Identification and functional mechanism verification of key microRNAs associated with the fibrosis progression in chronic kidney disease

doi:10.21203/rs.3.rs-2718414/v1

Download PDF

Research Article

Identification and functional mechanism verification of key microRNAs associated with the fibrosis progression in chronic kidney disease

https://doi.org/10.21203/rs.3.rs-2718414/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Chronic kidney disease (CKD) is a serious threat to human health worldwide, and its incidence is increasing annually. The incidence of CKD is a worldwide problem that heavily threatens human health and is increasing annually. A growing amount of information is emerging about the role of miRNAs in the regulation of renal fibrosis, which has aroused interest in the development of drugs that block pathogenic miRNAs or restore protective miRNAs levels.

Methods: The aim of this study was to identify the microRNAs (miRNAs) differentially expressed in renal tissues from patients with progressive DN and FSGS of high fibrosis scores to investigate the function and mechanism of miRNAs in renal fibrosis by using kidney tissues from normal and MCD patients as controls. First, we investigated the expression profiles of miRNAs in human kidney biopsy samples using microarray. Then, two new miRNAs were selected to explore the biological functions in TGF-β1 or HG -induced cell models using human proximal renal tubule cells (HK-2). GO and KEGG Pathway Enrichment Analysis were used to explore the target genes and their mechanism in renal fibrosis.

Results: The kidney biopsy samples from three types of diseases representing different fibrosis states, two novel miRNAs, hsa-miR-1470-3p and hsa-miR-4483-3p, were detected as consistently differentially expressed among all three types of patient's renal samples and in mice model. In vitro, hsa-miR-4483-3p was suppressed, whereas hsa-miR-1470-3p was induced by treatment with TGF-β1 or HG. Inhibition of hsa-miR-1470-3p or overexpression of hsa-miR-4483-3p promoted HG or TGF-β1-induced fibrosis in HK-2 cells. The further study revealed that MMP-13 and TIMP1 were the target genes of hsa-miR-1470-3p and hsa-miR-4483-3p, respectively.

Conclusion: In conclusion, the present study identifies newly dysregulated miRNA profiles related to fibrosis kidneys. Hsa-miR-1470-3p and hsa-miR-4483-3p are demonstrated to involve in kidney fibrosis by regulation of MMP13, TIMP1 respectively. Our results may represent a promising research direction for renal disorders and help identify new biomarkers and therapeutic targets for chronic kidney disease.

key miRNAs

chronic kidney disease

renal fibrosis

Chronic kidney disease (CKD) is a serious threat to human health worldwide, and its incidence is increasing annually. The incidence of CKD is a worldwide problem that heavily threatens human health and is increasing annually^[1–3]. In patients with CKD, regardless of the initial etiology, renal fibrosis is the leading cause of renal function loss and is considered as a major pathological characteristic leading to end-stage renal disease (ESRD)^[4–6]. Renal fibrosis is characterized by increased production of a-smooth muscle actin (a- SMA) and extracellular matrix (ECM) in the interstitium^[7–9]. However, the molecular mechanism of renal fibrosis has not been fully elucidated so far.

MicroRNAs (miRNAs) are endogenous non-coding small RNA, which mainly bind to the 3'-untranslated region (3'-UTR) of the target mRNA and prevent the transcription of the mRNA from being translated into proteins. MiRNAs are thought to be responsible for the regulation of > 60% of all protein expression levels, thereby playing significant and diverse roles in pathophysiological processes in various diseases^[10]. As a key regulator of organogenesis, cancer and diseases, miRNAs have attracted more and more attention^[3]. Recent studies have shown that some miRNAs in renal tissue play a significant role in the development of renal fibrosis. A deep understanding of their relationship may provide a new therapeutic target for the clinical treatment of renal fibrosis.

A growing amount of information is emerging about the role of miRNAs in the regulation of renal fibrosis, which has aroused interest in the development of drugs that block pathogenic miRNAs or restore protective miRNAs levels. For example, increased expression of miR-21 can be detected in renal tubules and glomerulus of humans and animals with kidney disease^[9]. Meanwhile, knockdown of miR-21 has a significant protective effect on renal fibrosis in mice or in renal tubular epithelial cells (TECs) and mesangial cells (MCs), which significantly reduce the accumulation of extracellular matrix (ECM) and α-smooth muscle actin (α-SMA), thereby alleviating the degree of fibrosis^[4–7].In recent years, anti-miR-21 therapy has demonstrated its ability to reduce renal injury and fibrosis in various animal models such as acute kidney injury (AKI) and Alport syndrome. Therefore, a potential new therapy of miR-21 for the treatment of renal fibrosis has entered phase II clinical trials^[8]. In addition, renal fibrosis was significantly attenuated by anti-miR-214 treatment in mice prior to unilateral ureteral obstruction (UUO) modeling, so miR-214 antagonism may be a novel therapy for renal fibrosis^[11].

Previous studies have shown that several miRNAs are involved in the pathological process of fibrosis in CKD, and consequently, they may represent valuable therapeutic targets for CKD^{[12, 13]}. However, further studies are needed to investigate the regulatory role of miRNAs in CKD, and these miRNAs could be developed as novel therapeutic medicine. Therefore, in the present study, we investigated the miRNAs involved in fibrosis progression of CKD and determined their potential as therapeutic agents for fibrosis of the kidney in CKD.

Patient specimens

Fresh kidney biopsy samples were obtained from patients with pathologically confirmed MCD, FSGS, and DN (n = 4 per group) for microarray analysis. Four cases of healthy kidney tissue from donor biopsy without obvious lesions were used as controls. Formalin-fixed paraffin-embedded (FFPE) renal biopsy specimens from patients with MCD, FSGS, DN, and healthy donor kidneys (n = 4 per group) were used for the validation and location study. Patient inclusion and exclusion criteria are listed in Supplementary Table 1. The clinical data including age, gender, Serum creatinine, Estimated glomerular filtration rate (eGFR), hospital number, pathological number, nephropuncture time were collected at the time of renal biopsy. These data are presented in Table 1 and Supplementary Table 2. All patients were granted written informed consent to take part in the study. Additionally, the protocol was ethically approved by the Institutional Review Board of The First Affiliated Hospital of Sun Yat-sen University.

Table 1

Clinical characteristics of MCD,FSGS,DN patients.
Group	Number	Gender	Age	Serum creatinine (umol/l)	eGFR (ml/min/1.73m²)
MCD	4	2M, 2F	28.8 ± 5.9	67.3 ± 10.4	116.4 ± 11.1
FSGS	4	3M, 1F	34.5 ± 11.7	164.5 ± 76.6	49.2 ± 16.8
DN	4	2M, 2F	45.5 ± 8.7	319.8 ± 162.1	25.0 ± 21.6
Normal	4	3M, 1F	-	-	-
(MCD minimal change disease, FSGS focal segmental glomerulosclerosis, DN diabetic nephropathy, M male, F female, eGFR estimated glomerular filtration rate.)

Mice models of DN and FSGS

All the experiments involving animals were performed after The First Affiliated Hospital of Sun Yat-sen University Institutional Ethical Committee's approval and under the strict adherence to the National Institutes of Health Guide for laboratory animals' care and use.

DN model: db/db mice and db/m mice (n = 30 per group, male, 6–8 weeks) were purchased from Nanjing University Bio-model Company and fed with a normal diet. Body weight and blood glucose were detected once a month from the beginning, and 24-hour urine was collected in the metabolic cage at 8w, 12w, 16w, 20w and 24w to detect urinary creatinine, urinary protein, and urinary albumin/creatinine in mice. A certain number of db/db mice and db/m mice were killed at 12w, 16w, and 24w, respectively (n = 10 per group).

FSGS model: Healthy 8-week-old balb/c mice were purchased from Beijing Weitong Lihua Animal Center, and randomly divided into FSGS model group and sham group with 8 mice in each group. The mice in the model group were injected with Adriamycin (12.5mg/kg, Sigma) twice into the tail vein of the mouse as described^[14], while another group of mice an equal amount of normal saline through the tail vein and served as controls. 24-h urine was collected every 2 weeks after injection, subsequently, the urinary creatinine, urinary protein, and urinary albumin/creatinine were then determined. Mice were killed 4 weeks after the last doxorubicin treatment, and their kidneys were harvested for further analysis.

MTT assay

Cell viability was determined by using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT; Sigma, St Louis, USA) colorimetric assay. HK-2 cells were seeded in 96-well plates and incubated for 24 hours, and the cells were subjected to various stimulations. After the treatments for different times, cells were washed with phosphate-buffered saline (PBS) and incubated in MTT solution (Sigma) for 3 hours. After dimethyl sulfoxide was added to each well, the absorbance was measured at 490 nm to determine the cell viability with a microplate reader (BioTek, Winooski, USA).

RNA isolation and microarray profiling

According to the manufacturer's guidelines, the total RNA of kidney biopsy tissues was extracted using Tri-Reagent (Invitrogen, Carlsbad, CA) and miRNeasy Mini Kit (Qiagen, Germany). 1 µg total RNA of each sample was characterized with the miRCURY™ Hy3™/Hy5™ Power Labeling Kit and hybridized on the miRCURY™ LNA Array containing 3100 capture probes. These samples were scanned by the Axon GenePix 4000B microarray scanner and the images were then imported into GenePix Pro 6.0 software to align the grid and extract data. Replicated miRNAs were averaged and those with intensities ≥ 30 in all samples were selected for normalization factor calculation. The expressed data were normalized using the Median normalization. After normalization, major differentially expressed (DE) miRNAs were detected by Volcano Plot filtering. Finally, hierarchical clustering was performed to show the different miRNAs expression profiles of the samples. For expression analysis, miRNAs were classified as differentially expressed if the fold change is > 1.5 and significant if the p-value is < 0.05.

In situ hybridization

To detect the expression levels and localization of hsa-miR-1470-3p and has-hsa-miR-4483-3p in kidney, in situ hybridization was performed in control, MCD, FSGS and DN kidneys using FFPE sections as described [24]. Specific LNA-digoxigenin labeled hsa-miR-1470-3p probe (5'-GCCCTCCGCCCGTGCACCCCG-3'), has-miR-4483-3p probe (5'-GGGGTGGTCTGTTGTTG-3'), and Negative Control probe (5'-GaactGGGGTGCGTGTGTGAT-3') were used (Roche Diagnostics, IN).

Cell culture and miRNA transfection

HK-2 cells were cultured in Dulbecco's modified Eagle's medium/F12 medium(Life Technologies, Carlsbad, CA) with 10% fetal bovine serum, 100-u/mL penicillin, and 100-µg/mL streptomycin(Life Technologies) at a 37°C incubator with 5% CO2. In the six-well plate, according to the instructions of ribo FECTTMCP transfection reagent,50nM hsa-miR-1470-3p, hsa-miR-4483-3p mimics and mimic negative control, 100nM hsa-miR-1470-3p, hsa-miR-4483-3p inhibitor and inhibitor negative control were transfected into HK-2 cells respectively, and the transfected cells were obtained at the designated time point to detect microRNA levels and expression of fibrosis factors. (The sequence of microRNA mimic, inhibitor, mimic NC, inhibitor NC are shown in Supplementary Table 3.) For TGF-β1 and HG treated experiment, cells were cultured in the presence or absence of 10 ng/mL recombinant human TGF-β1 (R&D Systems, Minneapolis, MN) and 30mM high glucose (HG) for various times.

Quantitative real‑time polymerase chain reaction（qRT-PCR）

Total RNA was isolated from FFPE specimens of MCD, FSGS, DN, and normal kidney biopsies using the RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE (Invitrogen) following the instructions. Meanwhile, total RNA was extracted from fresh mouse kidney cortex and HK-2 cells using TRIZOL Reagent Kit (Invitrogen, Carlsbad, CA, USA). For miRNA and mRNA, total RNA (1 ug) was reverse transcribed into cDNA using Roche Transcriptor First Strand cDNA Synthesis Kit according to the manufacturer's protocol. QRT-PCR was performed on the ABI 7900 system using the Roche FastStart Universal SYBR Green Master (ROX). All data were normalized to U6 or β-actin expression. The relative RNA expression was calculated with the method of 2-ΔΔCt. The primers are listed in Supplementary Table 4.

Western blotting

Western Blotting

Proteins isolated from mouse kidney tissue samples and cultured HK-2 cells were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, Billerica, MA, USA), blocked with 5% non-fat dried milk, and incubated overnight at 4℃ with primary antibodies: anti- COL − 1 antibody (1:1000,SouthernBiotech, USA), anti- COL − 3 antibody (1:1000,SouthernBiotech, USA), anti-a- SMA antibody (1:1000,Sigma, USA), anti-fibronectin antibody (1:1000, BD,USA), anti-vimentin antibody (1:1000, Abcam, USA), anti-E-cadherin antibody (1:1000, BD,USA), anti-MMP13 antibody (1:1000, Affinity, China), anti-TIMP1 antibody (1:1000, Affinity, China). Then the secondary antibodies were applied and the signals were detected by enhanced chemiluminescence (Merck Millipore, USA). The density of the bands was quantified and normalized to β-actin using Image-J software.

Immunofluorescence Assay

The paraffin-embedded mouse kidneys and HK-2 cells were prepared by a routine procedure and then incubated with anti-E-cadherin(E- CAD) antibody (1:20, BD, USA), anti-vimentin antibody (1:20, Abcam, USA), anti-COL-1 antibody (1:20, SouthernBiotech, USA), anti-COL-3 antibody (1:20, SouthernBiotech, USA) and anti-COL-4 antibody (1:20, SouthernBiotech, USA) overnight at 4℃. The slides were then stained with Cy3- or fluorescein isothiocyanate (FITC)-conjugated secondary antibodies for 1 hour at 37℃ and mounted with the anti-fade mounting medium using DAPI to visualize the nuclei. Slides were visualized on a ZEISS confocal microscope for each group (n = 3).

Histology Staining

Paraffin-embedded kidney sections from mice were prepared by a routine procedure. The glomerular collagen deposition, interstitium, glomerular volume, mesangial cells, and mesangial matrix were detected by H&E, Masson, PAS, and PASM staining in 2 µm paraffin sections. After histologic staining, neutral balsam was used for sealing, and representative images were captured using Leica Microscopy (Germany) for each group (n = 3).

Luciferase Reporter Assays

The 3'-UTRs for both MMP13 and TIMP1 were PCR-amplified from genomic DNA. PCR primers were used to amplify the MMP13 and TIMP1 (primer sequences are listed in Supplementary Table 4). The amplified 3'-UTRs were cloned downstream of the luciferase coding region in the pGL-3 control (Clontech). HK-2 cells were cultured in 24-well plates 24 hours before transfection. 200ng of the reporter plasmid was co-transfected with the control Renilla-luciferase plasmid were cotransfected using Lipofectamine 3000 (Invitrogen). To assess the effect of hsa-miR-1470-3p、hsa-miR-4483-3p on reporter activity, 20uM of synthetic miRNAs mimics (FuNeng GuangZhou) were cotransfected. Then, cells were harvested 48 hours after transfection and luciferase activities were analyzed by Dual-Luciferase Reporter Assay (Promega, Madison, WI). Renilla luciferase activity was normalized to firefly luciferase expression of each sample. Data were expressed as means ± SEM of three independent experiments.

Statistical analysis

The experimental results are expressed in the form of mean ± SEM. The results of at least three independent and repeated experiments were taken, and the data were analyzed using GraphPad Prism software. The independent samples t-test was used, and for comparison between multiple groups, the LSD method was used in one-way method ANOVA. P < 0.05 indicated that the difference is statistically significant.

The clinical characteristics of MCD, FSGS, DN patients are summarized in Table 1. The serum creatinine and eGFR levels for the MCD, FSGS and DN groups were 67.3 ± 10.4, 164.5 ± 76.6, 319.8 ± 162.1 µmol/L and 116.4 ± 11.1, 49.2 ± 16.8, 25.0 ± 21.6, respectively, indicating progressive deterioration of renal function in MCD, FSGS and DN patients.

miRNA expression profile in kidney samples from DN, FSGS, MCD patients.

Kidney tissues from DN, FSGS and MCD patients of suitable age and gender were selected for analysis according to the results of renal pathology from the Department of Pathology of the First Affiliated Hospital of Sun Yat-sen University (Supplementary Table 3 for inclusive and exclusive criteria). A total of 16 fresh kidney biopsies were used for miRNA expression profiling by microarray screening. A large number of miRNAs were found differentially expressed (DE) in DN, FSGS, MCD patients compared with control patients (the heat map is shown in Fig. 1A-C). As shown in the table, by comparison of the DE miRNAs profiles among these three groups, 437 miRNAs were found to be commonly dysregulated as compared with the control groups (Fig. 1D). According to the chip detection results, hsa-miR-1470-3p is the most upregulated microRNA among the DE microRNAs, whereas hsa-miR-4483-3p is the most downregulated microRNA. The detection results of these two miRNAs in the chips of patients with DN, FSGS, and MCD are shown in Table 2.

Table 2

Hsa-miR-1470-3p and hsa-miR-4483-3p in FSGS, DN and MCD compared with the normal group.
ID	FSGS FC	p-value	DN FC	p-value	MCD FC	p-value
Up-regulated
has-hsa-miR-1470-3p	63.761	0.046	117.892	0.041	-	-
Down-regulated
Has-hsa-miR-4483-3p	0.034	0.000	0.166	0.003	-	-
(FC fold change)

2. Validation of hsa-miR-1470-3p and hsa-miR-4483-3p in DN, FSGS, MCD patients.

Hsa-miR-1470-3p and hsa-miR-4483-3p were established to change consistently among the three groups by qRT-PCR. The expression of hsa-miR-1470-3p was mainly upregulated in the FSGS, DN groups compared with the control and MCD groups, while hsa-miR-4483-3p was downregulated in the diseased kidneys (Fig. 1F). The results of in situ hybridization(ISH) using human FFPE sections showed that both hsa-miR-1470-3p (probe sequence: GCCCTCCGCCCGTGCACCCCG) and has-hsa-miR-4483-3p (probe sequence: GGGGTGGTCTGTTGTTG ) were largely expressed in tubular epithelial cells (Fig. 1E). Negative Control sequence: GaactGGGGTGCGTGTGTGAT.

3.HK-2 cell viability under HG and TGF-β1 stimulation.

MTT assay was used to detect the cell viability of HK-2 cells under HG (30mM) and TGF-β1 (10ng/mL) stimulation at different time points of stimulation. As can be seen from Fig. 1G,H, the viability of cells was fair from 0h-72h, while it significantly declined at 96h under the stimulation of HG. Similarly, the activity of TGF-β1 stimulated cells reduced significantly after 96h of stimulation. Therefore, the duration of the stimulus of HG and TGF-β1 was set for 72h.

4.Expression of hsa-miR-1470-3p and hsa-miR-4483-3p in the kidney of disease model mice

1)Biochemical parameters of blood and urine in DN,FSGS mice models.

During animal modeling, two db/db mice died for unknown reasons and were removed from the experimental group. Computer-generated images of DN and FSGS model mice are shown in Fig. 2A, F. Figure 2.B-E shows that the body weight, blood glucose, urinary albumin/creatinine ratio, and serum creatinine of db/db diabetic mice increased significantly compared with that of db/m mice from 6–8 weeks. Meanwhile, the serum creatinine and 24h urinary protein of FSGS model group were also increased compared with the control group, as shown in Fig. 2. G,H.

2) Pathological changes of renal tissue in DN, FSGS mice model.

As can be seen from the staining of HE, Masson, PAS and PASM in Fig. 2.I. In diabetic nephropathy mice at 16w and 24w db/db experienced glomerulus hypertrophy, severe enlargement and widening of the mesangial matrix, resulting in nodular sclerosis, k-W nodules and more obvious collagen deposition in the glomerulus and renal interstitium compared with 16w and 24w db/m mice. In addition, mesangial and mesangial matrix hyperplasia, glomerulosclerosis, mesangial matrix broadening, diffuse basement membrane thickening, and glomerular and renal interstitial collagen deposition were obvious in the FSGS model group compared with control mice.

3) The mRNA and protein levels of renal fibrosis indices in DN and FSGS mice.

In order to confirm the successful modeling of DN and FSGS mice, the kidney tissues of db/db, db/m, FSGS and control mice were taken to extract RNA and protein to verify the mRNA and protein expression levels of the related fibrosis indicators. As shown in Fig. 2J,M, QPCR revealed that the mRNA expression levels of FN, COL 1, COL 3, and a- SMA in 16W ,24W db/db mice and the FSGS group were remarkably higher than those in db/m mice of the same week and the control mice. Moreover, as shown in Fig. 2.K,L, western blot and semi-quantitative analysis were also performed to verify the protein expression levels of E-CAD, COL-1, COL-3 and vimentin was significantly higher in 16w and 24w db/db diabetic mice than in db/m mice of the same week. At the same time, the protein expression of vimentin, E- CAD, COL − 1, COL − 3, and a- SMA in FSGS mice were elevated than those in control mice, as shown in Fig. 2.N,O. Furthermore, the immunofluorescence results in Fig. 2.P-R indicate that the protein expression of E- CAD, COL − 1, COL − 3 and vimentin is higher in 16W,24W db/db mice and FSGS mice than in db/m mice of the same week and the control group.

4) Validation of hsa-miR-1470-3p and hsa-miR-4483-3p in DN and FSGS mice in vivo.

In conclusion, the renal fibrosis models of DN and FSGS were established successfully. As shown by qRT-PCR in Fig. 2. S,T,U, hsa-miR-1470-3p was up-regulated in DN and FSGS kidneys, while hsa-miR-4483-3p was down-regulated which is in complete agreement with the data from human samples.

5. Role of hsa-miR-1470-3p and hsa-miR-4483-3p in HG -induced fibrosis in HK-2 cells.

To determine the expression of hsa-miR-1470-3p and hsa-miR-4483-3p in HG -induced fibrosis of HK-2 cells, cells were collected from normal glucose (5.5mmol/L, NG), normal glucose + mannitol hyperosmotic (5.5mmol/L + 24.5mmol/L mannitol, NM), and high glucose (30mmol/L, HG) for 0h, 24h, 48h, and 72h after synchronous treatment for qRT-PCR. As shown in Fig. 3A, B, the expression of hsa-miR-1470-3p was upregulated in a time-dependent manner after HG stimulation compared with HK-2 cells cultured in NG or NM medium. In contrast, the expression of hsa-miR-4483-3p showed an opposite trend.

HK-2 cells were transfected with hsa-miR-1470-3p mimic, hsa-miR-1470-3p inhibitor, hsa-miR-4483-3p mimic, hsa-miR-4483-3p inhibitor, and miRNA mimic NC or miRNA inhibitor NC under HG stimulation, respectively. The qRT-QPCR showed that the level of hsa-miR-1470-3p and hsa-miR-4483-3p in the hsa-miR-1470-3p mimic and hsa-miR-4483-3p mimic transfection group were especially higher than that in the miRNA mimic NC group, and these levels were significantly reduced after miRNA inhibition transfection compared with the miRNA inhibitor NC group, see Fig. 3C,D.

QRT-PCR, western blot and semi-quantitative analysis showed that the mRNA and protein levels of fibrosis markers (FN, COL-1, COL-3, a-SMA) augmented under HG stimulation, suggesting that HG could promote fibrosis in HK-2 cells. The results showed that under HG stimulation, after hsa-miR-1470-3p was overexpressed or hsa-miR-4483-3p was inhibited, the expressions of FN,COL-1, COL-3,a-SMA mRNA and protein levels were greatly enhanced. On the contrary, when hsa-miR-1470-3p was inhibited or hsa-miR-4483-3p was overexpressed, the expression of these proteins declined (Fig. 3G-P). Meanwhile, immunofluorescence results showed that under the stimulation of HG, the levels of FN, COL-4 ,vimentin were increased after hsa-miR-1470-3p was overexpressed or hsa-miR-4483-3p was inhibited, whereas the expression of these proteins decreased when hsa-miR-1470-3p was inhibited or hsa-miR-4483-3p was overexpressed (Fig. 3Q-V).

6. Role of hsa-miR-1470-3p and hsa-miR-4483-3p in TGF-β1-induced fibrosis in HK-2 cells.

The expression levels of hsa-miR-1470-3p and hsa-miR-4483-3p in TGF-β1-induced fibrosis of HK-2 cells showed the same trend as the HG stimulation detected by qRT-PCR, as shown in Fig. 4A,B. Similarly, qRT-QPCR showed that the levels of hsa-miR-1470-3p and hsa-miR-4483-3p were particularly high in the mimic transfection group compared with mimic NC group, and the expression of these two microRNAs was lower in the inhibitor transfection group under TGF-β1 stimulation than in the inhibitor NC group, see Fig. 4C,D.

TGF-β1 stimulation has the same effect on promoting fibrosis as HG stimulation. QRT-PCR,WB, and semi-quantitative analysis showed that under TGF-β1 stimulation, the mRNA and protein levels of fibrosis-related markers (FN, COL-1, COL-3, a-SMA) were greatly boosted after hsa-miR-1470-3p overexpression or hsa-miR-4483-3p inhibition, and the above fibrosis markers were also inhibited after inhibition of hsa-miR-1470-3p expression or overexpression of hsa-miR-4483-3p (Fig. 4E-P). Besides, immunofluorescence showed that under TGF-β1 stimulation, levels of FN, COL-4, and vimentin increased after overexpression of hsa-miR-1470-3p or inhibition of hsa-miR-4483-3p. Conversely, the expressions of the above proteins were reduced after hsa-miR-1470-3p was inhibited or hsa-miR-4483-3p was overexpressed (Fig. 4Q-V).

7. The analysis of the target genes of hsa-miR-1470-3p and hsa-miR-4483-3p.

In order to characterize the potential biological functions of hsa-miR-1470-3p and hsa-miR-4483-3p, the putative target genes of these two novel miRNAs were predicted by TargetScan,miRanda and then subjected to GO analysis and KEGG pathway enrichment analysis so that the downstream target genes of hsa-miR-1470-3p and hsa-miR-4483-3p could be predicted online (Fig. 5A-D). Among all the genes examined in the previous step, we preliminarily screened target genes associated with fibrosis for further verification.

The qRT-PCR results showed that the levels of MMP14, MMP13, MMP9, CTGF, and TIMP1 were greatly decreased after overexpression of hsa-miR-1470-3p or hsa-miR-4483-3p and that these target genes were increased after inhibition of hsa-miR-1470-3p or hsa-miR-4483-3p (Fig. 5E,F). Therefore, the wild-type and mutant plasmids were established by a double luciferase reporter vector (Fig. 5G-J). MMP13, MMP9, CTGF, TIMP1 wild-type, mutant plasmids and hsa-miR-1470-3p or hsa-miR-4483-3p mimics, mimic NC were transfected into HK-2 cells for 48h to 72h, and the fluorescence activity was detected by dual-luciferase reporter gene system. The results showed that when co-transfected with rluc-MMP13-WT, rluc-TIMP1 -WT plasmid,the addition of hsa-miR-1470-3p mimic or hsa-miR-4483-3p mimic reduced the luciferase activity compared with the negative control group. In conclusion, it indicates that hsa-miR-1470-3p can bind directly to MMP13, while hsa-miR-4483-3p binds to TIMP1 and thus is involved in renal fibrosis (Fig. 5K,L). Figure 5M-N showed that the expression of MMP13,TIMP1 decreased after overexpression of hsa-miR-1470-3p or hsa-miR-4483-3p, whereas transfection of hsa-miR-1470-3p or hsa-miR-4483-3p inhibitors into HK-2 cells showed the opposite trend. In addition, the WB results of kidney tissue of DN mice showed that the expression of MMP13 was decreased in the kidney tissue of 24w db/db mice compared with that of 24w db/m mice, while the expression level of TIMP1 decreased.

Finally, the protein-protein interaction network (PPI), GO, and KEGG enrichment were used to predict the top 10 significant target genes of MMP13 and TIMP1, which indicate that MMP13 and TIMP1 are closely related to the synthesis of extracellular matrix and collagen and thus participating in the process of renal fibrosis (Fig. 5U-Z).

MicroRNAs are conserved, endogenous and short RNA molecules whose typical role is to regulate the expression of their target proteins through mRNA degradation or translation inhibition^[15]. MicroRNAs are known to regulate many cellular processes, including cell type differentiation, proliferation, migration, survival, and play an active role in cell physiology and pathophysiology. Many microRNAs are involved in the occurrence and progression of chronic or acute nephropathy in patients or animal models^[16]. For example, miR-29 can reduce renal interstitial fibrosis^[17]. MiR-382 and miR-21 can lead to renal interstitial fibrosis^{[18, 19]}. MiR-192 mediates the effect of TGF-β1 on vascular cells and glomerular injury in the diabetic glomerular system^[20]. MiR-30 family protects against podocellular injury and proteinuria^[21]. In addition to these functions, miRNAs can also serve as potential disease markers and contribute to the development of precision medicine. For example, a study of 112 patients with non-small cell lung cancer showed characteristics of five microRNAs that predict disease progression^[22]. Another study of 109 polyps undergoing colonoscopy found microRNA expression profiles of four different histopathological polyps compared with normal mucosa^[23].

Zhong et al. found that the glucose and urinary albumin/creatinine ratios of db/db diabetic mice at 20 weeks of age were significantly higher than in db/m mice of the same age. PAS staining showed that the kidney of db/db diabetic mice at 20 weeks of age showed glomerular hyperplasia, thickening of the capillary basement membrane, and dilatation of the mesangial matrix, as well as other pathological changes of diabetic nephropathy. Thus, db/db mice showed obvious renal fibrosis at 20 weeks of age^[24]. Therefore, 16w and 24w db/db mice can be selected as models for moderate and severe renal fibrosis in DN. Meanwhile, studies have shown that balb/c mice carry recessive ADR sensitivity genes^[25], and in preliminary studies, a single dose only induced transient proteinuria, which peaked on day 14. In order to be predictable and reproducible for the induction of persistent proteinuria and progressive glomerulosclerosis, two injections were used in the study, separated with 4W. The control group was injected with the same amount of normal saline. Compared with the control group, PAS staining of renal tissue in the experimental group showed glomerulosclerosis, basement membrane hyperplasia, and significantly increased serum creatinine and urinary albumin/creatinine levels^[26]. In conclusion, we planned to establish a FSGS model by injecting doxorubicin 12.5mg/kg twice into the caudal vein.

A previous study on esophageal cancer showed that hsa-miR-1470-3p was located at 19p13.12, revealing that hsa-miR-1470-3p was upregulated in ESCC tissues. Moreover, functional experiments showed that downregulation of hsa-miR-1470-3p significantly inhibited the proliferation of ESCC cells and decreased the level of CCNE1, a cell cycle regulation gene. The results indicated that upregulation of hsa-miR-1470-3p expression could promote cell proliferation and accelerate cell cycle transition^[27]. Meanwhile, Nie et al. confirmed that hsa-miR-1470-3p induces the upregulation of p27 by targeting C-Jun-mediated lapatinib^[28], but the expression, role, and potential molecular mechanism of hsa-miR-1470-3p in the progression of CKD remain to be determined. Importantly, hsa-miR-1470-3p and hsa-miR-4483-3p identified in this study have not been previously detected in kidney disease and may represent novel disease mechanisms worthy of further investigation. As seen in the study of this work, hsa-miR-4483-3p was downregulated in renal tubules of patients with DN and FSGS, whereas hsa-miR-1470-3p was upregulated, so its role in renal fibrosis and related mechanisms can be explored in an innovative way.

Fibrosis is a basic connective tissue lesion defined as an increase in fibrous extracellular matrix (ECM) in a tissue or organ. Matrix metalloproteinases (MMPs) are major proteases that regulate translocation of ECM, so they are thought to be important in tissue remodeling during fibrosis. Tissue remodeling is the result of the imbalance between normal synthesis and degradation of ECM components, which is largely controlled by MMPs/TIMP imbalance^[29]. MMPs are zinc-binding proteins that have been shown to play a role in tumor cell metastasis due to their ability to degrade ECM. Overexpression of MMPs can aggravate the digestion and degradation of various components of ECM^[30]. MMPs and tissue inhibitors of metalloproteinase (TIMP) are two important factors in regulating the synthesis and degradation of ECM. MMPs mainly degrade the main components of the extracellular matrix, collagen I and III, and TIMP1 can inhibit the activity of MMPs. In this study, we also identified that the regulation of fibrosis via targeting MMP13 and TIMP1 may be the mechanisms by which hsa-miR1470-3p and hsa-miR-4483-3p are involved in the process of renal fibrosis. By loss-of- and gain-of-function regulation in vitro, our results confirmed that hsa-miR-1470-3p inhibited fibrosis formation, whereas hsa-miR-4483-3p promoted it. As demonstrated by qRT-PCR, western blot, and luciferase reporter assay, MMP13 and TIMP1 were found to be the true target genes of hsa-miR-1470-3p and hsa-miR-4483-3p, respectively. Our study showed that hsa-miR-1470-3p could bind to the 3'-UTR of MMP13, inhibiting its expression and reducing the degradation of extracellular matrix, which promoted the process of renal fibrosis. Meanwhile, hsa-miR-4483-3p was decreased in fibrotic kidneys and HG or TGF-β1-treated HK-2 cells, whereas TIMP1 was inhibited by hsa-miR-4483-3p at both mRNA and protein levels. This may be the underlying mechanism by which hsa-miR-4483-3p is involved in renal fibrosis, which requires further research.

There are some limitations in the present study. First, the levels of hsa-miR-1470-3p and hsa-miR-4483-3p were not artificially inhibited or overexpressed in DN and FSGS mice models, so as to observe the therapeutic effect of downregulation of hsa-miR-1470-3p or upregulation of hsa-miR-4483-3p in vivo on renal fibrosis. Second, the dual-luciferase reporter gene showed that the addition of hsa-miR-1470-3p, hsa-miR-4483-3p mimics could reduce the luciferase activity of MMP13, TIMP1 in HK-2 cells. However, after co-transfection of hsa-miR-1470-3p, hsa-miR-4483-3p mimics with the mutant MMP13 or TIMP1 plasmid at the binding site, the fluorescence activity of luciferase did not change significantly. In summary, the binding sites of MMP13 and hsa-miR-1470-3p, TIMP1, and hsa-miR-4483-3p should be reselected to construct mutant plasmids for further dual-luciferase analysis. Third, the heterogeneity of the MCD, FSGS, DN samples makes it difficult to clarify the significance of dysregulated miRNAs. Comprehensive studies of a single disease at different stages are likely to provide more intriguing data. Last but not least, the detailed mechanisms by which hsa-miR-1470-3p and hsa-miR-4483-3p participate in specific types of kidney disease need to be further explored.

In conclusion, the present study identifies newly dysregulated miRNA profiles related to fibrosis kidneys. Hsa-miR-1470-3p and hsa-miR-4483-3p are demonstrated to involve in kidney fibrosis by regulation of MMP13, TIMP1 respectively. Our results may represent a promising research direction for renal disorders and help identify new biomarkers and therapeutic targets for chronic kidney disease.

Acknowledgements

We thank Dr. Xueqing Yu, Dr. Qin Zhou(National Health Commission Key Laboratory of Nephrology, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, China) for their helpful suggestions regarding the experiments and their excellent technical assistance.

Author contributions

JQW,XQY contributed to the conception of the study; KYH,XCZ performed the experiment; JZ,HXD contributed significantly to analysis and manuscript preparation; YH performed the data analyses and wrote the manuscript; RRD helped perform the analysis with constructive discussions.

Funding

This work was supported in part by the National Natural Science Foundation of China (No. 81960142, 81560122), Youth Science and Technology Fund Program of Gansu Province (No. 21JR1RA157), and Talent Innovation and Entrepreneurship Project of Lanzhou City, Gansu Province (2021-RC-94). Meanwhile, our experiments are supported by the Clinical Medical Research Center of Gansu Province (21JR7RA436).

Data availability

All data generated or analyzed during this study are included in this article. Further enquiries can be directed to the corresponding author on reasonable request.

Conflict of interest The authors declare that they have no competing interests.

Ethical approval

The study protocol was approved by the Institutional Review Board and Ethics Committee of The First Affiliated Hospital of Sun Yat-sen University. Every patient had provided written informed consent. All animal experiments were approved by the Committee on Animal Experimentation of Sun Yatsen University and performed in compliance with the Guidelines for the Care and Use of Laboratory Animals of the university.

Zhang L, Wang F, Wang L. et.al. Prevalence of chronic kidney disease in China: a cross-sectional survey[J].Lancet,2012,379(9818):815–822.
Chung AC, Lan HY. MicroRNAs in renal fibrosis.[J].Front Physiol.2015.00050.
Saal S, Scott J. Harvey.MicroRNAs and the kidney: coming of age[J]. Ren pathophysiology. 2009;18:317–23.
Hallan SI, Ovrehus MA, Romundstad S, Rifkin D, Langhammer A, Stevens PE, Ix JH. Long-term trends in the prevalence of chronic kidney disease and the influence of cardiovascular risk factors in Norway[J]. Kidney Int. 2016;90:665–73.
Murphy D, McCulloch CE, Lin F, Banerjee T, Bragg-Gresham JL, Eberhardt MS, Morgenstern H, Pavkov ME, Saran R, Powe NR, Hsu CY. Centers for Disease, C, Prevention Chronic Kidney Disease Surveillance, T., Trends in prevalence of chronic kidney disease in the United States[J]. 2016.Ann. Intern. Med.
Shin HY, Kang HT. Recent trends in the prevalence of chronic kidney disease in Korean adults: Korean National Health and Nutrition Examination Survey from 1998 to 2013. J. Nephrol; 2016.
Decleves AE, Sharma K. Novel targets of antifibrotic and anti-inflammatory treatment in CKD[J]. Nat Rev Nephrol. 2014;10:257–67.
Jha V, Garcia-Garcia G, Iseki K, Li Z, Naicker S, Plattner B, Saran R, Wang AY, Yang CW. Chronic kidney disease: global dimension and perspectives[J].Lancet,2013382,260–272.
Katz IJ, Gemtholtz TE, van Deventer. M,et a1.Is there a need for eally detection pmgmms for chronic kidney disease?[J].C linical nephmlogy,2010,74(suppll):113–118.
Trionfini P, Benigni A, Remuzzi G. MicroRNAs in kidney physiology and disease[J]. Nat Rev Nephrol. 2015;11:23–33.
Denby L, Ramdas V, Lu R, Conway BR, Grant JS, Dickinson B, Aurora AB, McClure JD, Kipgen D, Delles C, van Rooij E, Baker AH. MicroRNA-214 antagonism protects against renal fibrosis. J Am Soc Nephrol. 2014 Jan;25(1):65–80.
Qin W, Chung AC, Huang XR, Meng XM, Hui DS, Yu CM, Sung JJ, Lan HY. TGF-β/Smad3 signaling promotes renal fibrosis by inhibiting miR-29. J Am Soc Nephrol. 2011;22:1462–74.
Chau BN, Xin C, Hartner J, et al. MicroRNA-21 promotes fibrosis of the kidney by silencing metabolic pathways[J]. Sci Transl Med. 2012;4:121ra18.
Fogo AB. Animal models of FSGS: lessons for pathogenesis and treatment. Semin Nephrol. 2003 Mar;23(2):161–71.
Makeyev EV, Maniatis T. Multilevel regulation of gene expression by microRNAs[J]. Science. 2008;319:1789–90.
Trionfini P, Benigni A, Remuzzi G. MicroRNAs in kidney physiology and disease[J]. Nat Rev Nephrol. 2015;11:23–33.
Qin W, Chung AC, Huang XR, Meng XM, Hui DS, Yu CM, Sung JJ, Lan HY. TGF-β/Smad3 signaling promotes renal fibrosis by inhibiting miR-29. J Am Soc Nephrol. 2011;22:1462–74.
Chau BN, Xin C, Hartner J, et al. MicroRNA-21 promotes fibrosis of the kidney by silencing metabolic pathways[J]. Sci Transl Med. 2012;4:121ra18.
Kriegel AJ, Liu Y, Cohen B, Usa K, Liu Y, Liang M. MiR-382 targeting of kallikrein 5 contributes to renal inner medullary interstitial fibrosis[J]. Physiol Genomics. 2012;44:259–67.
Kato M, Zhang J, Wang M, Lanting L, Yuan H, Rossi JJ, Natarajan R. MicroRNA-192 in diabetic kidney glomeruli and its function in TGF-beta-induced collagen expression via inhibition of E-box repressors[J]. Proc Natl Acad Sci. 2007;104:3432–7.
Wu J, Zheng C, Wang X, et al. MicroRNA-30 family members regulate calcium/calcineurin signaling in podocytes[J]. J Clin Invest. 2015;125:4091–106.
Yu SL, Chen HY, Chang GC, et al. MicroRNA signature predicts survival and relapse in lung cancer[J]. Cancer Cell. 2008;13:48–57.
Tsikitis VL, Potter A, Mori M, et al. MicroRNA signatures of colonic adenomas according to histology[J]. Cancer Prev Res (Phila). 2016;9:942–9.
X.Zhong ACK, et al. miR-21 is a key therapeutic target for renal injury in a mouse model of type 2 diabetes[J]. Diabetologia. 2013;56:663–74.
Zheng Z, Pavlidis P, Chua S, et al. An ancestral haplotype defines susceptibility to doxorubicin nephropathy in the labo- ratory mouse[J]. J Am Soc Nephrol. 2006;17:1796–800.
Caroline B, Marshall RD, Krofft JW, Pippin, et al. CDK inhibitor p21 is prosurvival in adriamycin-induced podocyte injury, in vitro and in vivo[J]. Am J Physiol Renal Physiol. 2010;298:F1140–51.
LI-LI MEI, YUN-TAN QIU, WEN-JUN, WANG, et al. Overexpression of microRNA-1470 promotes proliferation and migration, and inhibits senescence of esophageal squamous carcinoma cells[J]. Oncol Lett. 2017;14:7753–8.
Nie W, Song W, Zhang W, et al. hsa-miR-1470-3p mediates lapatinib induced p27 upregulation by targeting c-jun[J]. J Cell Physiol. 2015;230:1630–9.
Sacha Robert T, Gicquel T, Victoni et al. Involvement of matrix metalloproteinases (MMPs) and inflammasome pathway in molecular mechanisms of fibrosis[J].Bioscience Reports(2016)36, e00360.
Xinhe WangYuedongHu,Jianyi, Cui et al. Coordinated targeting of MMP-2/MMP-9 by miR-296-3p/FOXCUT exerts tumor-suppressing e ects in choroidal malignant melanoma[J]. Molecular and Cellular Biochemistry,2018,445:25–33.

No competing interests reported.

Supplementalmaterial.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Identification and functional mechanism verification of key microRNAs associated with the fibrosis progression in chronic kidney disease

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Patient specimens

Mice models of DN and FSGS

MTT assay

RNA isolation and microarray profiling

In situ hybridization

Cell culture and miRNA transfection

Quantitative real‑time polymerase chain reaction（qRT-PCR）

Western blotting

Immunofluorescence Assay

Histology Staining

Luciferase Reporter Assays

Statistical analysis

Results

4.Expression of hsa-miR-1470-3p and hsa-miR-4483-3p in the kidney of disease model mice

Discussion

Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1