CSF3 contributes to the invasive and metastatic phenotypes and associates with poor prognosis in patients with colorectal cancer via NF-κB signaling pathway

doi:10.21203/rs.3.rs-2715939/v1

Download PDF

Research Article

CSF3 contributes to the invasive and metastatic phenotypes and associates with poor prognosis in patients with colorectal cancer via NF-κB signaling pathway

https://doi.org/10.21203/rs.3.rs-2715939/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Colony-stimulating factor 3 (CSF3) is a cytokine associated with inflammation, which mainly stimulates myeloid stem cell maturation, proliferation, and migration into circulation. However, the significance of CSF3 in colorectal cancer (CRC) remains unclear. Here, we aimed to examine the expression and impacts of CSF3 in CRC.

Methods

CSF3 expression was examined in CRC tissues and cells by IHC staining and western blot. RNA interference was used to silence CSF3 in CRC cells. The effects of CSF3 on biological behaviors such as proliferation and migration of CRC cells were examined in vitro and in vivo.

Results

CSF3 was highly expressed in CRC tissues and cells. CSF3 high level was correlated to patients’ age, with a feature of a higher pathological stage, more distant lymphatic metastasis and more severe lymph node invasion. Knocking down CSF3 led to decreased proliferation and migration, increased apoptosis, arrested cell cycle in vitro as well as impaired tumor growth in vivo. Mechanistically, CSF3 regulates CRC cell proliferation and apoptosis dependent on enhances p65 phosphorylation to facilitate NF-κB-mediated transcriptional activity.

Conclusion

Our study demonstrated that CSF3 interacts with the NF-κB signaling pathway to promote the progression of CRC. CSF3 might be a potential therapeutic target for CRC patients.

Colorectal cancer

CSF3

proliferation

migration

NF-κB signaling

Ranking third in all cancers diagnosed, colorectal cancer (CRC) is the third leading cause of cancer death according to cancer statistics, 2022 [1]. The CRC mortality decreased during the most recent decade (2010–2019) by about 2% per year [1, 2]. The risk of obesity, physical inactivity, and smoking is heightened by a combination of population aging, dietary habits, and adverse risk factors [3]. Of concern is that chronic inflammation is also a major risk factor linked to the development of CRC [4]. Current treatments include endoscopic and surgical local excision, downstaging preoperative radiotherapy and systemic therapy, extensive surgery for locoregional and metastatic disease, local ablative therapies for metastases, and palliative chemotherapy, targeted therapy, and immunotherapy [3]. Although these treatment options have prolonged patients’ overall survival to some extent, for those with more advanced diseases, the outcomes were less than satisfactory. A greater understanding of the pathogenesis of CRC is likely to lead to improved therapeutics.

Granulocyte colony-stimulating factor (G-CSF), now referred to as colony-stimulating factor 3 (CSF3), is an 18–70 kDa glycoprotein, which was first discovered by Metcalf et al. in 1966 [5]. CSF3 is a proinflammatory cytokine with the well-studied function of inducing differentiation and mobilization of neutrophils. CSF3 is a known cell growth factor and binds to CSF3 R, thereby activating a complex signal transduction system and guiding a variety of biological functions, such as regulating proliferation, survival, and differentiation of neutrophilic progenitor cells, stimulating the secretion of vascular endothelial growth factor to enhance angiogenesis, as well as inducing immune tolerance of T cells in stem cell grafts [6]. However, some tumors also express CSF3 and CSF3 receptor (CSF3 R) [7–9]. However, the significance of CSF3 in CRC remains unclear.

Here, we reported that CSF3 was highly expressed in colorectal tumors. The downregulation of CSF3 suppressed colorectal cancer cell phenotypes in vitro and in vivo. CSF3 regulates NF-kappa B (NF-κB) signaling pathway via promoting p65 phosphorylation, thereby effectively enhancing CRC development. Our findings suggested that CSF3 has a tumor-promoting capacity in CRC, thus warranting more consideration for its potential as a therapeutic target.

2.1 Cell lines and animals

From American type culture collection (ATCC) (https://www.atcc.org/), we acquired human normal colorectal mucosal cell FHC, CRC cells SW480, RKO and HCT 116, as well as human colorectal adenocarcinoma epithelial cell DLD-1. Culturing FHC, RKO, HCT 116 and DLD-1 in 1640 + 10% FBS, and SW480 in L-15 + 10% FBS, the cells were then incubated in a 37℃ incubator with 5% CO₂.

The four-week-old female BALB-c nude mice were provided by Cavens Biogle Model Animal Research Co., Ltd (www.cavens-biogle.cn). A cage containing five mice, with a temperature of 22–25˚C and humidity between 50–60%, was kept with a 12-h light/dark cycle. Water and food were provided in adequate amounts.

Both AAALAC (Association for Assessment and Accreditation of Laboratory Animal Care International) and the IACUC (Institutional Animal Care and Use Committee) of Chinese PLA General Hospital have given their approval to the laboratory animal facility and all animal protocols used in this study. The ethics committee of Chinese PLA General Hospital gave their approval to this research.

2.2 Collection of tissue samples

From the Seventh Medical Center of Chinese PLA General Hospital in Beijing, China, 91 CRC patients were employed to conduct a CRC tissue microarray (TMA). All the patients who provided the tissues signed informed consent. None of the patients had undergone preoperative intervention therapy or chemotherapy. Clinical data of a meticulous nature, including age, gender, tumor size, clinical grade, histological type, differentiation degree, and lymph node metastasis, was included and statistically analyzed. Using the American Joint Committee on Cancer (AJCC) staging system, surgically resected specimens were used to ascertain the stages of invasive adenocarcinoma.

2.3 Bioinformatics analysis

In this study, CSF3 mRNA levels in CRC and normal tissues were investigated based on TCGA data through GEPIA 2 website (http://gepia2.cancer-pku.cn/#analysis). The co-expressed genes of CSF3 were investigated by the co-Expedia website (https://www.coexpedia.org/search.php). The expression patterns of CSF3’s co-expressed genes were evaluated in CRC and normal samples from TCGA database. Analysis of all DEGs obtained was conducted using the Kyoto Encyclopedia of Genes and Genomes (KEGG), utilizing the R. package cluster Profiler v3.16.0.

2.4 Immunohistochemical staining (IHC)

IHC staining was used to quantify the expression of antibodies in the lesion sites. The slides were deparaffinized with xylene 3 times. Then, the slides were subjected to antigen repair using EDTA solution and block using 3% H₂O₂. After that, primary and secondary antibodies were added, subsequent DAB and Hematoxylin were applied to visualize the expression patterns of antibodies in the healthy and lesion sites. IHC experimental scores were classified into negative (0), positive (1–4), ++ positive (5–8), or +++ positive (9–12), and high/low levels were ascertained by the median of these scores. The details of anti-bodies were listed as follows: CSF3 (1:500, abcam, #ab204989), Ki67 (1:100, abcam, #ab16667), Goat Anti-Rabbit IgG H&L (HRP) (1:400, abcam, #ab97080).

2.5 Plasmid construction and lentivirus infection

This manuscript used the RNA interference method to knock down CSF3. The RNA interference target sequence of CSF3 (GTGCTTAGAGCAAGTGAGGAA) was designed and the corresponding shRNA lentiviral vector was constructed. 1.5×10⁵ HCT 116 and RKO cells in the logarithmic growth phase were infected at the lentivirus titer of 3×10⁸ TU/mL under ENI.S + Polybrene, then were maintained in 1640 + 10% FBS medium. The infection efficiencies were evaluated by microscopic fluorescence.

2.6 RNA extraction and Real-time quantitative PCR (qRT-

PCR)

The total RNA of cells was extracted according to the manufacturer’s instruction of TRIzol reagent (Sigma, St. Louis, MO, USA), which was subsequently reverse-transcribed to synthesize cDNA. 10 µL qRT-PCR system was conducted with SYBR Green Mastermixs Kit (Vazyme, Nan-jing, Jiangsu, China). The relative expression of mRNA was calculated based on 2-△△Ct method. The primer sequences (5′-3′) included CSF3-forward: CAGAGCCCCATGAAGCTGAT; CSF3-reverse: GCCCTG-GATCTTCCTCACTTG; GAPDH-forward: TGACTTCAACAGCGACACCCA; GAPDH-reverse: CACCCTGTTGCTGTAGCCAAA.

2.7 Western blot assay

Lysis Buffer lysis (Cell Signal Technology, Danvers, MA) was employed to lysate the cells, and 10% SDS-PAGE was then used to segregate the total proteins. The proteins were then transferred onto PVDF membranes, which were blocked with TBST solution of 5% skim milk at room temperature for 1h before being incubated with primary and secondary antibodies. TBST was then applied to the membranes thrice, each time for 10 min. Finally, the ECL + plusTM Western blot system kit was used for color rendering, and X-ray imaging was captured. The de-tails of antibodies were listed as follows: CSF3 (1:500, abcam, #ab181053), p65 (1:2000, Proteintech, #10745-1-AP), p-p65 (1:1000, CST, #3033), GAPDH (1:30000, Proteintech, 60004-1-lg), Goat Anti-Rabbit (1:3000, Beyotime, # A0208), Goat Anti-Mouse (1:3000, Beyotime, A0216).

2.8 Proliferation

After infection, the cells were inoculated in a 96-well plate at the density of 2000 cells/well. The number of cell was counted for continuous 5 days using Celigo. Finally, the data were statistically analyzed to plot the cell proliferation curve.

2.9 Migration

Assays of wound healing and transwell were conducted to evaluate cell migration. Following infection, the cells were cultured in a 96-well plate (7×10⁴ cells/well). Subsequently, the cells were incubated in an incubator with 5% CO₂ at 37°C. A microscope was used to graph the images at the designated time, and the rate of cell migration was determined by the scratch images.

After infection, cells were prepared at a density of 4×10⁵ cells/mL and placed in the upper chamber, which was then incubated in a serum-free medium. Subsequently, the upper chamber was transferred to the lower chamber, which was filled with a medium containing 30% FBS, and left to incubate for 72 h for transwell assay. Finally, 400 µL Giemsa was added for cell staining and the cell migration ability was quantified.

2.10 Flow cytometry

Lentivirus-infected cells were cultured in 6-well plates (2 mL/well) for 5 days. At room temperature in the dark, 10µL Annexin V-APC was added to staining for 10-15min. The cell apoptosis level was then measured using FACSCalibur (BD Biosciences, San Jose, CA, USA). As for cell cycle detection, cells were treated as previously described. Then, 1.5 mL PI solution was added, and the cell number in G1, S and G2 phase was counted.

2.11 The construction of tumor xenograft Model

1×10⁷ RK0 cells with shCtrl or shCSF3 were subcutaneously injected into the axilla of the animal's right forelimb, each group containing 5 mice. The tumor volume was calculated at an indicated time according to the following formula: tumor volume = π/6×L×W×W, in which L and W represent tumor length and tumor width, respectively. After 34 days, the mice were sacrificed and the tumors were removed for weighing and photographing and finally frozen in liquid nitrogen and stored at -80°C.

2.12 Statistical analysis

Repeating all experiments three times, GraphPad Prism 8 (San Diego, CA, USA) and SPSS 19.0 (IBM, SPSS, Chicago, IL, USA) were utilized for data processing. Student's t-test and one-way ANOVA were then employed to evaluate the statistical significance. The data were presented as the mean ± SD. The link between CSF3 levels and clinicopathological characteristics of colorectal cancer patients was revealed via Spearman correlation analysis and Mann-Whitney U analysis. Kaplan-Meier ascertained the prognostic importance of CSF3 in CRC. P < 0.05 was considered as statistical significance, and all tests were two-tailed.

3.1 Upregulation of CSF3 predicts poor prognosis in colorectal cancer

We first characterized protein expression levels of CSF3 in CRC through IHC staining on a tissue microarray including 91 cases of tumor tissues and 104 cases of normal tissues. The results indicated that CSF3 expression was significantly increased in tumor samples compared with matched normal tissues from the same individual (Fig. 1A and Table 1). Besides, tumor stage Ⅲ samples were found to harbor obviously higher CSF3 expression than stageⅠ(Table 1). Also, in most cases, patients with elevated CSF3 tended to face poor survival (Fig. 1B).

Table 1

Expression patterns of CSF3 in colorectal cancer tissues and para-carcinoma tissues revealed in immunohistochemistry analysis.
CSF3 expression	Tumor tissue		Para-carcinoma tissue		P value
CSF3 expression	Cases	Percentage	Cases	Percentage	< 0.001
Low	39	42.9%	93	89.4%
High	52	57.1%	11	10.6%

In addition, CSF3 mRNA and protein levels were also abundant in colorectal cancer cells in comparison with normal cell FHC (Fig. 1C and 1D). We next investigated CSF3 mRNA expression based on RNA-seq data from the TCGA dataset. As expected, CSF3 mRNA expression remained elevated in colorectal cancer relative to healthy controls (Fig. 1E). Moreover, we established the relationship between CSF3 expression and patients’ clinicopathological parameters. The Mann-Whitney U analysis revealed that CSF3 high level implied a higher pathological stage, more distant lymphatic metastasis and more severe lymph node invasion (Table 2), which was also evidenced by Spearman rank correlation analysis (Table 3). These data suggested that CSF3 might serve as a tumor promotor in CRC.

Table 2

Relationship between CSF3 expression and tumor characteristics in patients with colorectal cancer.
Features	No. of patients	CSF3 expression		P value
	No. of patients	low	high
	91	39	52
Age (years)				0.014
≤ 60	47	26	21
>60	44	13	31
Gender				0.295
Male	55	26	29
Female	36	13	23
Tumor size				0.713
≤ 4cm	54	24	30
>4cm	37	15	22
Differentiation				0.092
low	8	1	7
medium	81	37	44
high	2	1	1
Tumor stage				0.003
Ⅰ	9	5	4
Ⅱ	35	21	14
Ⅲ	39	12	27
Ⅳ	8	1	7
Tumor infiltrate				0.702
T1	1	1	0
T2	11	5	6
T3	43	18	25
T4	36	15	21
Metastasis				0.071
M0	83	38	45
M1	8	1	7
Lymph node invasion				0.014
No	47	26	21
Yes	44	13	31
Vascular invasion				0.895
No	86	37	49
Yes	5	2	3
Lymphatic metastasis (N)				0.027
0	47	26	21
1	26	7	19
2	18	6	12

Table 3

Relationship between CSF3 expression with patients’ age, pathological stage, lymph node invasion and lymphatic metastasis (N).
		CSF3
Age	Spearman correlation	0.260
	Signification (double-tailed)	0.013
	N	91
Stage	Spearman correlation	0.315
	Signification (double-tailed)	0.002
	N	91
Lymph node invasion	Spearman correlation	0.260
	Signification (double-tailed)	0.013
	N	91
Lymphatic metastasis (N)	Spearman correlation	0.233
	Signification (double-tailed)	0.026
	N	91

3.2 Silencing CSF3 affects colorectal cancer cell events related to tumor development

In this section, we aimed to study the consequences of the loss of CSF3 function in vitro. First, RNA interference method was employed to knock down CSF3 in HCT 116 and RKO cells with high and moderate CSF3. The results of qPCR and western blot assays showed decreased CSF3 at mRNA and protein levels (Fig. 2A and 2B), indicating that CSF3 was smoothly silenced. Subsequently, the celigo cell counting experiment revealed an inhibition of cell proliferation in CSF3-depleted HCT 116 and RKO cells (Fig. 2C). In addition to affecting proliferation, silencing CSF3 also weakened the cells’ abilities to migrate (Fig. 2D and 2E). As we know, cell apoptosis and cell cycle are important events associated with tumor occurrence and development. Thus, after CSF3 knockdown, flow cytometry was performed to visualize the changes in HCT 116 and RKO cell apoptosis and cycle. The data suggested that CSF3 downregulation resulted in a promotion in cell apoptosis (Fig. 2F) and an arrest in G2 phase (Fig. 2G). Taken together, these findings demonstrated that silencing CSF3 could affect CRC cell events related to tumor development.

3.3 Silencing CSF3 affects colorectal cancer tumor outgrowth

Having shown the consequences of loss of CSF3 function in vitro, the in vivo experiments were conducted by establishing a subcutaneous xenograft tumor model. 1×10⁷ RKO cells, in which CSF3 was infected with shCSF3 or shCtrl, were subcutaneously injected into the axilla of the mice's right forelimb. We assessed tumor growth indexes at indicated time and found that the volume of tumor derived from shCSF3-infected cells was decreased (Fig. 3A). After xenografting for 34 days, the mice were sacrificed to harvest tumors. We found that tumor was lighter in shCSF3 group than shCtrl group (Fig. 3B and 3C). From this, we proposed that silencing CSF3 could impair CRC tumor outgrowth in vivo. To further clarify this hypothesis, the western bolt was conducted and revealed that CSF3 protein levels were decreased in tumors derived from shCSF3-infected cells (Fig. 3D). Consistently, IHC staining analysis showed that lower density and intensity of CSF3 and proliferation indicator Ki67 in tumor tissues from shCSF3 cells-generated xenografts (Fig. 3E).

3.4 CSF3 mediates CRC via NF-κB signaling pathway

To uncover the downstream pathway of CSF3 mediating CRC, we used the co-Expedia website (https://www.coexpedia.org/search.php) to determine CSF3 co-expressed genes. The expression patterns of these genes were then verified in CRC. The genes in line with the |log 2 (FC)| ≥ log 2 (1.3) and P < 0.05 were identified as differentially expressed genes (DEGs) in CRC, which were subjected to the KEGG analysis. The results showed that there were 12 genes enriching in NF-κB signaling pathway (Fig. 4A). More importantly, NF-κB pathway has been reported to participate in CRC development [10, 11]. Also, we found that silencing CSF3 decreased the phosphorylation level of p65 (p-p65) but did not change its total protein level (Fig. 4B). More notably, the decline in p-p65 was reversed in CSF3-depleted cells upon NF-κB pathway activator treatment (Fig. 4C). The cell function assays also illustrated that cell viability and motility in CSF3-silenced RKO cells were ameliorated after NF-κB signaling pathway activator addition (Fig. 4D and 4E). Collectively, we concluded that CSF3 mediates CRC via NF-κB signaling pathway.

In the present study, we identified an important role played by CSF3 in modulating colorectal cancer (CRC). CRC patients with high levels of CSF3 were associated with decreased overall survival compared to patients harboring low CSF3-expressing tumors. Silencing CSF3 attenuated colorectal cancer cell proliferation and migration while augmenting apoptosis and arresting cells in G2 phase. Our data were in accordance with previous reports indicating that CSF3 was responsible for human cancer development [12–14]. On the one hand, CSF3 overexpression has carcinogenic effects. For instance, macrophage phenotypes regulated by CSF3 are linked to a decreased overall survival rate in human triple-negative breast cancer [12]. Besides, GCSF is secreted in some aggressive human tumors, and recently, the elevation of GCSF and G-CSFR has been observed in colon and gastric cancer, where CSF3 promotes the proliferation and migration of cancer cells [13, 14]. On the other hand, the drugs targeting CSF3 have been in clinical use for two decades to stimulate neutrophil and macrophage production and function, particularly in cancer patients. In 1991, the US registered G-CSF for the purpose of preventing febrile neutropenia in cancer patients who had undergone chemotherapy [15].

Famously, NF-κB is a ubiquitous transcription factor that mediates a cytoplasmic/nuclear signaling pathway and regulates gene expression of cytokines, cytokine receptors, and adhesion molecules [16, 17]. Furthermore, there is a correlation between the activation of NF-κB and the control of apoptotic pathway, cell proliferation, differentiation, migration, and angiogenesis as well as resistance to chemo/radiotherapies in tumor cells [18]. NF-κB, a factor in tumorigenic processes and cancer survival, is present in a variety of solid tumors, such as breast, ovarian, prostate, gastric carcinoma, and pancreatic cancer [19–23].

Here, we found that the co-expressed genes of CSF3 were associated with the NF-κB signaling pathway. Also, CSF3 downregulation resulted in the disorders of phosphorylation site (p65) of NF-κB. A substantial body of evidence showed that the NF-κB signaling pathway is involved in CRC development and progression [10, 11]. For instance, MyD88 has been evidenced to function as a potential promotor for CRC, which was mediated by NF‑κB signaling pathway [24]. Additionally, B7-H3 was overexpressed in CRC and promotes CRC angiogenesis by means of activating NF-κB pathway [9]. Moreover, SREBP1 promotes the invasion and angiogenesis of CRC, which was accompanied by the phosphorylation of NF-κB-p65 [25]. More studies demonstrated that DHX9 enhances phosphorylation of p65 and promotes nuclear translocation of p65, thereby promoting NF-κb-mediated transcriptional activity and contributing to the malignant phenotypes of CRC [26]. In this paper, we also revealed that CSF3 regulates the NF-κB signaling pathway by affecting p65 phosphorylation, thereby effectively promoting CRC development.

Normally, the CSF3 working model varies in different cancers. In this study, we demonstrate that CSF3 is highly expressed in colorectal cancer and promotes proliferation and migration through the NF-κB pathway. Our findings suggested that CSF3 has a tumor-promoting capacity in CRC, thus warranting more consideration for its potential as a therapeutic target.

Author contributions

JFX, LY and PJ contributed to the study conception and design. HX, RRL and JFX conducted the analyses and wrote the manuscript. XZM, SWD, HZ, CWD and LY helped or performed experiments and analyses. JQS, LY and PJ contributed to revising and proof-reading the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding This research was funded by the Special Project for Military Medical Innovation, grant number 18CXZ027 and the Beijing Municipal Science and Technology Commission, grant number D171100002617001.

Data availability All the datasets generated and analyzed in the present study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate The study was approved by the Ethics Committee of the Chinese PLA General Hospital. Informed consent was obtained from each patient before their inclusion in the study.

Ethics approval of animals All animal procedures were performed according to the protocol approved by the Chinese PLA General Hospital. This study follows the legal requirements or guidelines for the care and use of animals in China and the International Union for Conservation of Nature (IUCN) Policy Statement on Research Involving Species at Risk of Extinction.

Consent for publication All authors consent to publication.

Competing interests The authors declare no conflict of interest.

Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin. 2022;72:7-33. https://doi.org/10.3322/caac.21708.
Baidoun F, Elshiwy K, Elkeraie Y, Merjaneh Z, Khoudari G, Sarmini MT, et al. Colorectal Cancer Epidemiology: Recent Trends and Impact on Outcomes. Curr Drug Targets. 2021;22:998-1009. https://doi.org/10.2174/1389450121999201117115717.
Dekker E, Tanis PJ, Vleugels J, Kasi PM, Wallace MB. Colorectal cancer. Lancet. 2019;394:1467-80. https://doi.org/10.1016/S0140-6736(19)32319-0.
Gillen CD, Walmsley RS, Prior P, Andrews HA, Allan RN. Ulcerative colitis and Crohn's disease: a comparison of the colorectal cancer risk in extensive colitis. Gut. 1994;35:1590-2. https://doi.org/10.1136/gut.35.11.1590.
Metcalf D. The colony-stimulating factors and cancer. Nat Rev Cancer. 2010;10:425-34. https://doi.org/10.1038/nrc2843.
Bendall LJ, Bradstock KF. G-CSF: From granulopoietic stimulant to bone marrow stem cell mobilizing agent. Cytokine Growth Factor Rev. 2014;25:355-67. https://doi.org/10.1016/j.cytogfr.2014.07.011.
Ninci EB, Brandstetter T, Meinhold-Heerlein I, Bettendorf H, Sellin D, Bauknecht T. G-CSF receptor expression in ovarian cancer. Int J Gynecol Cancer. 2000;10:19-26. https://doi.org/10.1046/j.1525-1438.2000.99076.x.
Hirai K, Kumakiri M, Fujieda S, Sunaga H, Lao LM, Imamura Y, et al. Expression of granulocyte colony-stimulating factor and its receptor in epithelial skin tumors. J Dermatol Sci. 2001;25:179-88. https://doi.org/10.1016/s0923-1811(00)00131-6.
Wang R, Ma Y, Zhan S, Zhang G, Cao L, Zhang X, et al. B7-H3 promotes colorectal cancer angiogenesis through activating the NF-κB pathway to induce VEGFA expression. Cell Death Dis. 2020;11:55. https://doi.org/10.1038/s41419-020-2252-3.
Patel M, Horgan PG, McMillan DC, Edwards J. NF-κB pathways in the development and progression of colorectal cancer. Transl Res. 2018;197:43-56. https://doi.org/10.1016/j.trsl.2018.02.002.
Soleimani A, Rahmani F, Ferns GA, Ryzhikov M, Avan A, Hassanian SM. Role of the NF-κB signaling pathway in the pathogenesis of colorectal cancer. Gene. 2020;726:144132. https://doi.org/10.1016/j.gene.2019.144132.
Hollmén M, Karaman S, Schwager S, Lisibach A, Christiansen AJ, Maksimow M, et al. G-CSF regulates macrophage phenotype and associates with poor overall survival in human triple-negative breast cancer. Oncoimmunology. 2016;5:e1115177. https://doi.org/10.1080/2162402X.2015.1115177.
Toyoda M, Chikamatsu K, Sakakura K, Fukuda Y, Takahashi K, Miyashita M, et al. A case of squamous cell carcinoma of the head and neck producing granulocyte-colony stimulating factor with marked leukocytosis. Auris Nasus Larynx. 2007;34:267-71. https://doi.org/10.1016/j.anl.2006.07.014.
Morris KT, Khan H, Ahmad A, Weston LL, Nofchissey RA, Pinchuk IV, et al. G-CSF and G-CSFR are highly expressed in human gastric and colon cancers and promote carcinoma cell proliferation and migration. Br J Cancer. 2014;110:1211-20. https://doi.org/10.1038/bjc.2013.822.
Hansson M, Söderström T. The colony stimulating factors. Med Oncol Tumor Pharmacother. 1993;10:5-12. https://doi.org/10.1007/BF02987762.
Baeuerle PA, Henkel T. Function and activation of NF-kappa B in the immune system. Annu Rev Immunol. 1994;12:141-79. https://doi.org/10.1146/annurev.iy.12.040194.001041.
Li Q, Verma IM. NF-kappaB regulation in the immune system. Nat Rev Immunol. 2002;2:725-34. https://doi.org/10.1038/nri910.
Baldwin AS. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-kappaB. J Clin Invest. 2001;107:241-6. https://doi.org/10.1172/JCI11991.
Tan Y, Sun R, Liu L, Yang D, Xiang Q, Li L, et al. Tumor suppressor DRD2 facilitates M1 macrophages and restricts NF-κB signaling to trigger pyroptosis in breast cancer. Theranostics. 2021;11:5214-31. https://doi.org/10.7150/thno.58322.
Yang W, Liu L, Li C, Luo N, Chen R, Li L, et al. TRIM52 plays an oncogenic role in ovarian cancer associated with NF-kB pathway. Cell Death Dis. 2018;9:908. https://doi.org/10.1038/s41419-018-0881-6.
Ren D, Yang Q, Dai Y, Guo W, Du H, Song L, et al. Oncogenic miR-210-3p promotes prostate cancer cell EMT and bone metastasis via NF-κB signaling pathway. Mol Cancer. 2017;16:117. https://doi.org/10.1186/s12943-017-0688-6.
Olga S, Michael N. NF-κB Signaling in Gastric Cancer. Toxins (Basel). 2017;9:119. https://doi.org/10.3390/toxins9040119.
Wang L, Zhou W, Zhong Y, Huo Y, Fan P, Zhan S, et al. Overexpression of G protein-coupled receptor GPR87 promotes pancreatic cancer aggressiveness and activates NF-κB signaling pathway. Mol Cancer. 2017;16:61. https://doi.org/10.1186/s12943-017-0627-6.
Zhu G, Cheng Z, Huang Y, Zheng W, Yang S, Lin C, et al. MyD88 mediates colorectal cancer cell proliferation, migration and invasion via NF‑κB/AP‑1 signaling pathway. Int J Mol Med. 2020;45:131-40. https://doi.org/10.3892/ijmm.2019.4390.
Gao Y, Nan X, Shi X, Mu X, Liu B, Zhu H, et al. SREBP1 promotes the invasion of colorectal cancer accompanied upregulation of MMP7 expression and NF-κB pathway activation. BMC Cancer. 2019;19:685. https://doi.org/10.1186/s12885-019-5904-x.
DHX9 contributes to the malignant phenotypes of colorectal cancer via activating NF-κB signaling pathway. Cell Mol Life Sci. 78:8261-81. https://doi.org/10.1007/s00018-021-04013-3.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

CSF3 contributes to the invasive and metastatic phenotypes and associates with poor prognosis in patients with colorectal cancer via NF-κB signaling pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

1 Background

2 Materials And Methods

2.1 Cell lines and animals

2.2 Collection of tissue samples

2.3 Bioinformatics analysis

2.4 Immunohistochemical staining (IHC)

2.5 Plasmid construction and lentivirus infection

2.6 RNA extraction and Real-time quantitative PCR (qRT-

2.7 Western blot assay

2.8 Proliferation

2.9 Migration

2.10 Flow cytometry

2.11 The construction of tumor xenograft Model

2.12 Statistical analysis

3 Results

3.1 Upregulation of CSF3 predicts poor prognosis in colorectal cancer

3.2 Silencing CSF3 affects colorectal cancer cell events related to tumor development

3.3 Silencing CSF3 affects colorectal cancer tumor outgrowth

3.4 CSF3 mediates CRC via NF-κB signaling pathway

4 Discussion

5 Conclusions

Declarations

References

Additional Declarations

Status:

Version 1