A Novel 4.25kb Deletion in PAX6 in A Chinese Han Family with Congenital Aniridia Combined with Cataract and Nystagmus

Abstract

Background: The aim of this study is to identify the genetic defect in a Chinese family with congenital aniridia combined with cataract and nystagmus.

Methods: Complete ophthalmic examinations, including slit-lamp biomicroscopy, dilated

indirect ophthalmoscopy, anterior segment photography, and anterior segment optical coherence tomography (OCT) were performed. Blood samples were collected from all family members and genomic DNA was extracted. Genome sequencing was performed in all family members and Sanger sequencing was used to verify variant breakpoints.

Results: All the thirteen members in this Chinese family, including seven patients and six normal people, were recruited in this study. The ophthalmic examination of affected patients in this family was consistent with congenital aniridia combined with cataract and nystagmus. A novel heterozygous deletion (NC_000011.10:g.31802307_31806556del) containing the 5’ region of PAX6 gene was detected that segregated with the disease.

Conclusion: We detected a novel deletion in PAX6 responsible for congenital aniridia in the affected individuals of this Chinese family. The novel 4.25kb deletion in PAX6 gene of our study would further broaden the genetic defects of PAX6 associated with congenital aniridia.

Background

Aniridia (Online Mendelian Inheritance in Man identifier, OMIM, 106210) is a rare, congenital ocular disorder with the characteristics of partial or complete absence of the iris. Aniridia occurs in approximately 1/64,000 to 1/96,000 live births and is primarily characterized by iris hypoplasia [1, 2]. Two-thirds of aniridia cases have an obvious hereditary history with autosomal dominant inheritance, complete penetrance and variable expressivity, while the remaining cases refer to sporadic cases [3–5]. Aniridia can occur isolated, as part of WAGR (Wilms tumor, aniridia, genitourinary disorders, and retardation) syndrome, WAGRO syndrome (WAGR and obesity), or other associated syndromes [6, 7]. In addition to the variable iris hypoplasia, congenital aniridia is usually accompanied with lens opacity or dislocation, nystagmus, glaucoma, aniridia-related keratopathy.

Paired box gene-6 (PAX6, OMIM: 607108), a member of the paired box gene family located on chromosome 11p13, was identified as a candidate gene for aniridia, spanning about 22 kb and containing 14 exons that encode 436 amino acids as transcriptional regulators [8–10]. This gene plays an essential role in eye development, as well as brain, spinal cord and pancreas [11]. Most congenital aniridia cases are caused by variants in PAX6 [12–14]. Prior to the current study, according to the Human PAX6 Allelic Variant Database (LOVD PAX6 database, version 180804) (http://lsdb.hgu.mrc.ac.uk/home.php?select_db=PAX6), 491 unique variants of PAX6 have been identified. Most of these variants are frameshift variants, splice site variants, or nonsense variants, which have been considered to produce truncated proteins or result in loss-of-function due to nonsense mediated decay, while other variants were missense [15, 16].

In this study, we performed genome sequencing to identify the molecular cause of congenital aniridia in a Han Chinese family to further investigate the genetic and phenotypic spectrum of congenital aniridias.

Methods

Subject recruitment and clinical examination

A four-generation family with aniridia was recruited in the Shanghai General Hospital in Shanghai, China. Thirteen family members of this family (Figure 1) took part in this study. This study was conducted in accordance with the Declaration of Helsinki and was approved by the ethics committee of Shanghai General Hospital. Informed consent was obtained from each participant. Seven of the 13 family members were diagnosed with congenital aniridia. No consanguinity was present in the family. Each family member received complete and comprehensive clinical and ophthalmic examination, including visual acuity test, intraocular pressure (IOP) measurement, anterior segment examination, slit lamp examination, fundus exam and orthoptic evaluation, as well as the examination of physical malformations and neurological deficits. In addition, 200 ethnically matched healthy individuals with no direct or collateral ties and no related phenotypes and systemic underlying diseases were recruited.

DNA Preparation

Genomic DNA was extracted from peripheral blood using the TruSeq DNA LT Sample Prep kit (Illumina, San Diego, CA) according to the manufacturer’s protocol. DNA samples were stored at −20°C until used, and DNA integrity was evaluated by 1% agarose gel electrophoresis.

Whole-genome sequencing

Whole-genome sequencing (WGS) was performed in all 13 family members. The libraries were constructed with TruSeq Nano DNA LT Sample Prepararion Kit (Illumina, San Diego, CA, USA). Briefly, the genomic DNA was sheared into fragments with length ~350 bp using S220 Focused-ultrasonicators (Covaris, USA). Adapters were ligated onto the 3’ end of the sheared fragments. After polymerase chain reaction (PCR) amplification and purification, the final libraries were sequenced on the Illumina sequencing platform HiSeq X Ten platform (Illumina Inc., San Diego, CA, USA) and 150 bp paired-end reads were generated. The average sequencing depth was at least 30×.

Routine whole-genome sequencing analysis

The raw reads were subjected to a quality check and then filtered by fastp (https://github.com/OpenGene/fastp). Reads were aligned to hg38 using SpeedSeq [17]. Single nucleotide variants and insertions/deletions (indels) calling were performed using Genome Analysis Toolkit v2.1 [18]. Structural variants and copy number variants were analyzed in SpeedSeq [17]. Annotations of single nucleotide variants, indels, structural variants and copy number variants were performed with ANNOVAR [19]. Variant filtering was performed as illustrated in Supplementary 1.

Variant validation

In order to identify the exact breakpoints of the deletion in PAX6 gene after WGS analysis, primers were designed in the region surrounding the deletion using Primer3 software (version 4.0, http://bioinfo.ut.ee/primer3-0.4.0/). PCR primer pairs and amplification conditions are available upon request. PCR products were checked by 1% agarose gel electrophoresis and purified with SAP-Exon I kit (USB, USA). Purified PCR products were directly sequenced in both forward and reverse directions using an ABI 3730xl genetic analyzer (Applied Biosystems, Foster City, CA, USA) per manufacturer’s instructions. DNA sequences were analyzed using Chromas (version 2.22) and DNAMAN (version 7) software. The primer sequences were 5’-TAAATTTATTTTTGTGCTGACCTTG-3’ (forward) and 5’- ATTTCAGGCAAGTTCTGTGGTG -3 (reverse) for the PAX6 gene.

Results

Discussion

Congenital aniridia, with or without cataract and nystagmus, is a kind of clinically ocular malformation inherited in an autosomal dominant mode of inheritance with variable expression. PAX6, which is located on chromosome 11p13, plays an important role in eye development process by regulating the tissue specific expression of various molecules, structural proteins and related hormones [16]. Most of aniridia cases occur due to a genetic defect of PAX6 no matter what in sporadic and familial forms. A lot of studies [22, 26–30] have reported that variants in the PAX6 gene can lead to the clinical symptom of aniridia. Furthermore, FOXC1 and PITX2 variants were also associated with aniridia [15]. The present study identified a novel deletion variant in PAX6 gene in this Chinese Han family. This finding expands the spectrum of the PAX6 variants resulting in congenital aniridia.

According to the Leiden Open Variation Database (LOVD, https://www.lovd.nl/) PAX6 gene database, nearly 90% of disease-causing variants lead to the aniridia phenotype, while the remaining 10% causes follicular dysplasia, Peters Syndrome and small eyeballs [31]. Among these aniridia patients, the clinical manifestations are diverse and aniridia can accompanied with other ocular abnormalities. In this family, corneal leukoplakia or nebula could be found in eight eyes of all fourteen affected eyes (57.1%). The condition of the cornea of patients with aniridia also needs regular examination. Corneal opacification and pannus began peripherally and spreads centrally early in life, which could lead to total opacification of the cornea called aniridia-associated keratopathy (AAK) [32, 33]. Abnormalities of the lens were found in all fourteen affected eyes (100%), manifested cataract and dislocation in this family. Reports of the incidence of glaucoma in cases of aniridia is widely variable, from 6–75% [34, 35], and 28.6% in our study. In the early stage, the angle appears open in most cases of aniridia and glaucoma is not present. However, tissue strands containing blood vessels form connections between the iris stroma and the angle wall as time goes on. Once this abnormal iris tissue migrates forward, it might obscure the posterior trabecular meshwork and scleral spur, obstructing the angle and blocking aqueous outflow [36].

The PAX6 gene spans for approximately 23 kb on chromosome 11p13, contains 14 exons, and encodes a protein of 422 amino acids, which binds DNA and functions as a regulator of transcription [37]. PAX6 is regulated by multiple enhancers located up to hundreds of kilobases from this locus. Variants in this gene or in the enhancer regions can cause ocular phenotypes and the activity of this protein is essential for the development of neural tissues, particularly the eye [8, 29]. The 4.25kb deletion could lead to expression of a protein missing a C-terminus or lack of expression due to nonsense medicated decay. Some deletions located downstream of PAX6 without affecting the coding region are also known to cause aniridia [29, 38], likely affecting downstream regulatory regions.

Conclusion

In conclusion, a novel 4.25kb deletion in the PAX6 gene was found in this Han Chinese family with congenital aniridia combined with cataract and nystagmus. This result expands the mutation spectrum and provides new genetic defects of PAX6 gene. With the development of genetic analysis, more detailed attention should be required in the clinical consequence of diverse PAX6 variants.

List Of Abbreviations

Declarations

Ethics approval and consent to participate

This study was conducted in accordance with the Declaration of Helsinki and was approved by the ethics committee of Shanghai General Hospital. A written informed consent was obtained from each participant.

Consent for publication

A written informed consent was obtained from each participant for the publication of this research and any accompanying images.

Availability of data and materials

The datasets generated during the current study are available in the National Genomics Data Center (NGDC) repository, the accession number is HRA000707 and the persistent web link is https://bigd.big.ac.cn/gsa-human/s/dGFiEmrB.

Competing interests

The authors declare that they have no competing interests.

Funding

Supported by the National Natural Science Foundation of China (No.81800878, No.81800835), and the Key Technological Research Projects of Songjiang District (No.18sjkjgg24).

Authors’ Contributions

X.X. and I.S had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Conception and design: T.Q and C. C. Data collection: T.Q, C.C, C.L, Q.G and K.L. Analysis and interpretation: T.Q, C.C, C.L, G.W, I.S and X.X. Drafting the manuscript: T.Q, C.C and I.S. Critical revision of the manuscript: T.Q, C.L, I.S and X.X. Supervision: X.X and I.S.

Acknowledgments

We thank the all family members for their participation. All authors attest that they meet the current ICMJE criteria for authorship.

References

1. Nelson LB, Spaeth GL, Nowinski TS, Margo CE, Jackson L: Aniridia. A review. Survey of ophthalmology 1984, 28(6):621-642.
2. Pozdeyeva NA, Pashtayev NP, Lukin VP, Batkov YN: Artificial iris-lens diaphragm in reconstructive surgery for aniridia and aphakia. Journal of cataract and refractive surgery 2005, 31(9):1750-1759.
3. Jordan T, Hanson I, Zaletayev D, Hodgson S, Prosser J, Seawright A, Hastie N, van Heyningen V: The human PAX6 gene is mutated in two patients with aniridia. Nature genetics 1992, 1(5):328-332.
4. Torkashvand A, Mohebbi M, Hashemi H: A novel PAX6 nonsense mutation identified in an Iranian family with various eye anomalies. Journal of current ophthalmology 2018, 30(3):234-238.
5. Yahalom C, Sharon D, Dalia E, Simhon SB, Shemesh E, Blumenfeld A: Combined Occurrence of Autosomal Dominant Aniridia and Autosomal Recessive Albinism in Several Members of a Family. Ophthalmic genetics 2015, 36(2):175-179.
6. Jung R, Rauch A, Salomons GS, Verhoeven NM, Jakobs C, Michael Gibson K, Lachmann E, Sass JO, Trautmann U, Zweier C et al: Clinical, cytogenetic and molecular characterization of a patient with combined succinic semialdehyde dehydrogenase deficiency and incomplete WAGR syndrome with obesity. Molecular genetics and metabolism 2006, 88(3):256-260.
7. Lim HT, Kim DH, Kim H: PAX6 aniridia syndrome: clinics, genetics, and therapeutics. Current opinion in ophthalmology 2017, 28(5):436-447.
8. Glaser T, Walton DS, Maas RL: Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nature genetics 1992, 2(3):232-239.
9. Hanson IM, Seawright A, Hardman K, Hodgson S, Zaletayev D, Fekete G, van Heyningen V: PAX6 mutations in aniridia. Human molecular genetics 1993, 2(7):915-920.
10. Hingorani M, Hanson I, van Heyningen V: Aniridia. European journal of human genetics : EJHG 2012, 20(10):1011-1017.
11. Kim J, Lauderdale JD: Analysis of Pax6 expression using a BAC transgene reveals the presence of a paired-less isoform of Pax6 in the eye and olfactory bulb. Developmental biology 2006, 292(2):486-505.
12. Grønskov K, Olsen JH, Sand A, Pedersen W, Carlsen N, Bak Jylling AM, Lyngbye T, Brøndum-Nielsen K, Rosenberg T: Population-based risk estimates of Wilms tumor in sporadic aniridia. A comprehensive mutation screening procedure of PAX6 identifies 80% of mutations in aniridia. Human genetics 2001, 109(1):11-18.
13. Hu P, Meng L, Ma D, Qiao F, Wang Y, Zhou J, Yi L, Xu Z: A novel 11p13 microdeletion encompassing PAX6 in a Chinese Han family with aniridia, ptosis and mental retardation. Molecular cytogenetics 2015, 8(1):3.
14. Robinson DO, Howarth RJ, Williamson KA, van Heyningen V, Beal SJ, Crolla JA: Genetic analysis of chromosome 11p13 and the PAX6 gene in a series of 125 cases referred with aniridia. American journal of medical genetics Part A 2008, 146a(5):558-569.
15. Fantes J, Redeker B, Breen M, Boyle S, Brown J, Fletcher J, Jones S, Bickmore W, Fukushima Y, Mannens M et al: Aniridia-associated cytogenetic rearrangements suggest that a position effect may cause the mutant phenotype. Human molecular genetics 1995, 4(3):415-422.
16. Kokotas H, Petersen MB: Clinical and molecular aspects of aniridia. Clinical genetics 2010, 77(5):409-420.
17. Chiang C, Layer RM, Faust GG, Lindberg MR, Rose DB, Garrison EP, Marth GT, Quinlan AR, Hall IM: SpeedSeq: ultra-fast personal genome analysis and interpretation. Nature methods 2015, 12(10):966-968.
18. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M et al: The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome research 2010, 20(9):1297-1303.
19. Wang K, Li M, Hakonarson H: ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic acids research 2010, 38(16):e164.
20. MacDonald JR, Ziman R, Yuen RK, Feuk L, Scherer SW: The Database of Genomic Variants: a curated collection of structural variation in the human genome. Nucleic acids research 2014, 42(Database issue):D986-992.
21. Ma AS, Grigg JR, Ho G, Prokudin I, Farnsworth E, Holman K, Cheng A, Billson FA, Martin F, Fraser C et al: Sporadic and Familial Congenital Cataracts: Mutational Spectrum and New Diagnoses Using Next-Generation Sequencing. Human mutation 2016, 37(4):371-384.
22. Park SH, Kim MS, Chae H, Kim Y, Kim M: Molecular analysis of the PAX6 gene for congenital aniridia in the Korean population: identification of four novel mutations. Molecular vision 2012, 18:488-494.
23. Peter NM, Leyland M, Mudhar HS, Lowndes J, Owen KR, Stewart H: PAX6 mutation in association with ptosis, cataract, iris hypoplasia, corneal opacification and diabetes: a new variant of familial aniridia? Clinical & experimental ophthalmology 2013, 41(9):835-841.
24. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E et al: Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genetics in medicine : official journal of the American College of Medical Genetics 2015, 17(5):405-424.
25. Riggs ER, Andersen EF, Cherry AM, Kantarci S, Kearney H, Patel A, Raca G, Ritter DI, South ST, Thorland EC et al: Technical standards for the interpretation and reporting of constitutional copy-number variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics (ACMG) and the Clinical Genome Resource (ClinGen). Genetics in medicine : official journal of the American College of Medical Genetics 2020, 22(2):245-257.
26. Cai F, Zhu J, Chen W, Ke T, Wang F, Tu X, Zhang Y, Jin R, Wu X: A novel PAX6 mutation in a large Chinese family with aniridia and congenital cataract. Molecular vision 2010, 16:1141-1145.
27. Chen P, Zang X, Sun D, Wang Y, Wang Y, Zhao X, Zhang M, Xie L: Mutation analysis of paired box 6 gene in inherited aniridia in northern China. Molecular vision 2013, 19:1169-1177.
28. Lee PC, Lam HH, Ghani SA, Subrayan V, Chua KH: Investigation of a PAX6 gene mutation in a Malaysian family with congenital aniridia. Genetics and molecular research : GMR 2014, 13(2):3553-3559.
29. Liu X, Wu Y, Miao Z, Zhang H, Gong B, Zhu X, Huang L, Shi Y, Hao F, Ma S et al: A novel deletion downstream of the PAX6 gene identified in a Chinese family with congenital aniridia. Ophthalmic genetics 2018, 39(4):428-436.
30. Wawrocka A, Sikora A, Kuszel L, Krawczynski MR: 11p13 deletions can be more frequent than the PAX6 gene point mutations in Polish patients with aniridia. Journal of applied genetics 2013, 54(3):345-351.
31. Lee HJ, Colby KA: A review of the clinical and genetic aspects of aniridia. Seminars in ophthalmology 2013, 28(5-6):306-312.
32. Lagali N, Wowra B, Fries FN, Latta L, Moslemani K, Utheim TP, Wylegala E, Seitz B, Käsmann-Kellner B: PAX6 Mutational Status Determines Aniridia-Associated Keratopathy Phenotype. Ophthalmology 2020, 127(2):273-275.
33. Mayer KL, Nordlund ML, Schwartz GS, Holland EJ: Keratopathy in congenital aniridia. The ocular surface 2003, 1(2):74-79.
34. Ivanov I, Shuper A, Shohat M, Snir M, Weitz R: Aniridia: recent achievements in paediatric practice. European journal of pediatrics 1995, 154(10):795-800.
35. Swanner JC, Walton DS, Chen TC: Prevention of aniridic glaucoma with goniosurgery. International ophthalmology clinics 2004, 44(1):67-71.
36. Grant WM, Walton DS: Progressive changes in the angle in congenital aniridia, with development of glaucoma. Transactions of the American Ophthalmological Society 1974, 72:207-228.
37. Yokoi T, Nishina S, Fukami M, Ogata T, Hosono K, Hotta Y, Azuma N: Genotype-phenotype correlation of PAX6 gene mutations in aniridia. Human genome variation 2016, 3:15052.
38. Simioni M, Vieira TP, Sgardioli IC, Freitas EL, Rosenberg C, Maurer-Morelli CV, Lopes-Cendes I, Fett-Conte AC, Gil-da-Silva-Lopes VL: Insertional translocation of 15q25-q26 into 11p13 and duplication at 8p23.1 characterized by high resolution arrays in a boy with congenital malformations and aniridia. American journal of medical genetics Part A 2012, 158a(11):2905-2910.