrett DA, Thomas EL, Stott C, Bell JD, et al. Efficacy and Safety of Cannabidiol and Tetrahydrocannabivarin on Glycemic and Lipid Parameters in Patients With Type 2 Diabetes: A Randomized, Double-Blind, Placebo-Controlled, Parallel Group Pilot Study. Diabetes Care. 2016;39:1777.
Kendall DA, Yudowski GA. Cannabinoid Receptors in the Central Nervous System: Their Signaling and Roles in Disease. Front Cell Neurosci. 2017;10:294.
Kim JI, Huh JY, Sohn JH, Choe SS, Lee YS, Lim CY, et al. Lipid-Overloaded Enlarged Adipocytes Provoke Insulin Resistance Independent of Inflammation. Mol Cell Biol. 2015;35:1686.
Knittle JL, Timmers K, Ginsberg-Fellner F, Brown RE, Katz DP. The growth of adipose tissue in children and adolescents. Cross-sectional and longitudinal studies of adipose cell number and size. J Clin Invest. 1979;63:239.
Laprairie RB, Bagher AM, Kelly MEM, Denovan-Wright EM. Cannabidiol is a negative allosteric modulator of the cannabinoid CB1 receptor. Br J Pharmacol. 2015;172:4790.
Lecoutre S, Petrus P, Rydén M, Breton C. Transgenerational Epigenetic Mechanisms in Adipose Tissue Development. Trends Endocrinol Metab. 2018;29:675.
Lefterova MI, Haakonsson AK, Lazar MA, Mandrup S. PPARγ and the global map of adipogenesis and beyond. Trends Endocrinol Metab. 2014;25:293.
Lowe HIC, Toyang NJ, McLaughlin W. Potential of Cannabidiol for the Treatment of Viral Hepatitis. Pharmacognosy Res. 2017;9:116.
Manickam E, Sinclair AJ, Cameron-Smith D. Suppressive actions of eicosapentaenoic acid on lipid droplet formation in 3T3-L1 adipocytes. Lipids Health Dis. 2010;9:57.
Martínez-Sánchez N. There and Back Again: Leptin Actions in White Adipose Tissue. Int J Mol Sci. 2020;21:6039.
Orsso CE, Colin-Ramirez E, Field CJ, Madsen KL, Prado CM, Haqq AM. Adipose Tissue Development and Expansion from the Womb to Adolescence: An Overview. Nutrients. 2020;12:2735.
Parray HA, Yun JW. Cannabidiol promotes browning in 3T3-L1 adipocytes. Mol Cell Biochem. 2016;416:131.
Ramlugon S, Levendal RA, Frost CL. Time-dependent effect of phytocannabinoid treatments in fat cells. Phytother Res. 2018;32:1080.
Raup-Konsavage WM, Carkaci-Salli N, Greenland K, Gearhart R, Vrana KE. Cannabidiol (CBD) Oil Does Not Display an Entourage Effect in Reducing Cancer Cell Viability in vitro. Med Cannabis Cannabinoids. 2020;3:95.
Riedel G, Fadda P, McKillop-Smith S, Pertwee RG, Platt B, Robinson L. Synthetic and plant-derived cannabinoid receptor antagonists show hypophagic properties in fasted and non-fasted mice. Br J Pharmacol. 2009;156:1154.
Ruan H, Pownall HJ. Overexpression of 1-Acyl-Glycerol-3-Phosphate Acyltransferase-α Enhances Lipid Storage in Cellular Models of Adipose Tissue and Skeletal Muscle. Diabetes. 2001;50:233.
Shan D, Li J liang, Wu L, Li D, Hurov J, Tobin JF, et al. GPAT3 and GPAT4 are regulated by insulin-stimulated phosphorylation and play distinct roles in adipogenesis. J Lipid Res. 2010;51:1971.
Silvestri C, Paris D, Martella A, Melck D, Guadagnino I, Cawthorne M, et al. Two non-psychoactive cannabinoids reduce intracellular lipid levels and inhibit hepatosteatosis. Journal Hepatol. 2015;62:1382.
Spalding KL, Arner E, Westermark PO, Bernard S, Buchholz BA, Bergmann O, et al. Dynamics of fat cell turnover in humans. Nature. 2008;453:783.
Subauste AR, Das AK, Li X, Elliot B, Evans C, El Azzouny M, et al. Alterations in Lipid Signaling Underlie Lipodystrophy Secondary to AGPAT2 Mutations. Diabetes. 2012;61:2922.
Taylor L, Gidal B, Blakey G, Tayo B, Morrison G. A Phase I, Randomized, Double-Blind, Placebo-Controlled, Single Ascending Dose, Multiple Dose, and Food Effect Trial of the Safety, Tolerability and Pharmacokinetics of Highly Purified Cannabidiol in Healthy Subjects. CNS Drugs. 2018;32:1053.
Taylor L, Gidal B, Blakey G, Tayo B, Morrison G. A Phase I, Randomized, Double-Blind, Placebo-Controlled, Single Ascending Dose, Multiple Dose, and Food Effect Trial of the Safety, Tolerability and Pharmacokinetics of Highly Purified Cannabidiol in Healthy Subjects. CNS Drugs. 2018;32:1053.
Veilleux A, Di Marzo V, Silvestri C. The Expanded Endocannabinoid System/Endocannabinoidome as a Potential Target for Treating Diabetes Mellitus. Curr Diab Rep. 2019;19:117.
Wendel AA, Lewin TM, Coleman RA. Glycerol-3-phosphate acyltransferases: rate limiting enzymes of triacylglycerol biosynthesis. Biochim Biophys Acta. 2009;1791:501.
Wierucka-Rybak M, Wolak M, Bojanowska E. The effects of Leptin in Combination with a Cannabinoid Receptor 1 Antagonist, AM 251, or Cannabidiol On Food Intake and Body Weight in Rats Red a High-Fat or a Free-Choice High Sugar Diet. J Physiol Pharmacol. 2014;65:487.
Wiley JL, Burston JJ, Leggett DC, Alekseeva OO, Razdan RK, Mahadevan A, et al. CB1 cannabinoid receptor-mediated modulation of food intake in mice. Br J Pharmacol. 2005;145:293.
Zebisch K, Voigt V, Wabitsch M, Brandsch M. Protocol for effective differentiation of 3T3-L1 cells to adipocytes. Anal Biochem. 2012;425:88.
Zou S, Kumar U. Cannabinoid Receptors and the Endocannabinoid System: Signaling and Function in the Central Nervous System. Int J Mol Sci. 2018;19:833.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Cannabidiol treatment of proliferating 3T3-L1 pre-adipocytes affects mature cell size and expression of acyltransferases involved in lipid droplet synthesis

Status:

Version 1

Abstract

Figures

1. Background

2. Materials and Methods

2.1. Reagents and materials

2.2. 3T3-L1 cell culture and differentiation

2.3. Measures of cell viability

2.4. MTS assay

2.5. Effect of CBD addition during the cell expansion period on 3T3-L1 differentiation

2.6. Treatment of 3T3-L1 cells with CBD during the differentiation period

2.7. Cell staining and microscopy for cell size measurement

2.8. Oil red O extraction and quantification of lipid deposition

2.9. RNA isolation and gene expression quantification

2.10. Statistical analyses

3. Results

3.1. Effect of CBD on 3T3-L1 cell viability

3.2. Effect of CBD on 3T3-L1 metabolic activity and cell proliferation

3.3. Timing of CBD exposure affects mature 3T3-L1 adipocyte size but not total lipid deposition

3.4. CBD affects the expression of genes involved in triacylglycerol synthesis in mature 3T3-L1 cells

4. Discussion

5. Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1