The STARTER checklist for antimalarial therapeutic efficacy reporting was used in this report [34].
Study site, study design and patients.
This observational study was conducted at Tanjung Leidong Health Centre in Kualuh Leidong District, North Labuhan Batu Regency, from July to December 2018. The district is a coastal area of 394 sq km with a population of more than 29,552. Plasmodium vivax is the predominant species in this location. Twenty Anopheles species are known malaria vectors across the Indonesia archipelago despite not being uniformly distributed from the west to the east of the country [35]. Six species responsible for malaria transmission of P. falciparum and P. vivax were described in Sumatera: An. kochi, An. maculatus, An. sinensis, An. sundaicus and An. tessellatus with local heterogeneity amongst the island [35].
Tanjung Leidong Health Centre offers malaria diagnosis using microscopy and treatment according to National recommendations (Dihydroartemisinin-piperaquine plus primaquine) which were provided for free for the local population.
Inclusion criteria were the attendance to health center for all patients over 15 years of age, axillary temperature above 37.5°C or history of fever within the preceding 48 hours, ability to swallow oral medication, ability and willingness to comply with the study and provide informed consent, absence of anti-malarial medication within the four weeks prior to the study, and mono-infection with P. vivax as detected by microscopy. Patients who disagreed to participate or were unable to take part in this study fully, or were infected with a non-vivax Plasmodium (given that P. knowlesi was not possible to detect using microscopy), were excluded.
Drugs.
The Ministry of Health provided antimalarial treatments. Dihydroartemisinin–piperaquine (KBN-Zheijang Pharmaceutical Co., Ltd, under license of Beijing Holley-Cotec Pharmaceutical Co., Ltd) containing 40 mg dihydroartemisinin and 320 mg piperaquine was administered once daily for three days following the Indonesian National guidelines [36]. DHA-PPQ was taken in front of the healthcare staff for three consecutive days. In addition, patients with P. vivax malaria were prescribed primaquine (local product by PT Pharos Indonesia, 15 mg base PQ tablets) on day 3 for 14 days (0.25 mg/kg/day). The systematic detection of G6PD deficiency was not available in Indonesia. All patients were followed up to day 28.
Microscopy for malaria diagnosis
Blood samples were collected during the DHA-PPQ treatment immediately before drug administration and at 24 and 48 (± 3) hours post-administration to estimate the proportion of patients with residual parasitemia. Blood samples were collected during the follow-up on days 7, 21 and 28 to detect delayed parasite clearance or recrudescence. Thick and thin blood smears were prepared on the same slide and were stained with a 3% Giemsa solution for 45 min. A field microscopist examined all slides included in this study. For positive smears, the numbers of parasites were counted in thick smears against 200 white blood cells (WBCs) or 500 WBCs in cases of low-density infections. Parasite density was calculated assuming 8000 WBCs per µl. The thin smears for the positive samples were further examined for species identification. All positive samples were sent to Eijkman Institute, Jakarta, for quality control.
Outcome measures.
The primary outcome of this study was the clinical and parasitological efficacy of the DHA-PPQ plus primaquine therapy during a follow-up period of 28 days. Although a longer follow-up would have been preferable, it was not feasible due to the operational constraints of routine monitoring in that setting.
In addition, the parasite clearance time, the proportion of patients presenting a delayed (> 48h) parasite clearance, and the prevalence of pvmdr1, pvk12 and pvpm4 molecular makers of chloroquine and DHA-PPQ resistance, were reported as secondary outcomes.
The parasite clearance time was defined as the time from the start of treatment to the first two consecutive negative parasitemia determined by routine microscopy. The parasite clearance half-life (PC1/2) according to the Worldwide Antimalarial Resistance Network (WWARN) Parasite Clearance Estimator (PCE) was not used because the 6-hourly blood sampling required was not available during this study.
Molecular analysis
DNA was extracted from blood-spot samples on filter paper using the spin-column method of the QIAamp DNA Mini Kit (Qiagen, Germany) and eluted in a total volume of 150 µl for each sample. The identification of species was confirmed by real-time PCR using species-specific primers [37]. All amplification reactions were carried out in a total volume of 20 µl and the presence of 250 nM of each oligonucleotide primers and 2.0 µl of Light Cycler Fast Start DNA Master SYBR Green 1 reaction mix. Primary amplification reactions were initiated with 5.0 µl of the template genomic DNA, and 1.0 µl of the product of these reactions was used to initiate the secondary amplification reactions.
PCR amplification of pvmdr1, pvk12, and pvpm4 genes
PCR reactions were performed in 30 µl containing one µmol/L of each primer, Mix Hotstart 5X (Solis Biodyne), 12.5 mmol/L MgCl2, 10X GC Enhancer (Solis Biodyne), and 2µL of genomic DNA. Before sequencing, all PCR products were purified using ExoSap-it (Thermo-Fisher). Sequencing was carried out by Biofidal-MicroSynth (Lyon, France) using BigDye V3.1 Terminator Cycle Sequencing kit (Thermofischer), purification by BigDye-X- Terminator, on ABI-3730XL sequencer. Consensus sequences were obtained using Chromas Pro (Technelysium Pty). Primers sequences and PCR program are presented in Table 1.
Table 1: Primers used for the amplification of pvmdr1, pvk12, and pvpm4
Genes
|
Primers
|
Sequences 5’ – 3’
|
PCR cycling
|
pvmdr1
pvk12
pvpm4
|
pvmdr1-Fidt
pvmdr1-Ridt
pvmdr1-F1
pvmdr1-R1
pvk12_F1-F
pvk12-c2216R
pvk12_F1-idt
pvk12_R1-idt
pvk12_F2-idt
pvk12_R2-idt
pvk12_F3-idt
pvk12_R3-idt
pvpm4_F1_F
pvpm4_F2_R
pvpm4_F1_R
pvpm4_F2_F
|
CTGGAGGCGAACTCGAATAAG
CCCTTCCTTGGAGGAACTAAAC
ATAGTCATGCCCCAGGATTG
ACGTTTGGTCTGGACAAGTAT
CCATACGTAAACGCTGCAAAT
ACAGCAACAGCGACGATAA
ACAGCAACAGCGACGATAA
GTGTTAGGGTGTGCCTAGAAG
CGAATATCGCAACGGAGACTAT
CTACCCAAGCCTTCATCCTATG
TCCATGGAGCTGTTAGACATTAG
CTCATTCGTGTCTGGAGAGAAA
TCAAAAGGAGTACGAAGCATACAA
TGTTCTAATTACAGCACCAACACA
ATGGGTTCTAAATCATCAGTGTCA
GATGCAGCATTAAAAATCTGTACG
|
96°C 12 min (96°C 20 sec, 54°C 20 sec, 72 °C 2 min) 35 cycles, 72° 10 min
96°C 12 min (96°C 20 sec, 54°C 20 sec, 72 °C 2 min) 35 cycles, 72° 10 min
96°C 12 min (96°C 20 sec, 52°C 20 sec, 72 °C 2min) 35 cycles, 72° 10 min
96°C 12 min (96°C 20 sec, 52°C 20 sec, 72 °C 2min) 35 cycles, 72° 10 min
96°C 12 min (96°C 20 sec, 52°C 20 sec, 72 °C 2min) 35 cycles, 72° 10 min
96°C 12 min (96°C 20 sec, 52°C 20 sec, 72 °C 2min) 35 cycles, 72° 10 min
95 °C 10 min (95 °C 30s, 62 °C 30s, 72 °C 150s) 40 cycles
95 °C 10 min (95 °C 30s, 62 °C 30s, 72 °C 150s) 30 cycles
|
pvmdr1: P. vivax multidrug-resistant-1; pvk12 : P. vivax kelch12 propeller domain, pvpm4: P. vivax plasmepsine 4.
Ethical clearance
Explanations regarding the study were given to the participants before the samples were collected. The Ethical Committee of the Medical Faculty Universitas Sumatera Utara/Adam Malik General Hospital (No. 588/TGL/KEPK FK USU-RSUP HAM /2018) approved the study. Written informed consent was obtained from each study participant, or from the parents or guardians of the children included. Material Transfer Agreement between Universitas Sumatera Utara and Lyon University was provided before the samples shipment. The samples shipment was made per the Nagoya Protocol on Access to Genetic Resources and the Fair and Equitable Sharing of Benefits Arising from their Utilization [38].
Statistical analysis
Based on an estimated therapeutic efficacy of DHA-PPQ plus primaquine of 95%, a risk of 5% decreased efficacy, the sample size calculation with a power of 90% and a precision of 5% was 100 P. vivax malaria patients. The cumulative percentage at fixed time points of positive parasite count using microscopy at days 0, 1, 2, 7, 14, and 21, were calculated using the Kaplan-Meier estimator. The early and late parasite clearance curves were compared using the log Rank test (Mantel-Cox). IBM SPSS Statistics for Windows, version 21.0, was used.