Feeding with 4,4′-diaponeurosporene-producing Bacillus subtilis enhances the lactogenic immunity of sow

doi:10.21203/rs.3.rs-2700293/v1

Download PDF

Research Article

Feeding with 4,4′-diaponeurosporene-producing Bacillus subtilis enhances the lactogenic immunity of sow

https://doi.org/10.21203/rs.3.rs-2700293/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The delivery of specific antibodies produced by oral administration of the porcine epidemic diarrhea virus (PEDV) vaccine by sow to newborn piglets via colostrum is an effective strategy to prevent porcine epidemic diarrhea (PED). However, there is a lag in the development of the corresponding vaccine due to the rapid mutation rate of PEDV, which could significantly increase the difficulty of PED prevention and control in pig farms. Hence, congenital lactogenic immunity was assessed by feeding 4,4′-diaponeurosporene-producing Bacillus subtilis (B.S-Dia) to sow on the 80th day of gestation in order to protect newborn piglets from PEDV infection. Firstly, we found that the quantities of T lymphocytes and monocytes in the blood and colostrum of sow after oral administration of B.S-Dia were significantly increased as observed by flow cytometry, whereas the proliferative activity of T lymphocytes in colostrum was also markedly increased. Furthermore, enzyme-linked immunosorbent assay (ELISA) results revealed that levels of TGF (Transforming growth factor) -β, Interleukin (IL) -6, lysozyme and lactoferrin were significantly increased. Finally, it was found in the piglets’ challenge protection test that offspring pigs of which sow was exposed to oral administration of B.S-Dia during pregnancy did not develop diarrhea symptoms and intestinal pathological changes 48 h after infection with PEDV, and the load of PEDV in the jejunum and ileum was significantly reduced, but offspring pigs of which was exposed to oral administration of PBS during pregnancy developed pronounced diarrhea symptoms and extensive PEDV colonization was noted both in the jejunum and ileum. In summary, oral administration of B.S-Dia by sow substantially increased congenital lactogenic immunity, thereby preventing newborn piglets from being infected with PEDV.

Congenital lactogenic immunity

4′-diaponeurosporene-producing Bacillus subtilis (B.S-Dia)

cytokines

lysozyme and lactoferrin

PEDV

Porcine epidemic diarrhea (PED) is a gastrointestinal infectious disease caused by the porcine epidemic diarrhea virus (PEDV) and is primarily characterized by watery diarrhea of newborn piglets. The mortality rate after infection is as high as 90%. At present, most of the vaccines used against PED prevention on the market are intramuscular injection vaccines, however, injection vaccines are unable to produce immune protection in time due to the imperfect development of the immune system of newborn piglets[1]. In recent years, studies about developing novel strategies to protect the piglets from PEDV infection by the immunizing sow, including refeeding and oral administration of PEDV vaccines have become a hot topic[2, 3]. Lactogenic immunity-induced PEDV vaccines are mainly provided by specific antibodies in the sow’s colostrum[4]. For instance, Saif et al. reported that oral administration of PEDV by a pregnant sow could markedly increase levels of specific antibodies and quantity of IgA⁺B lymphocytes in colostrum, and significantly reduce diarrhea rate and mortality in piglets[2]. Additionally, oral administration of attenuated PEDV vaccine by a pregnant sow could also elevate levels of the specific antibodies in colostrum[5].

Oral administration of the PEDV vaccine by sow induces the production of IgA plasmablasts in the intestine, then these cells could migrate into the mammary gland through the gut-mammary gland-SIgA axis, and secrete dimeric IgA antibodies into the colostrum to form specific SIgAs[6]. Vaccination remains the most promising and effective way to prevent and control PEDV. However, effective vaccines for epidemic PEDV strains of swine farms are still under development[7]. The studies also revealed that cross-protection between different PEDV strains wasn’t ideal[8, 9]. Hence, strategies to improve the congenital lactogenic immunity of sows to protect piglets from PEDV infection may be an effective way.

Bacillus subtilis (B.S) is a commonly used probiotic that can be used as an additive in animal feed[10]. Carotenoid could display unique biological functions and act as a potent mucosal immune enhancer. 4,4′-diaponeurosporene-producing Bacillus subtilis (B.S-Dia) was constructed as described in a study[11]. A plasmid (pMK3-crtMN) containing two carotenoid synthases, dehydrosqualene synthase, crtM, and dehydrosqualene desaturase, crtN, was constructed. The plasmid was transformed into B.S (WB800, the name of the strain) by electroshock. A previous study in our laboratory has found that mice fed by B.S-Dia exhibited improved intestinal congenital immunity, thus effectively resisting Salmonella infection[12]. In this study, the potential effects of multiple feeding of sows with B.S-Dia on congenital lactogenic immunity were investigated. The challenge protection test was used to verify whether the lactogenic immunity obtained by the piglets could effectively resist the infection of PEDV, in order to provide another pathway for the effective prevention and control of the occurrence of PED.

2.1 Animals

In this study, the sows were purchased from Hongsong pig farm in Gaochun City, Jiangsu Province. The antibodies against PEDV, porcine reproductive and respiratory syndrome virus (PRRSV), porcine respiratory coronavirus (PRCV), transmissible gastroenteritis virus (TGEV) and pseudorabies virus (PRV) and porcine circovirus 2 (PCV2) were negative. This study was approved by the Ethics Committee of Animal Experiments center of Nanjing Agricultural University. All animal studies were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University (SYXK-2017-0007), and followed the National Institutes of Health guidelines for the performance of animal experiments.

2.2 Cells and virus strains

Vero E6 cells and PEDV Zhejiang 08 (epidemic strain) were presented by Dabei agricultural animal medicine research center. Swine testicular (ST) cells were stored in this laboratory. TGEV (SHXB) was provided by the Jiangsu Provincial Academy of Environmental Science (JAAS).

2.3 Experimental design

Thirty healthy sows randomly selected from the pig farm were divided into three groups: in B.S-Dia group, sows fed with 5 mL of B.S-Dia (1×10¹⁰ CFU/ mL); B.S group, 5 mL of Bacillus subtilis WB800 (1×10¹⁰ CFU/ mL) were fed; In PBS group, 5 mL PBS was taken orally on the 80th day of gestation (GD80). All sows were given orally every 5 days until delivery (GD115) (Fig. 1A)

Piglets are free to suck breast milk after birth. After 5 days of age, 5 piglets from each group were randomly selected and orally infected with PEDV Zhejiang 08 strain (TCID₅₀ = 3). All newborn piglets were euthanized 48 h after infection, and the time of euthanasia was determined according to the literature[13]. Fecal samples of piglets were collected at 0, 6, 12, 24, 36 and 48 h after infection, and the clinical symptoms of piglets were observed. Blood, duodenum, jejunum, ileum and mesenteric lymph nodes were collected for related tests. In addition, the clinical symptoms were observed and scored 0–48 h after infection. The specific scoring criteria are as follows: 0 indicates that the stool is hard and shaped; 1 point indicates that the feces are soft and shaped; 2 points means that the feces are semi-solid without shape; A score of 3 indicates watery diarrhea.

2.4 Detection of immune cells in blood

After delivery, 10 mL blood was collected from the ear vein of sows, and 1 mL whole blood was taken for the detection of full-automatic blood analyzer (BC-5000, Nanjing Baden Medical Co., Ltd.). The remaining blood is used to separate monocytes and lymphocytes. 9 mL lymphocyte separation solution is added to a 50 mL sterile centrifuge tube, then an equal volume of anticoagulant is slowly added, and centrifuged at 400 g for 25 min, collect the white layer in the middle and wash it with RPMI medium twice, then, the collected cells were resuspended 100 µL PBS. CD3 (Number: 561476, APC mouse anti pig CD3ε, BD) and CD14 (Number: 17000-1-AP, Rabbit anti pig CD14, Proteintech) were performed by flow cytometry.

2.5 Detection of the number of immune cells and the lymphocyte proliferation in colostrum

50 mL colostrum was collected from sows after delivery, and 20 mL colostrum was taken for cell separation. The separation method was improved according to the previous study[14]. The specific operation steps are as follows: colostrum was filtered through a nylon mesh (210 µm) to remove impurities, then, the fat layer and supernatant were discarded after centrifugation at 340 g for 15 min. Furthermore, the cell precipitate was washed with pre-cooled PBS, centrifuged at 340 g for 15 min, and the supernatant was discarded, thereafter, the operation was repeated. Finally, the obtained cell precipitate samples were resuspended with 100 µL PBS for CD3 and CD14 detection by flow cytometry.

The remaining 30 mL colostrum was used to isolate lymphocytes (Lactation Lymphocyte Separation Solution, Beijing Solabao Biotechnology Co., Ltd.). The cells in colostrum were isolated after centrifuged (500 g, 10 min) and resuspended with sample dilution to prepare single cell suspension (2🞨10⁸-2🞨10⁹/mL). Then, 5 mL separation solution slowly added the single cell suspension. It centrifuged at room temperature with a horizontal rotor at 500–900 g for 20–30 min. We carefully aspirated the second annular milky white lymphocyte layer with a pipette, transferring to another sterile 15 mL centrifuge tube and adding 10 mL cell washing solution to wash the white film layer. The cells were centrifuged at 250 g for 10 min and the supernatant was discarded, and the cells were resuspended by adding 5 mL PBS or cell washing solution at 250 g for 10 min; the above steps were repeated. The isolated lymphocytes were labeled with Carboxyfluorescein succinimidyl ester (Number:565082, CFSE, BD) and incubated at 37°C for 8 min, followed by 2 washes with RPMI medium, and cells were spread at 1🞨10⁶ cells/well in 12-well plates and stimulated by adding phytohemagglutinin (PHA, 50ng/mL) or IL-2 (1000 IU), which stimulated the proliferation of T lymphocytes[15]. After 24 h, the cells were centrifuged at 300 g for 10 min and resuspended by adding 1 mL PBS, and the proliferative activity of lymphocytes was detected by flow cytometry.

2.6 Detection of cytokines and antiviral proteins in colostrum

Colostrum was first filtered through a nylon mesh (210 µm) to remove impurities and then centrifuged at 340 g for 15 min at 4°C. The fat layer and sediment were discarded and the whey was collected. Next, the whey was centrifuged at 12,000 g for 30 min to remove residual fat. The collected whey was assayed by non-specific SIgA, IgG, IL-6, IL-4, IFN-γ, TGF-β, CCL2, lactoferrin and lysozyme ELISA kits. It referred to the instructions of the kit (Shanghai Huyu Biotechnology Co., Ltd.) for the specific method.

2.7 Detection of viral load in piglet feces and tissues

Sterile cotton swabs dipped in the feces of piglets were placed in a 1.5 mL centrifuge tube and added with 500 mL PBS, followed by centrifugation at 12000 rpm for 15 minutes to collect the supernatant, and the supernatant was collected by centrifugation after grinding the piglets' tissues. 500 µL supernatant was added to 500 µL Trizol reagent, and total cellular RNA was extracted according to the traditional Trizol method. RNA concentrations of different treatment groups were standardized before reverse transcription, and cDNA was subsequently obtained by reverse transcription according to the instructions of HiScript TM QRT SuperMix kit (Novozymes Biotechnology Co., Ltd.). The cDNA was diluted 5-fold with DEPC water and amplified with SYBR Green qPCR Master Mix enzyme for RT-qPCR. Mix enzyme. The PEDV load in feces was determined by absolute quantification, and the plasmid constructed from the PEDV-N gene sequence was used as a standard and a standard curve was made. PEDV load in piglets’ intestine was measured by relative quantitative PCR. GAPDH was used as the internal reference and PEDV-N gene was used as the target gene for amplification. The primer sequences were referred to Table 1.

Table 1

The primers used in this study
Gene	Primer forward/Reverse	Length
PEDV-N-F	AAGGCGCAAAGACTGAACCC	20bp
PEDV-N-R	TGTTGCCATTACCACGACTCC	21bp
GAPDH-F	TCATCATCTCTGCCCCTTCT	20bp
GAPDH-R	GTCATGAGTCCCTCCACGAT	20bp

The viral load in the intestine was further verified by Western blotting. The procedure was as follows: jejunum and ileum were collected and proteins were lysed with RIPA lysis buffer. Protein concentration was then determined by Bicinchoninic Acid Assay. All samples were detected by protein blotting using the specific antibody PEDV-N (Medgenelabs Biological)[16]. For tissues, GAPDH was used as an internal control to assess protein content.

The viral distribution in the intestine was verified by immunofluorescence assay. Sections were dewaxed and incubated in citric acid-sodium citrate buffer (pH = 6.0) for 15 min to antigen repair, washed with PBS, and incubated dropwise with 5% bovine serum albumin for 1 h to block nonspecific antibody binding. It added with PEDV-N antibody after washing 5 times with PBS, and incubated overnight at 4°C. After PBS washes, FITC goat anti-mouse IgG (Number: bs-0296G-FITC, Beijing boarsen Co., Ltd.) was added to the sections and incubated for 2 h. The sections were washed 5 times with PBS and 4',6-Diamidino-2-phenylindole (Number: 564907, DAPI, BD) was added to show the cell nuclei. The viral distribution in the intestine was observed using fluorescence confocal microscopy.

2.8 Detection of the antiviral function of whey in colostrum

The collected whey was mixed with PEDV (10⁴ PFU) and incubated in a 37ºC incubator for 1 h. Then, they were inoculated into Vero E6 cells at 4ºC and 37ºC for 1 h. After incubation, the cells were washed with DMEM medium to remove residual virus and protein, followed by the addition of 1 mL DMEM medium containing 2% FBS to each well. After 24 hours, the supernatant of cell culture was collected for plaque test.

The collected whey was mixed with Vero E6 cells incubated in a 37ºC incubator for 1 h. After incubation, the cells were washed with DMEM medium to remove residual protein. Then, PEDV (10⁴ PFU) were added into cells and inoculated into at 4ºC and 37ºC for 1 h. After incubation, the cells were washed with DMEM medium to remove residual virus, followed by the addition of 1 mL DMEM medium containing 2% FBS to each well. After 24 hours, cell culture supernatant and RNA samples were collected for plaque tests and RT-qPCR.

The collected whey was mixed with ST cells incubated in a 37ºC incubator for 1 h. After incubation, the cells were washed with MEM medium to remove residual protein. Then, TGEV (10⁴ PFU) were added into cells and inoculated into at 4ºC and 37ºC for 1 h. The subsequent steps are the same as above.

2.9 Distribution of CD3⁺T lymphocytes in the mammary glands of sows and the jejunum of piglets.

Immunohistochemical staining (IHC) was used to observe the number of CD3⁺T lymphocytes in the tissues. The 4% paraformaldehyde-fixed mammary and jejunal tissues were first dehydrated in different concentrations of alcohol and then placed in xylene for transparency, followed by paraffin embedding and preparation of paraffin sections. After the sections were dewaxed, IHC was performed using the Strept Avidin-Biotin Complex (SABC) kit (Bode biological company). Dewaxed sections were incubated in citric acid-sodium citrate buffer for 15 min to antigen repair. Endogenous peroxidase was blocked by adding 3% H₂O₂ and incubated for 1 h in a 37°C incubator, washed 5 times with PBS followed by 5% bovine serum albumin together for 1 h to block non-specific antibody binding. CD3 antibody (Number: bs-10498R, Rabbit Anti-Pig CD3, Beijing boarsen Co., Ltd.) was titrated after washing 5 times with PBS and incubate overnight at 4°C. Then, sections were added the corresponding biotinylated secondary antibody and incubate for 1 h. After 5 washes with PBS, they were added SABC and incubated for 1 h at 37°C, developing the color with 3,3-diaminobenzidine. Finally, tissue sections were observed the using an ordinary light microscope.

3.1 Effects of oral B.S -Dia on quantity and proliferative activity of the cells in sow blood and colostrum

To explore the potential effects of oral administration of B.S-Dia by sow on the number of white blood cells (WBCs), blood was collected from the ear vein of sow and analyzed by an automated cell analyze (Fig. 1B). The results indicated that oral administration of B.S-Dia could significantly increase the quantity of WBCs in blood (Fig. 1B). Monocytes and T lymphocytes have been established as main WBCs, which play a key role in viral infection, so the quantities of monocytes and T lymphocytes in blood were detected by flow cytometry. The results showed that oral administration of B.S-Dia can lead to significantly increased quantities of monocytes and T lymphocytes in sow blood (P < 0.05) (Fig. 1C-E).

A part of immunocytes in the blood entered the mammary gland. In the study, the number of T lymphocytes in the mammary gland of sows feeding with B.S-Dia was significantly increased (Sup Fig. 1). Furthermore, immune cells in the breast finally were transported into the colostrum, therefore, flow cytometry was used to study the changes of the quantity of monocytes and T lymphocytes in the colostrum. It was found that compared with the PBS group, the quantities of monocytes (average = 36.5%) and T lymphocytes (average = 14%) in the colostrum of sow after oral administration of B.S-Dia were significantly increased (Fig. 2A-B). In addition to cell number, the lymphocytes to possess proliferative activity has a critical role for the immune defense of the piglets. In this study, it was observed that compared with the B.S group (PHA: average = 821; IL-2: average = 827) and the PBS group (PHA: average = 946; IL-2: average = 907), the fluorescence intensity of T lymphocytes in sow colostrum (PHA: average = 788; IL-2: average = 769) was significantly decreased (Fig. 2C-E) (P < 0.05, P < 0.01) in the B.S-Dia group, whereas the fluorescence intensity and proliferative activity were negative related. In summary, oral administration of B.S-Dia by sow could lead to enhanced proliferative activity of T lymphocytes.

3.2 Effects of B.S-Dia on colostrum levels of cytokine and antiviral protein

The nutrients in the sow colostrum mainly included lactoprotein, milk fat and lactose. First, the proportion of these three components in colostrum was detected. Compared with the B.S group (average = 11.3) and the PBS group (average = 11.0), the lactoprotein content in the sow colostrum of the B.S-Dia group was found to be significantly increased (P < 0.05), with an average of 15% (Fig. 3A). In addition, to provide nutrition from casein, lactoprotein in colostrum can also include antibodies, cytokines and antiviral substances, which possess the functions of enhancing piglet immunity and virus resistance. In this study, the concentrations of IgG in colostrum were observed to be significantly increased in the B.S-Dia group (Fig. 3B). Thereafter, the concentrations of IFN-γ, TGF-β and IL-6 in colostrum were detected, because these cytokines have antiviral function. It was noted that compared with the PBS group, the contents of TGF-β and IL-6 in colostrum increased significantly in the B.S-Dia group (Fig. 3C). Additionally, concentration of the two important antiviral proteins, lysozyme and lactoferrin, reached 298.9 µg/L nd 592.0 µg/mL in the colostrum, respectively, in the B.S-Dia group, which was significantly higher than that in the PBS group (Fig. 3D) (P < 0.01).

Could the increased levels of cytokines and antiviral proteins in colostrum following sow feeding of B.S-Dia play a role in the process of viral infection? Therefore, as shown in Supplementary Fig. 2A, whey collected from sows of B.S-Dia, B.S and PBS group was preincubated with virus prior to PEDV infection and the mixture was subsequently inoculated on Vero E6 cells. The results of the plaque assay (Sup. Figure 2. B, C) showed that whey of sows in the B.S-Dia, B.S and PBS group pretreated with PEDV failed to inhibit PEDV infection. The above results indicated that the antiviral substances in whey could not act directly on the virus. Then, would these antiviral substances exert antiviral function by stimulating cells? As shown in Fig. 4A, in the experiment whey was preincubated with Vero E6 cells prior to viral infection, then infected with PEDV. The results of RT-qPCR (Fig. 4B) and plaque assay (Fig. 4C, D) suggested that whey from sows feeding B.S-Dia pretreated cells was able to significantly inhibit intracellular viral expression and release of infectious particles. Next, to investigate the effect of antiviral substances in colostrum on other enteroviruses, a similar cell treatment method was performed (Fig. 4E), and the results showed that whey from sows feeding B.S-Dia pretreated cells also significantly inhibited transmissible gastroenteritis virus (TGEV) infection (Fig. 4F).

3.3 Effect of congenital lactogenic immunity on PEDV infection in the newborn piglets

In order to evaluate the potential protective effect of congenital lactogenic immunity on the piglets produced by sow feeding (Fig. 5A), the clinical symptoms of piglets infected with PEDV were monitored. It was found that the PBS group and the B.S group displayed typical PEDV symptoms at 48 h, including acute watery diarrhea, depression and decreased appetite, which were absent in the B.S-Dia group. In order to evaluate the degree of piglet diarrhea, scoring was carried out according to the stool consistency, with higher scores indicating more severe diarrhea. The piglets in the PBS group had a diarrhea score close to 2.4 at 48 h after infection with PEDV, which was significantly higher than the B.S (1.2) group and B.S-Dia (0) group (Fig. 5B) (P < 0.05, P < 0.01). Moreover, the detection of the viral load in feces showed that piglets of the B.S-Dia group had lower viral load at 36 and 48 h of infection (Fig. 5C). Additionally, the piglets of the B.S-Dia group exhibited no obvious pathological symptoms upon dissection and the piglets had abundant intestinal contents with no changes in the intestinal wall (Fig. 5D). However, piglets of the B.S group and the PBS group possessed no intestinal contents, and the intestinal wall was relatively thin and transparent (Fig. 5D).

The viral distribution in piglet gut was detected by Real-time qPCR. As observed, PEDV primarily existed in the jejunum and ileum of piglets, and the viral RNA content in the piglets’ jejunum and ileum was significantly lower than that of the B.S group and the PBS group (Fig. 6A). In addition, Western Blot results also revealed that the jejunum and ileum of the piglets in the B.S-Dia group contained less PEDV protein, and the jejunum of the piglets in the B.S group had a significantly lower viral load as compared to the piglets in the PBS group (Fig. 6B-C) (P < 0.05, P < 0.01). Moreover, results of immunofluorescence detection also showed that no PEDV antigen was observed in the jejunum and ileum villous epithelial cells of piglets in the B.S-Dia group, whereas a large number of PEDV-positive cells were found in the jejunum and ileum of piglets in the B.S group and the PBS group (Fig. 6D). The above results showed that congenital lactogenic immunity induced sows by fed with B.S-Dia effectively reduced PEDV viral loads of piglets’ intestine.

3.4 Effects of feeding of sow with B.S-Dia on piglet immunity

Newborn piglets can primarily acquire immunity through colostrum, thus resisting infection by pathogenic microorganisms. In order to verify the potential effects of oral administration of B.S-Dia by sow on piglet immunity, the quantity of lymphocyte (CD3) and concentrations of IL-6, lysozyme and lactoferrin in the piglet were investigated for research in this study. The results of immunohistochemical analysis showed that the quantity of CD3⁺T lymphocytes in the piglets in the B.S-Dia group was significantly increased (average = 127), but the quantity of CD3⁺T lymphocytes in the other groups was lower (Sup. Figure 3A, B) (P < 0.01). Additionally, the blood levels of IL-6, lysozyme and lactoferrin of piglets in the B.S-Dia group were significantly increased (Sup. Figure 3C) (P < 0.05, P < 0.01). In summary, oral administration of B.S-Dia by sow can significantly enhance immunity of the newborn piglets.

PED is one of the major intestinal diseases that can cause diarrhea in the newborn piglets, with high morbidity and mortality[17]. Although oral administration of immune-specific vaccine by sow could effectively provide lactogenic protection for the newborn piglets, the production of vaccine was far behind the mutation speed of the virus due to the fast speed of PEDV mutation, which can increase the difficulty in PED prevention and control in the pig farms. It has been demonstrated that high levels of specific antibodies could be produced in sow milk after oral administration of PEDV vaccine, but the piglets still developed diarrhea symptoms after challenge, which might be related to infection with the different subtypes of PEDV (different from vaccine strains)[14]. The above results indicated that the cross-protective effect of different PEDV isoforms of vaccine was not ideal. We also obtained a surprising result that feeding with B.S-Dia could not only increase the quantity of immunocytes in colostrum, but also improved the levels of different cytokines and antiviral protein in colostrum, and congenital lactogenic immunity produced by feeding of sow with B.S-Dia could effectively prevent the piglets from infecting PEDV by challenge protection test. Additionally, congenital immunity was not limited by viral antigenic and might protect the piglets from infection with another enterovirus, such as, TGEV. But cytokines and antiviral proteins that belong to congenital immunity exist in the piglets for a short time, and it couldn’t provide protection of piglets for a long time.

The sow intestinal submucosa has been reported to be widely distributed in dendritic cells (DC), which could protrude dendrites across the epithelium into the intestinal lumen to grab Bacillus subtilis, and then DC can migrate into the mesenteric lymph nodes, thereby activating initial T lymphocytes and promoting cytokine secretion. A number of previous have demonstrated that oral administration of B.S-Dia could significantly induce the maturation of mouse bone-derived DCs and enhance the proliferation function of T lymphocytes[10]. T lymphocytes, cytokines and antiviral protein can thereby home to the mammary gland through the gut-mammary gland-SIgA axis and enter the colostrum[18, 19]. Therefore, feeding with B.S-Dia effectively stimulate sow to produce congenital lactogenic immunity.

On the 40th day of sow pregnancy, the quantity of T lymphocytes in the mammary gland began to increase gradually and reached the maximum level on the 80th day of pregnancy[2], hence B.S-Dia was fed on the 80th day of sow gestation, and fed several times until the sow parturition. The results showed that T lymphocytes in colostrum not only increased quantitatively, but also significantly increased the proliferative activity. Moreover, the chemokine CCL2 could promote the migration of T lymphocytes across the mammary gland epithelial cells[20]. It was also observed that oral administration of B.S-Dia led to significantly increased colostrum level of CCL2, which could be the main reason for the increase in the quantity of T lymphocytes in colostrum. T lymphocytes in the colostrum were able to pass through the gut of the newborn piglets and entered the circulatory system, thus contributing both to the development of the autoimmune system[21]. In addition to T lymphocytes, colostrum also contained a large number of the monocytes, which differentiated into the macrophages after entering the intestine of the newborn piglets[22]. When the body was infected by a virus, phagocytic-lysosomes could be formed in macrophages[23]. In the phagolysosome, lysozyme and the various hydrolases decomposed the virus into the small molecular particles, finally transporting to the outside of the cell through exocytosis, which was beneficial for the body to resist viral infection[23].

The cytokines were transferred into newborn piglets through the colostrum and played an important role in regulating immune and antiviral responses[24]. IL-6 could regulate the body's immune response[25]. In addition, IL-6 also exhibit antiviral functions. IL-6 prevent the assembly of hepatitis B virus into the cells, thereby effectively inhibiting the replication of the virus[26]. IL-6 could also suppress virus invasion by downregulating the expression of HBV-specific receptors present on the cell surface[27]. TGF-β affected cell proliferation and differentiation, regulate intestinal inflammation, and stimulate antibody secretion in the intestine of the newborn piglets[28, 29]. Additionally, TGF‐β also exhibit diverse antiviral properties. In hepatocytes, TGF‐β can exert antiviral functions by blocking the invasion and replication of hepatitis C virus in a TGF‐β /SMAD signaling pathway-dependent manner[30]. Moreover, another study showed that TGF‐β could also activate the expression of IFN-β through modulating the TGF‐β/SMAD signaling pathway to inhibit the replication of human syncytial virus in macrophages[31]. In this study, feeding of sow with B.S-Dia was found to significantly enhance the antiviral ability of piglets, which might be related to increased colostrum levels of TGF‐β and IL-6.

Sow colostrum is relatively rich in lactoferrin, which could inhibit the invasion of viruses[32, 33]. Lactoferrin primarily block the virus invasion by binding to the viral particles or adhesion molecules on the surface of the target cells. It has been demonstrated that lactoferrin resist entry of the viruses by binding to the rotavirus particles, thus preventing the binding of viruses to specific receptors on the surface of intestinal epithelial cells[34, 35]. Sano et al. found that lactoferrin could directly interact with the F1 subunit of the F protein antigen site of the respiratory complex virus, thereby resisting the viral infection[36]. Lang et al. reported that lactoferrin blocked the interaction between the spike protein of SARS-CoV-2 and the host cells by binding to heparan sulfate proteoglycans on the surface of the host cell[37]. In addition, sow colostrum also contain lysozyme, which also exhibit significant antiviral functions. Lysozyme has a large number of positive charges in the body, and some studies have shown that lysozyme could directly interact with the negatively charged viral proteins to form viral DNA and RNA apo-groups double salt, thereby inactivating the virus[38]. In another study, Mann et al. demonstrated that the positive charges carried by lysozyme inhibited virus-induced cell fusion and thus affected the transmission of NF-кB signaling pathway, thereby inhibiting the viral infection[39]. In our study, feeding of sow with B.S-Dia elevate levels of the lysozyme and lactoferrin in colostrum, which might benefit the newborn piglets against PEDV infection.

In general, gestating sows fed B.S-Dia were able to improve congenital lactogenic immunity and protect newborn piglets from PEDV infection, and it provided another pathway for the prevention the occurrence of PED. However, there are limitations in this study. Firstly, which innate immune factors in colostrum would inhibit viral replication remain unknown, future studies are warranted to better understand the mechanisms involved. Furthermore, B.s-Dia needs to be applied and promoted in more large-scale pig farms to further verify the effect on inducing congenital lactogenic immunity.

Author Contributions

Peng Liu performed the experiments and wrote the manuscript; Qi Zhang prepared the reagents and helped detect cytokines in colostrum; Chengjie Yang, Xiuyu Wang, Yuchen Li and Jianda Li were responsible for the collection of samples; Qian Yang initiated the study, designed the experiments, and supplied the manuscript. All authors reviewed the manuscript.

The authors would like to thank all the reviewers who participated in the review, as well as MJEditor (www.mjeditor.com) for providing English editing services during the preparation of this manuscript.

Funding

This work was financially supported by the National Key Research and Development Program of China (Grant No. 2021YFD1801105), the National Natural Science Foundation of China (31930109) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflict of Interest

The authors have declared that no competing interests exist.

Ethics Statement

This study was approved by the Ethics Committee of Animal Experiments center of Nanjing Agricultural University. All animal studies were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University (SYXK-2017-0007), and followed the National Institutes of Health guidelines for the performance of animal experiments.

Cabinian A, Sinsimer D, Tang M, Zumba O, Mehta H, Toma A, Sant'Angelo D, Laouar Y, Laouar A: Transfer of Maternal Immune Cells by Breastfeeding: Maternal Cytotoxic T Lymphocytes Present in Breast Milk Localize in the Peyer's Patches of the Nursed Infant. PloS one 2016, 11(6):e0156762.
Langel SN, Paim FC, Alhamo MA, Buckley A, Van Geelen A, Lager KM, Vlasova AN, Saif LJ: Stage of Gestation at Porcine Epidemic Diarrhea Virus Infection of Pregnant Swine Impacts Maternal Immunity and Lactogenic Immune Protection of Neonatal Suckling Piglets. Frontiers in immunology 2019, 10:727.
Langel SN, Paim FC, Alhamo MA, Lager KM, Vlasova AN, Saif LJ: Oral vitamin A supplementation of porcine epidemic diarrhea virus infected gilts enhances IgA and lactogenic immune protection of nursing piglets. Veterinary research 2019, 50(1):101.
Baker AA, Davis E, Spencer JD, Moser R, Rehberger T: The effect of a Bacillus-based direct-fed microbial supplemented to sows on the gastrointestinal microbiota of their neonatal piglets. Journal of animal science 2013, 91(7):3390-3399.
Song DS, Oh JS, Kang BK, Yang JS, Moon HJ, Yoo HS, Jang YS, Park BK: Oral efficacy of Vero cell attenuated porcine epidemic diarrhea virus DR13 strain. Research in veterinary science 2007, 82(1):134-140.
Langel SN, Paim FC, Lager KM, Vlasova AN, Saif LJ: Lactogenic immunity and vaccines for porcine epidemic diarrhea virus (PEDV): Historical and current concepts. Virus research 2016, 226:93-107.
Li Z, Ma Z, Li Y, Gao S, Xiao S: Porcine epidemic diarrhea virus: Molecular mechanisms of attenuation and vaccines. Microbial pathogenesis 2020, 149:104553.
Huan C, Pan H, Fu S, Xu W, Gao Q, Wang X, Gao S, Chen C, Liu X: Characterization and evolution of the coronavirus porcine epidemic diarrhoea virus HLJBY isolated in China. Transboundary and emerging diseases 2020, 67(1):65-79.
Zhang Y, Chen Y, Yuan W, Peng Q, Zhang F, Ye Y, Huang D, Ding Z, Lin L, He H et al: Evaluation of Cross-Protection between G1a- and G2a-Genotype Porcine Epidemic Diarrhea Viruses in Suckling Piglets. Animals : an open access journal from MDPI 2020, 10(9).
Alexopoulos C, Georgoulakis IE, Tzivara A, Kritas SK, Siochu A, Kyriakis SC: Field evaluation of the efficacy of a probiotic containing Bacillus licheniformis and Bacillus subtilis spores, on the health status and performance of sows and their litters. Journal of animal physiology and animal nutrition 2004, 88(11-12):381-392.
Liu H, Xu W, Chang X, Qin T, Yin Y, Yang Q: 4,4'-diaponeurosporene, a C30 carotenoid, effectively activates dendritic cells via CD36 and NF-κB signaling in a ROS independent manner. Oncotarget 2016, 7(27):40978-40991.
Liu H, Xu W, Yu Q, Yang Q: 4,4'-Diaponeurosporene-Producing Bacillus subtilis Increased Mouse Resistance against Salmonella typhimurium Infection in a CD36-Dependent Manner. Frontiers in immunology 2017, 8:483.
Li Y, Wang X, Zhang E, Liu R, Yang C, Duan Y, Jiang Y, Yang Q: Calpain-1: a Novel Antiviral Host Factor Identified in Porcine Small Intestinal Mucus. mBio 2022, 13(5):e0035822.
Subramaniam S, Yugo DM, Heffron CL, Rogers AJ, Sooryanarain H, LeRoith T, Overend C, Cao D, Meng XJ: Vaccination of sows with a dendritic cell-targeted porcine epidemic diarrhea virus S1 protein-based candidate vaccine reduced viral shedding but exacerbated gross pathological lesions in suckling neonatal piglets. The Journal of general virology 2018, 99(2):230-239.
Badia R, Ballana E, Castellví M, García-Vidal E, Pujantell M, Clotet B, Prado JG, Puig J, Martínez MA, Riveira-Muñoz E et al: CD32 expression is associated to T-cell activation and is not a marker of the HIV-1 reservoir. Nature communications 2018, 9(1):2739.
Li Y, Wu Q, Huang L, Yuan C, Wang J, Yang Q: An alternative pathway of enteric PEDV dissemination from nasal cavity to intestinal mucosa in swine. Nature communications 2018, 9(1):3811.
Van Diep N, Choijookhuu N, Fuke N, Myint O, Izzati UZ, Suwanruengsri M, Hishikawa Y, Yamaguchi R: New tropisms of porcine epidemic diarrhoea virus (PEDV) in pigs naturally coinfected by variants bearing large deletions in the spike (S) protein and PEDVs possessing an intact S protein. Transboundary and emerging diseases 2020, 67(6):2589-2601.
Zhang S, Chen F, Zhang Y, Lv Y, Heng J, Min T, Li L, Guan W: Recent progress of porcine milk components and mammary gland function. Journal of animal science and biotechnology 2018, 9:77.
De Rosa V, Galgani M, Santopaolo M, Colamatteo A, Laccetti R, Matarese G: Nutritional control of immunity: Balancing the metabolic requirements with an appropriate immune function. Seminars in immunology 2015, 27(5):300-309.
Liu P, Zhang P, Yuan C, Li J, Yang Q: Mechanism of transepithelial migration of lymphocytes into the milk in porcine mammary glands. Journal of reproductive immunology 2022, 149:103440.
Moylan DC, Pati SK, Ross SA, Fowler KB, Boppana SB, Sabbaj S: Breast Milk Human Cytomegalovirus (CMV) Viral Load and the Establishment of Breast Milk CMV-pp65-Specific CD8 T Cells in Human CMV Infected Mothers. The Journal of infectious diseases 2017, 216(9):1176-1179.
Nechvatalova K, Kudlackova H, Leva L, Babickova K, Faldyna M: Transfer of humoral and cell-mediated immunity via colostrum in pigs. Veterinary immunology and immunopathology 2011, 142(1-2):95-100.
Zhang H, Ge S, Ni B, He K, Zhu P, Wu X, Shao Y: Augmenting ATG14 alleviates atherosclerosis and inhibits inflammation via promotion of autophagosome-lysosome fusion in macrophages. Autophagy 2021, 17(12):4218-4230.
Nguyen TV, Yuan L, Azevedo MS, Jeong KI, Gonzalez AM, Saif LJ: Transfer of maternal cytokines to suckling piglets: in vivo and in vitro models with implications for immunomodulation of neonatal immunity. Veterinary immunology and immunopathology 2007, 117(3-4):236-248.
Sato A, Hashiguchi M, Toda E, Iwasaki A, Hachimura S, Kaminogawa S: CD11b+ Peyer's patch dendritic cells secrete IL-6 and induce IgA secretion from naive B cells. Journal of immunology (Baltimore, Md : 1950) 2003, 171(7):3684-3690.
Kuo TM, Hu CP, Chen YL, Hong MH, Jeng KS, Liang CC, Chen ML, Chang C: HBV replication is significantly reduced by IL-6. Journal of biomedical science 2009, 16(1):41.
Bouezzedine F, Fardel O, Gripon P: Interleukin 6 inhibits HBV entry through NTCP down regulation. Virology 2015, 481:34-42.
Ogawa J, Sasahara A, Yoshida T, Sira MM, Futatani T, Kanegane H, Miyawaki T: Role of transforming growth factor-beta in breast milk for initiation of IgA production in newborn infants. Early human development 2004, 77(1-2):67-75.
Massacand JC, Kaiser P, Ernst B, Tardivel A, Bürki K, Schneider P, Harris NL: Intestinal bacteria condition dendritic cells to promote IgA production. PloS one 2008, 3(7):e2588.
Zou LL, Li JR, Li H, Tan JL, Wang MX, Liu NN, Gao RM, Yan HY, Wang XK, Dong B et al: TGF-β isoforms inhibit hepatitis C virus propagation in transforming growth factor beta/SMAD protein signalling pathway dependent and independent manners. Journal of cellular and molecular medicine 2021, 25(7):3498-3510.
Pokharel SM, Shil NK, Bose S: Autophagy, TGF-β, and SMAD-2/3 Signaling Regulates Interferon-β Response in Respiratory Syncytial Virus Infected Macrophages. Frontiers in cellular and infection microbiology 2016, 6:174.
Florisa R, Recio I, Berkhout B, Visser S: Antibacterial and antiviral effects of milk proteins and derivatives thereof. Current pharmaceutical design 2003, 9(16):1257-1275.
Zhou H, Li X, Wang Z, Yin J, Tan H, Wang L, Qiao X, Jiang Y, Cui W, Liu M et al: Construction and characterization of thymidine auxotrophic (ΔthyA) recombinant Lactobacillus casei expressing bovine lactoferricin. BMC veterinary research 2018, 14(1):206.
González-Chávez SA, Arévalo-Gallegos S, Rascón-Cruz Q: Lactoferrin: structure, function and applications. International journal of antimicrobial agents 2009, 33(4):301.e301-308.
Latorre D, Puddu P, Valenti P, Gessani S: Reciprocal interactions between lactoferrin and bacterial endotoxins and their role in the regulation of the immune response. Toxins 2010, 2(1):54-68.
Sano H, Nagai K, Tsutsumi H, Kuroki Y: Lactoferrin and surfactant protein A exhibit distinct binding specificity to F protein and differently modulate respiratory syncytial virus infection. European journal of immunology 2003, 33(10):2894-2902.
Lang J, Yang N, Deng J, Liu K, Yang P, Zhang G, Jiang C: Inhibition of SARS pseudovirus cell entry by lactoferrin binding to heparan sulfate proteoglycans. PloS one 2011, 6(8):e23710.
Behbahani M, Nosrati M, Mohabatkar H: Inhibition of Human Immunodeficiency Type 1 Virus (HIV-1) Life Cycle by Different Egg White Lysozymes. Applied biochemistry and biotechnology 2018, 185(3):786-798.
Mann JK, Ndung'U TJFV: The potential of lactoferrin, ovotransferrin and lysozyme as antiviral and immune-modulating agents in COVID-19. 2020, 15(9):609-624.

No competing interests reported.

Sup.Fig1.tif
Supplementary Fig1 (A) Immunohistochemical detection of the number of lymphocyte (CD3) in the mammary gland, n=3; Magnification×100, ×400, scale bar=50, 20μm. (B) The numbers of CD3⁺T cells were counted in random fields (×400), the significant difference between different treatment groups was determined by one-way ANOVA, **P<0.01.
Sup.Fig2.tif
Supplementary Fig2 (A) Anti-PEDV effects analysis of sow whey after oral administration of B.S-Dia, B.S and PBS. PBS, the colostral whey from sows in PBS group was pretreated with PEDV; B. S, PEDV pretreated with colostral whey of sows in oral administration of B. subtilis group; B.S-Dia, the colostral whey from sows in B.S-Dia group was pretreated with PEDV. (B) Plaque test were used to detect the antiviral effect. The significant difference between different treatment groups was determined by one-way ANOVA, NS, no significant difference.
Sup.Fig3.tif
Supplementary Fig3 (A) Immunohistochemical detection of the number of lymphocyte (CD3) in the intestinal tract of piglets, magnification×100, ×400, scale bar=50 μm; (B) The numbers of CD3+T cells were counted in random fields (×400), significant differences were analyzed by one-way ANOVA, **P < 0.01. (C) The concentrations of cytokines and antiviral proteins in the blood of piglets were detected by ELISA kit, n=5, and the significant difference between different treatment groups was determined by one-way ANOVA, *P<0.05, **P<0.01.

Download PDF

Version 1

posted

You are reading this latest preprint version

Feeding with 4,4′-diaponeurosporene-producing Bacillus subtilis enhances the lactogenic immunity of sow

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Animals

2.2 Cells and virus strains

2.3 Experimental design

2.4 Detection of immune cells in blood

2.5 Detection of the number of immune cells and the lymphocyte proliferation in colostrum

2.6 Detection of cytokines and antiviral proteins in colostrum

2.7 Detection of viral load in piglet feces and tissues

2.8 Detection of the antiviral function of whey in colostrum

2.9 Distribution of CD3⁺T lymphocytes in the mammary glands of sows and the jejunum of piglets.

3. Results

3.2 Effects of B.S-Dia on colostrum levels of cytokine and antiviral protein

3.3 Effect of congenital lactogenic immunity on PEDV infection in the newborn piglets

3.4 Effects of feeding of sow with B.S-Dia on piglet immunity

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

Feeding with 4,4′-diaponeurosporene-producing Bacillus subtilis enhances the lactogenic immunity of sow

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Animals

2.2 Cells and virus strains

2.3 Experimental design

2.4 Detection of immune cells in blood

2.5 Detection of the number of immune cells and the lymphocyte proliferation in colostrum

2.6 Detection of cytokines and antiviral proteins in colostrum

2.7 Detection of viral load in piglet feces and tissues

2.8 Detection of the antiviral function of whey in colostrum

2.9 Distribution of CD3+T lymphocytes in the mammary glands of sows and the jejunum of piglets.

3. Results

3.2 Effects of B.S-Dia on colostrum levels of cytokine and antiviral protein

3.3 Effect of congenital lactogenic immunity on PEDV infection in the newborn piglets

3.4 Effects of feeding of sow with B.S-Dia on piglet immunity

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

2.9 Distribution of CD3⁺T lymphocytes in the mammary glands of sows and the jejunum of piglets.